Table of Contents
Note: the screen shots may be out of sync with the latest version of S2S.
You have to start with an RNA secondary Structure. The "File -> Load..." menu allows you to:
- open a 2D stored in a CT (name ends with ".ct"), BPSEQ (name ends with ".bpseq") or FASTA (name ends with ".fasta", ".fna", ".fas",".fa" or ".txt") file. The 2D cannot describes any pseudoknots.
- open an RNA tertiary structure stored in a PDB file (name ends with ".pdb")
- open an RNA molecule stored in a FASTA file (name ends with ".fasta", ".fna", ".fas",".fa" or ".txt")
- open an RNA alignment stored in a Stockholm (name ends with ".stk") or FASTA file.
If you start from a PDB file, S2S will annotate it with a secondary structure. This will produce an "extended secondary structure", meaning a secondary structure extended with base-pair classification and tertiary interactions. If the 3D structure contains several RNA molecules, S2S will ask you to choose against which one you want to construct your alignment.
If you start from an RNA molecule without any structural information (a FASTA file for example), S2S will predict a secondary structure.
To load a secondary structure from a FASTA file, this secondary structure has to be described with the bracket notation and its id has to be "Secondary Structure":
>Secondary Structure
.......((((.....(((((((.((...((.(((........))).)).....)).))))...)))..((((..(((..(((....((((...((((
(...))))).....))))..)))..))).......))))........)))).
>RNA test
UAACAAUCUGCUGAAAGGUACCGUCGGAGGGAGCUUUGUUGCCAGCGCCAGAAACGCCGGUUUAACCAGCGCCGAAGUGAGCGCAGUGAUUAAAGCCA
UGCAGUGGCAAAUGGAUUUCCGCAAACUGAAAAAAGGCGAUGAAUUUGCGGU
To load an RNA alignment from a FASTA file, the first sequence has to describe the consensus secondary structure with the bracket notation and whose id is "Secondary Structure". All the other lines describe the RNA sequences with the "-" character for the gaps:
>Secondary Structure
..((((((.((.(.......((.....(.(.(.(.(.................((...............(((....(.((.................
))...))).)...))......................)))))...).)..(...((...((......(.((.......((....).).......))..
..)....)).....)).)...).))..).))))).
>seq1
--AGGAAC-GG-C-C-AU-ACC----AC-G-U-C-G---AU----------C-GC-A----------C--CAC----A-UC----CCGUCC-------
GC-UCUGU-GA-AGUUAA-G-----------------CGGCGUC-G-G--G---CC--AGGCUA--GUACUACGG--UGGGGGAC-C-ACGUG-GGG-
--G--ACCCU----GG-U---G-CU--G-UUCCU-
>seq2
--UCUGGC-GG-C-C-AU-AGC----GU-G-G-G-G---GA----------A-AC-G----------C--CCG----G-UC----CCAUCCC------
GA-ACCCG-GA-AGCUAA-G-----------------CCCCAUA-G-C--G---CC--GAUG----GUACUGCAA---CCGGGAG-G-UUGUG-GGA-
--G---AGUA----GG-U-C-G-CC--G-CCGGAC
At now, S2S cannot deal with secondary structures containing pseudo-knots and described in FASTA, Stockholm, CT or BPSEQ formats.
The first sequence used to create a new alignment is called the "reference molecule" and its secondary structure is called the "reference structure". This reference structure is displayed:
- as a bracket notation in the alignment panel. The following symbols are used:
- '(' and ')': for the canonical secondary interactions
- '<' and '<': for the non-canonical secondary interactions
- '.': for the single-strand regions
- '-': for the gaps
- as a 2D drawing in the 2D panel. This 2D drawing in linked to the alignment display. A selection in the alignment panel will highlight the counterpart in the 2D panel (and so will do the opposite).
The display of the alignment is splitted between several "alignment views". An alignment view is twice the same alignment whose orientation is reversed. Between the two reversed orientations, can be displayed the secondary and/or tertiary interactions using the
Leontis-Westhof classification.
Using these buttons

in the toolbar, you can add a new alignment view or remove the last one.
To add new sequences to your alignment, use "Import -> RNA Molecules". You can import them from CT, BPSEQ and FASTA files.
