JaMBW Chapter 2.3

TranslatER


Aim

Given a sequence of nucleic acids and a translation table, this program generates a corresponding aminoacid sequence. The above terminology is explained with the following example, which uses the "standard code":


catgttagcagatcttctaagataactacgcatgactgactgactgactgatgact  input sequence
 H  V  S  R  S  S  K  I  T  T  H  D  X  L  T  D  X  X     output translated

Indeed in the above example the translation table had the following relations:



Codon AminoAcid Codon Aminoacid Codon Aminoacid Codon Aminoacid
      1  3            1  3            1  3            1  3
 TTT  F Phe      TCT  S Ser      TAT  Y Tyr      TGT  C Cys  
 TTC  F Phe      TCC  S Ser      TAC  Y Tyr      TGC  C Cys  
 TTA  L Leu      TCA  S Ser      TAA  X Ter      TGA  X Ter  
 TTG  L Leu i    TCG  S Ser      TAG  X Ter      TGG  W Trp  

 CTT  L Leu      CCT  P Pro      CAT  H His      CGT  R Arg  
 CTC  L Leu      CCC  P Pro      CAC  H His      CGC  R Arg  
 CTA  L Leu      CCA  P Pro      CAA  Q Gln      CGA  R Arg  
 CTG  L Leu i    CCG  P Pro      CAG  Q Gln      CGG  R Arg  

 ATT  I Ile      ACT  T Thr      AAT  N Asn      AGT  S Ser  
 ATC  I Ile      ACC  T Thr      AAC  N Asn      AGC  S Ser  
 ATA  I Ile      ACA  T Thr      AAA  K Lys      AGA  R Arg  
 ATG  M Met i    ACG  T Thr      AAG  K Lys      AGG  R Arg  

 GTT  V Val      GCT  A Ala      GAT  D Asp      GGT  G Gly  
 GTC  V Val      GCC  A Ala      GAC  D Asp      GGC  G Gly  
 GTA  V Val      GCA  A Ala      GAA  E Glu      GGA  G Gly  
 GTG  V Val      GCG  A Ala      GAG  E Glu      GGG  G Gly  

The above table shows, for each codon, the corresponding aminoacid that is obtained upon translation, in its one (1) and three (3) letter notation. The Initiation codons are marked with a "i", while the Termination codons are identified by on letter symbol "X" and three letter "Ter".

Mode of operation

This program uses a pull-down menu and 2 windows: the pull-down menu is used to choose the translation table to use, while the windows are required in order to tell the program which sequence to use and return to the user the translated output. The top window should be filled from the user, with a sequence of interest, while the bottom one contains the result of the translation. The following steps must be performed:

  1. Choice of translation table
    The officialtranslation tables as compiled by A.Elzanowski and J.Ostell (1996) are made available through this applet by a simple pull-down menu. In order to choose a translation table the user has simply to select it from the available list through the pull-down menu. User-provided translation tables are supported by the parameter mechanism of the applet, without need of modifying the program, details are provided in the html source of the page.
  2. Sequence input
    • Symbols used
      Either paste or type in the top area the sequence of interest. Any character or symbol that does not belong to the [atcgATCG] set is ignored. The program assumes the Open Reading Frame being starting at the first base.
    • removal of header information
      Only the sequence must be placed in the top window: heading comments must be removed
    • long sequences and small window
      In order to allow users with small screens to still be able of using this program, the size of each window had been made rather small. Therefore, use the scroll-bars in order to move around in the input and output windows. The suggested strategy is to double click in the specified area and then do copy/paste from/to the text-editor of choice or across different applications.
  3. Aminoacid code choice
    By selecting anyone of the 2 choices provided, and hereafter described, the user has control on the aminoacid code used in the output, either being one letter or three letters, by clicking on the button close to them:
    • One letter, generate the output with one letter per aminoacid (e.g DEA)
    • Three letters, generate the output with three letters per aminoacid (e.g.AspGluAla)
  4. Translate
    Once the sequence is placed in the top window, by pressing the "TRANSLATE" button then the translation is computed.