Given a sequence of nucleic acids and a translation table, this program generates a corresponding aminoacid sequence. The above terminology is explained with the following example, which uses the "standard code":
catgttagcagatcttctaagataactacgcatgactgactgactgactgatgact input sequence H V S R S S K I T T H D X L T D X X output translated
Indeed in the above example the translation table had the following relations:
Codon AminoAcid Codon Aminoacid Codon Aminoacid Codon Aminoacid 1 3 1 3 1 3 1 3 TTT F Phe TCT S Ser TAT Y Tyr TGT C Cys TTC F Phe TCC S Ser TAC Y Tyr TGC C Cys TTA L Leu TCA S Ser TAA X Ter TGA X Ter TTG L Leu i TCG S Ser TAG X Ter TGG W Trp CTT L Leu CCT P Pro CAT H His CGT R Arg CTC L Leu CCC P Pro CAC H His CGC R Arg CTA L Leu CCA P Pro CAA Q Gln CGA R Arg CTG L Leu i CCG P Pro CAG Q Gln CGG R Arg ATT I Ile ACT T Thr AAT N Asn AGT S Ser ATC I Ile ACC T Thr AAC N Asn AGC S Ser ATA I Ile ACA T Thr AAA K Lys AGA R Arg ATG M Met i ACG T Thr AAG K Lys AGG R Arg GTT V Val GCT A Ala GAT D Asp GGT G Gly GTC V Val GCC A Ala GAC D Asp GGC G Gly GTA V Val GCA A Ala GAA E Glu GGA G Gly GTG V Val GCG A Ala GAG E Glu GGG G Gly
The above table shows, for each codon, the corresponding aminoacid that is obtained upon translation, in its one (1) and three (3) letter notation. The Initiation codons are marked with a "i", while the Termination codons are identified by on letter symbol "X" and three letter "Ter".
Mode of operation
This program uses a pull-down menu and 2 windows: the pull-down menu is used to choose the translation table to use, while the windows are required in order to tell the program which sequence to use and return to the user the translated output. The top window should be filled from the user, with a sequence of interest, while the bottom one contains the result of the translation. The following steps must be performed:
- Choice of translation table
The officialtranslation tables as compiled by A.Elzanowski and J.Ostell (1996) are made available through this applet by a simple pull-down menu. In order to choose a translation table the user has simply to select it from the available list through the pull-down menu. User-provided translation tables are supported by the parameter mechanism of the applet, without need of modifying the program, details are provided in the html source of the page.- Sequence input
- Symbols used
Either paste or type in the top area the sequence of interest. Any character or symbol that does not belong to the [atcgATCG] set is ignored. The program assumes the Open Reading Frame being starting at the first base.- removal of header information
Only the sequence must be placed in the top window: heading comments must be removed- long sequences and small window
In order to allow users with small screens to still be able of using this program, the size of each window had been made rather small. Therefore, use the scroll-bars in order to move around in the input and output windows. The suggested strategy is to double click in the specified area and then do copy/paste from/to the text-editor of choice or across different applications.- Aminoacid code choice
By selecting anyone of the 2 choices provided, and hereafter described, the user has control on the aminoacid code used in the output, either being one letter or three letters, by clicking on the button close to them:
- One letter, generate the output with one letter per aminoacid (e.g DEA)
- Three letters, generate the output with three letters per aminoacid (e.g.AspGluAla)
- Translate
Once the sequence is placed in the top window, by pressing the "TRANSLATE" button then the translation is computed.