ViewVC Help
View File | Revision Log | Show Annotations | Root Listing
root/PrimerMatch/pcr_match.htm
Revision: 1.1.1.1 (vendor branch)
Committed: Wed Dec 22 21:37:18 2004 UTC (11 years, 5 months ago) by nje01
Branch: MAIN
CVS Tags: HEAD, RELEASE-20041222, HEAD
Changes since 1.1: +0 -0 lines
Log Message:
Initial primer_match import

Line File contents
1 <html>
2 <p align="center"><font face="Arial" size="+2">pcr_match</font></p>
3
4 <h3>Name</h3>
5 <blockquote>
6 <p><b>pcr_match</b> - Find primer pairs in a DNA
7 sequence database</p>
8 </blockquote>
9 <h3>Synopsis</h3>
10 <blockquote>
11 <p><b>pcr_match</b> [
12 <i> options</i> ]</p>
13 </blockquote>
14 <h3>Description</h3>
15 <blockquote>
16 <p><b>pcr_match</b> finds pairs of short
17 DNA sequences, usually primers, in a (much) larger DNA sequence database such as the human genome.&nbsp;</p>
18 <p>By default, <b> pcr_match</b> outputs a human readable
19 alignment for each occurance of a primer in the sequence database. The format of the alignments is completely configurable with the
20 <u> -A</u> options.</p>
21 <p><b>pcr_match </b>runs fastest when the sequence database has been
22 pre-processed with <b>compress_seq</b>, but this is not necessary. If the
23 sequence database has not been pre-processed with <b>compress_seq</b>, the
24 sequence database <u>must</u> be in a regular FASTA format. Each line, except
25 for the last, of every sequence entry must hold the same number of sequence
26 characters. If the sequence database is not in a regular FASTA format, the
27 results may be incorrect. <b>pcr_match</b> will warn the user if the FASTA
28 format is not in a regular format.&nbsp;</p>
29 </blockquote>
30 <h3>Options</h3>
31 <blockquote>
32 <p>-i <i>FASTA_sequence_database</i></p>
33 <blockquote>
34 <p>Name of the sequence database to search. Required.</p>
35 </blockquote>
36 <p>-p <i> primers</i></p>
37 <blockquote>
38 <p>White space (space, tab, new line) separated list of primer sequences to find in the sequence database. When this
39 opition is used on the command line, the primers will usually need to be placed in quotes (&quot;).
40 The primer pairs must be consecutive in the list of primers. One of
41 <u>-p</u>, <u>-P</u>, <u>-F, </u>or <u>-S</u> must be supplied.</p>
42 </blockquote>
43 <p>-P <i>primer_file</i></p>
44 <blockquote>
45 <p>File containing a white space (space, tab, new line) separated list of primer
46 sequences to find in the sequence database. The primer pairs must be consecutive
47 in the list of primers. One of
48 <u>-p</u>, <u>-P</u>, <u>-F, </u>or <u>-S</u> must be supplied.</p>
49 </blockquote>
50 <p>-F <i>fasta_primer_file</i></p>
51 <blockquote>
52 <p>FASTA file containing a list of primer sequences to find in the sequence
53 database. The primer pairs must be consecutive in the list of primers. One of
54 <u>-p</u>, <u>-P</u>, <u>-F, </u>or <u>-S</u> must be supplied.</p>
55 </blockquote>
56 <p>-S <i>sts-format-file</i></p>
57 <blockquote>
58 <p>UniSTS format file containing a list of primer pairs to find in the sequence
59 database. One of
60 <u>-p</u>, <u>-P</u>, <u>-F, </u>or <u>-S</u> must be supplied.</p>
61 </blockquote>
62 <p>-o <i> output_file</i></p>
63 <blockquote>
64 <p>Output is redirected into the file <i>output_file</i>. If absent, output goes to standard out.</p>
65 </blockquote>
66 <p>-k <i> edit_distance</i></p>
67 <blockquote>
68 <p>The maximum number of insertions, deletions, and substitutions permitted in any primer alignment. If absent, edit distance 0 is assumed.&nbsp;</p>
69 </blockquote>
70 <p>-K <i>mismatches</i></p>
71 <blockquote>
72 <p>The maximum number of mismatches permitted in any primer alignment. </p>
73 </blockquote>
74 <p>-r&nbsp;</p>
75 <blockquote>
76 <p> Reverse complement the reverse complement (second) primer. This option is
77 automatically set, for UniSTS format primer pairs. Default: false.</p>