Using the FASTA format, you can also import RNA sequences containing gaps.
To display the new sequences, select an alignment view and, in the Preferences panel, increase the number of sequences displayed:
To navigate horizontally, you can:
- keep your mouse pressed on an alignment view and drag it
- select an alignment view by clicking on its upper-left circle and use the 'E' and 'R' keys to move on the left or on the right
- select an alignment view by clicking on its upper-left circle and use the left/right arrows in the "Alignment View Navigation" box.
When you navigate horizontally in an alignment view, the next alignment view will follow the move if the "Linked to next view" option is activated in the Preferences panel.
To navigate vertically, you can:
- place your mouse over an alignment view and use the wheel
- select an alignment view by clicking on its upper-left circle and use the up/down arrows in the "Alignment View Navigation" box.
At last, the toolbar provides buttons to zoom in/out your alignment:


With S2S, you have 3 main graphical features to help you to manage the construction of your alignment:
- the structural conservations according to the reference structure
- the display of the secondary and tertiary interactions in the space between alignment views
- the user selections
The structural conservations
The goal of a structural alignment is to find the conservation of the structure and not of the sequence. Consequently, the graphical engine of S2S has been designed to show you if your alignment conserves or not the local structure as described in the "reference structure".
S2S uses two different colors to display the secondary and the tertiary interactions. Each color is used to display to the user the local structural conservation.
According to the
Leontis-Westhof classification, there're 3 levels of conservation:
- level 1: the combination of the homologous residues chosen by the user with the type of interaction observed in the reference structure will be isosteric with the reference base-pair
- level 2: the combination of the homologous residues chosen by the user with the type of interaction observed in the reference structure is geometrically possible but not necessarily isosteric with the reference base-pair
- level 3: the combination of the homologous residues chosen by the user with the type of interaction observed in the reference structure has never been observed until now
The level 1 of conservation is displayed with the darkest color, the level 2 with a brighter one and the level 3 with no color.
Since a residue can participate to several base-base interactions (at most 3 base-base interactions, one per edge), the background color for each residue can be splitted according to this amount.
In the previous screenshot, the colors chosen are green for the tertiary interactions and brown for the secondary interactions. For the position 1617 of the alignment (lower alignment view), we have an A in the "reference sequence", establishing a cis-WatsonCrick-WatsonCrick secondary interaction with a C1572. This A makes also a trans-Hoogsteen-Watson-Crick tertiary interaction with a C1568 (we have a "triple interaction").
For the sequences S13 and S14, the user decides that the homologous residues are:
- C and A for the C1572
- C and U for the C1568
- A and U for the A1617
According to the colors displayed, we can say that S13 is isosteric with the reference secondary and tertiary interactions. S12 is isosteric only for the tertiary interaction. The color for the secondary interaction is brighter and so this combination is geometrically possible, but not necessarily isosteric.
In the sequence S14, we can also see that for the secondary interaction between the A1536 and U1654, the user has constructed a combination never observed until now (the background color is white).
To choose different colors, keep the right mouse button pressed on the alignment panel. A popup menu will appear. Your choices will also influence the 2D panel. Using the "Set Current Colors as Default" options, S2S saves the current colors in its configuration file.
You can define your own isostericity rules using the "LWMatrices" panel. Double-click on a cell and set the value you want. Base-pairs with cells having the same values will be isosteric. If a base-pair's cell is not empty, this means that this combination is geometrically possible. If it is empty, it has never been observed.
The display of the secondary and tertiary interactions
When an alignment view is selected by clicking on its upper-left circle, you can tweak the base-base interactions displayed in the space between this alignment view and the next one. To do so, use one of the following options of the "Alignment View Display" box:
- Filter: in the field beside this button, describe a range of residues. Only the interactions established by these residues are displayed. The range is defined using the following syntax: start-end,start-end,.... For example, "790-800,810-820" means residues between the positions 790 to 800 of the alignment AND 810 to 820. To redisplay all the interactions, erase your selection range and click the "Filter" button.