78 </blockquote>
79 <p>-a</p>
80 <blockquote>
81 <p> Output all primer pair orientations. Default: false.</p>
82 </blockquote>
83 <p>-<i>x l&nbsp;</i></p>
84 <blockquote>
85 <p>Length of exact seed or word size, ala blast, required by any primer
86 alignment. Can be combined with other options.</p>
87 </blockquote>
88 <p>-s (<i> l | ~l </i>)<i>&nbsp;</i></p>
89 <blockquote>
90 <p> Constrain the first<i> l </i>primer characters to match exactly; any insertions, deletions or substitutions must occur after position<i>
91 l</i>. The reverse complement of a primer must also have its first <i> l </i> characters
92 match exactly. Note that a wildcard match is considered an exact match. With
93 the ~ modifier, the first <i>l</i> primer characters are constrained to
94 match inexactly, the remaining characters must match exactly.&nbsp;</p>
95 </blockquote>
96 <p>-e (<i> l | ~l </i>)<i>&nbsp;</i></p>
97 <blockquote>
98 <p> Constrain the last <i> l </i>primer characters to match exactly; any insertions, deletions or substitutions must occur before position<i>
99 l</i>. The reverse complement of a primer must also have its last<i> l</i> characters
100 match exactly. Note that a wildcard match is considered an exact
101 match.&nbsp; With the ~ modifier, the last <i>l</i> primer characters are
102 constrained to match inexactly, the remaining characters must match exactly.</p>
103 </blockquote>
104 <p>-5<i> </i>(<i> l | ~l </i>)</p>
105 <blockquote>
106 <p> Constrain the<i> l </i>primer characters at the 5' end of the primer to match
107 exactly; any insertions, deletions or substitutions must occur after position<i> l
108 </i> from the 5' end of the primer. The reverse complement of a primer must also
109 have the<i> l </i>characters at its 5' end match exactly. Note that a wildcard
110 match is considered an exact match. With the ~ modifier, the <i>l</i> primer
111 characters at the 5' end of the primer are constrained to match inexactly, the
112 remaining characters must match exactly.&nbsp;</p>
113 </blockquote>
114 <p>-3<i> </i>(<i> l | ~l </i>)&nbsp;</p>
115 <blockquote>
116 <p> Constrain the<i> l </i>primer characters at the 3' end of a primer to match
117 exactly; any insertions, deletions or substitutions must occur after position<i> l
118 </i> from the 3' end of the primer. The reverse complement of a primer must also have the<i> l
119 </i> characters at its 3' end match exactly. Note that a wildcard match is
120 considered an exact match. With the ~ modifier, the <i>l</i> primer characters
121 at the 3' end of the primer are constrained to match inexactly, the remaining
122 characters must match exactly.&nbsp;</p>
123 </blockquote>
124 <p>-w&nbsp;</p>
125 <blockquote>
126 <p> Respect IUPAC ambiguity codes as wildcards, in both the sequence database <i>and</i>
127 the primers. A symbol from the sequence database is considered a wildcard match
128 to a primer symbol if either set of represented DNA symbols contains the other.
129 The only exception is that a N in the sequence database does not match any
130 primer symbol. Note: this is almost certainly what you want, as long stretches
131 of Ns are often used to indicate gaps in assembled sequence.&nbsp;</p>
132 </blockquote>
133 <p>-W&nbsp;</p>
134 <blockquote>
135 <p>Respect IUPAC ambiguity codes as wildcards, in both the sequence database <i>and</i>
136 the primers. A symbol from the sequence database is considered a wildcard match
137 to a primer symbol if either set of represented DNA symbols contains the other.
138 Also respects Ns in the sequence databases.&nbsp;&nbsp;</p>
139 </blockquote>
140 <p>-u&nbsp;</p>
141 <blockquote>
142 <p>Force all primers to uppercase characters.</p>
143 </blockquote>
144 <p>-m <i> min-length</i></p>
145 <blockquote>
146 <p>Minimum length, in bases, of the amplicon product of the primer pairs.
147 Default: 0.</p>
148 </blockquote>
149 <p>-M <i> max-length</i></p>
150 <blockquote>
151 <p>Maximum length, in bases, of the amplicon product of the primer pairs.
152 Default: 2000.</p>
153 </blockquote>
154 <p>-d <i>deviation</i></p>
155 <blockquote>
156 <p>Maximum deviation of the length, in bases, of the amplicon product of the
157 primer pairs from the length specified in the UniSTS format primer file. UniSTS
158 format primers required. Default: no constraint. </p>
159 </blockquote>
160 <p>-b </p>
161 <blockquote>
162 <p>Measure the length of amplicon as number of bases <i>between</i> primers.</p>
163 </blockquote>
164 <p>-A <i> format</i></p>
165 <blockquote>
166 <p>Output format for primer alignments. See <b> Output Format</b> below. If present, alignments will be output.</p>
167 </blockquote>
168 <p>-R <i> report_interval</i></p>
169 <blockquote>
170 <p>Usually, <b> primer_match</b> accumulates many matches before taking the time
171 to output alignments. This reduces the running time tremendously. However, if you are debugging or want reassurance that
172 <b> primer_match</b> is actually doing something, setting <i> report_interval</i>
173 to 1 will force <b>primer_match</b> to report alignments as they are found.</p>
174 </blockquote>
175 <p>-E <i> eos</i></p>
176 <blockquote>
177 <p>Consider the sequence character with ascii code <i> eos</i> to represent the
178 end of the sequence in a FASTA entry. This character can never be part of an alignment, except if explicitly included in a primer sequence.
179 By default, 12 (new line) is considered the end of sequence character. The end of sequence character is inserted by
180 <b> compress_seq</b>.</p>
181 </blockquote>
182 <p>-D ( <i>0</i> | <i>1</i> | <i>2</i> | <i>3</i> | <i>4</i> )&nbsp;</p>
183 <blockquote>
184 <p>Select the sequence database pre-processing strategy. The default, 0, will
185 choose the fastest strategy, based on the pre-processing done, or not done, by <b>compress_seq</b>.</p>
186 <ol>
187 <li>Sequence database has not been pre-processed.</li>
188 <li>Sequence database has been indexed by <b>compress_seq</b>. This is the
189 default behavior of <b>compress_seq</b>.</li>
190 <li>Sequence database has been indexed and normalized by <b>compress_seq</b>,
191 using the option <u>-n true</u>.</li>
192 <li>Sequence database has been indexed, normalized and compressed by <b>compress_seq</b>,
193 using the option <u>-z true</u>.</li>
194 </ol>
195 <p>Given the availability of pre-processed sequence database files, option 3 is
196 selected first, then option 4, then option 2, then option 1. This will typically
197 represent the fastest possible run time.&nbsp;</p>
198 </blockquote>
199 <p>-B</p>
200 <blockquote>
201 <p>Use buffered standard I/O rather than mmap to stream through the sequence
202 database. On some platforms, where the use of mmap is somewhat unpredictable,
203 this option may make it possible to run <b>primer_match</b> reliably.&nbsp;</p>
204 </blockquote>
205 <p>-v&nbsp;</p>
206 <blockquote>
207 <p>Verbose (version &amp; diagnostic) output.</p>
208 </blockquote>
209 <p>-h&nbsp;</p>
210 <blockquote>
211 <p> Command-line help.</p>
212 </blockquote>
213 </blockquote>
214 <h3>Output Format</h3>
215 <blockquote>
216 <p>The an example of the default alignment output format </p>
217 <pre><font face="Courier New" size="2">&gt;gi|21700565|gb|AC092408.3| Papio anubis clone RP41-446H8, complete sequence
218 CTTGTAATCCCAGAACTTTGG 57681 ... 1714 ... 59395 CCCCGTCTCTACTAAAAATA
219 ||^||||||||||*||||||| |||||||||||||*||||||
220 CT-GTAATCCCAGGACTTTGG F R CCCCGTCTCTACTTAAAATA D11S3114 REVERSE-STRAND</font></pre>
221 <p>The command line option <u> -A</u> give the user explicit control over the
222 output of alignments respectively. Each format string contains conversion characters, which specify pieces of the alignment or count