- Restrict to the selection: if some residues are selected in the corresponding alignment view, only the interactions established by these residues are displayed
- Secondary Interactions: display/hide the secondary interactions
- Tertiary Interactions: display/hide the tertiary interactions
Using the "BaseBase Interactions Display" box, you can also display/hide base-base interactions according to their families. This option will also influence the 2D drawing of the 2D panel.
The user selections
You have several ways to make a selection:
- Depending on the selection mode in the toolbar:
- "Residues" mode: click on a residue in the 2D or the alignment panel to select it
- "Interactions" mode: click on a residue in the alignment panel to select this residue and all its partners. In the 2D panel, click in the center of a base-base interaction to select it
- "Structural Domains" mode: click on a residue in the alignment panel to select all the residues of the corresponding structural domain (helix or single-strand). In the 2D panel, click in the center of the structural domain to select it.
In the 2D panel, if the selection is made with the "Shift" key pressed, this will merge the selections. This "Shift" key used in the alignment panel will select all the residues between the residue just clicked and the first residue selected meet in the upstream direction of the alignment.
- open the "Sequences" panel, select one or several sequences, right click on them and use the "Search motif" option. Describe the motifs you search using a classical regular expression syntax.
Using this button

in the toolbar, you can save the residues selected as a user-defined selection. This selection will appear in the 2D explorer panel. Right-click on it to rename or delete it.
Change the position of residues in an RNA sequence
Press the 'i' key to be in the 'gap insertion" mode. Click on the bracket notation or on the "alignment meter" above it to insert a column of gaps. The gaps allow you to move your residues:
- select an alignment view and a residue inside it. Press 'o' or 'p' keys to move the residues on the left or on the right
- select an alignment view, a residue inside it and an other one with the "shift" key pressed. Press 'o' or 'p' keys to move the range of residues selected on the left or on the right. If this range contains, they will move along.
Press the 'd' key to delete column filled with gaps only. Click on the bracket notation or on the "alignment meter" above it to delete it.
Press the 's' key to come back to the "standard" mode (no insertion and deletion after a mouse click).
Change the position of an RNA sequence in the alignment
In the "Sequences" panel, drag an drop a sequence to the position you want.
What is described here works only if you have constructed your alignment from a PDB file. In the toolbar, you will find a button to launch the
PyMOL application (
Chimera and
VMD will come with the next updates).
Install and use PyMOL
PyMOL is still freely available at
this address. When you start PyMOL for the first time, S2S asks your for its location. Precise to S2S the absolute path of the PyMOL executable file. If you gave a wrong path, you can enter a new one by clicking on the same button with the "Shift" key pressed.
You have to precise the location of the "real" executable file. For example, if you're using MacOSX and MacPyMOL, it is not "/Applications/MacPyMOL.app/" but "/Applications/MacPyMOL.app/Contents/MacOS/MacPyMOL".
S2S saves your structural alignment in its own format. It can also export your data to several formats to allow you to pursue your work with other bioinformatics softwares.
Save your alignment
S2S allows you to save your data in binary or textual files using the "Save Alignment As..." choice.
Each file format has its own advantages and drawbacks:
- the textual format takes more time to be saved and reloaded. But it is compatible with all the S2S versions. It is also human-readable and searchable by tools like grep or awk
- the binary format is faster to be saved and reloaded. But it is only compatible with the version of S2S which produces it.
When your data are saved using the textual format, S2S creates a directory with the name you have chosen. It contains four sub-directories:
- TertiaryStructures: stores the data for the 3D structures
- SecondaryStructures: stores the data for the 2D structures
- StructuralAlignments: stores the data for the structural alignments
- Molecules: stores the molecules annotated by the data stored in the three other directories
You can reopen your saved structural alignment with File -> Load S2S Alignment.
Export your data
The File menu allows you to:
- export your alignment in a FASTA file
- export your secondary structure in a CT file
- export the selections done in the alignment panel in a FASTA file
- export the structural domains selected in the 2D panel in a CT file (for details you can read this blog post)
In the toolbar, you can:
- export in a PNG file the current alignment or 2D display using one of the capture buttons

- with this button
, select a sequence in the "Sequences" panel and click it to infer a 2D/3D model. This model can then be loaded by the Assemble application. You can have more details in a video tutorial of the Assemble website