223 output.</p>
224 <p>Alignment format conversion characters:</p>
225 </blockquote>
226 <div align="center">
227 <center>
228 <table border="0" width="100%" height="1191">
229 <tr>
230 <td width="12%" valign="top" align="left" height="19"></td>
231 <td width="8%" valign="top" align="left" height="19">%h&nbsp;</td>
232 <td width="89%" valign="top" align="left" height="19">FASTA header (defline) of the sequence entry containing the alignment.</td>
233 </tr>
234 <tr>
235 <td width="12%" valign="top" align="left" height="38"></td>
236 <td width="8%" valign="top" align="left" height="38">%H</td>
237 <td width="89%" valign="top" align="left" height="38"> First &quot;word&quot; of the FASTA
238 header (defline) of the sequence entry containing the alignment. The first word is everything up to (but not
239 including) the first whitespace character of the defline.</td>
240 </tr>
241 <tr>
242 <td width="12%" valign="top" align="left" height="19"></td>
243 <td width="8%" valign="top" align="left" height="19">%f</td>
244 <td width="89%" valign="top" align="left" height="19"> Index of the FASTA entry containing
245 the alignment.</td>
246 </tr>
247 <tr>
248 <td width="12%" valign="top" align="left" height="19"></td>
249 <td width="8%" valign="top" align="left" height="19">%&gt;s</td>
250 <td width="89%" valign="top" align="left" height="19"> Start position of the
251 &quot;left&quot; primer alignment
252 within the FASTA entry (space based).</td>
253 </tr>
254 <tr>
255 <td width="12%" valign="top" align="left" height="19"></td>
256 <td width="8%" valign="top" align="left" height="19">%&lt;s</td>
257 <td width="89%" valign="top" align="left" height="19"> Start position of the
258 &quot;right&quot; primer alignment
259 within the FASTA entry (space based).</td>
260 </tr>
261 <tr>
262 <td width="12%" valign="top" align="left" height="19"></td>
263 <td width="8%" valign="top" align="left" height="19">%&gt;e</td>
264 <td width="89%" valign="top" align="left" height="19"> End position of the
265 &quot;left&quot; primer alignment in the FASTA entry (space based).</td>
266 </tr>
267 <tr>
268 <td width="12%" valign="top" align="left" height="19"></td>
269 <td width="8%" valign="top" align="left" height="19">%&lt;e</td>
270 <td width="89%" valign="top" align="left" height="19"> End position of the
271 &quot;right&quot; primer alignment in the FASTA entry (space based).</td>
272 </tr>
273 <tr>
274 <td width="12%" valign="top" align="left" height="19"></td>
275 <td width="8%" valign="top" align="left" height="19">%&gt;l</td>
276 <td width="89%" valign="top" align="left" height="19"> Length of the
277 &quot;left&quot; primer alignment.</td>
278 </tr>
279 <tr>
280 <td width="12%" valign="top" align="left" height="19"></td>
281 <td width="8%" valign="top" align="left" height="19">%&lt;l</td>
282 <td width="89%" valign="top" align="left" height="19"> Length of the
283 &quot;right&quot; primer alignment.</td>
284 </tr>
285 <tr>
286 <td width="12%" valign="top" align="left" height="19"></td>
287 <td width="8%" valign="top" align="left" height="19">%l</td>
288 <td width="89%" valign="top" align="left" height="19"> Length of the
289 amplicon.</td>
290 </tr>
291 <tr>
292 <td width="12%" valign="top" align="left" height="19"></td>
293 <td width="8%" valign="top" align="left" height="19">%&gt;5</td>
294 <td width="89%" valign="top" align="left" height="19"> Position of the 5' end of the
295 &quot;left&quot; primer alignment in the sequence entry (space
296 based).</td>
297 </tr>
298 <tr>
299 <td width="12%" valign="top" align="left" height="19"></td>
300 <td width="8%" valign="top" align="left" height="19">%&lt;5</td>
301 <td width="89%" valign="top" align="left" height="19"> Position of the 5' end of the
302 &quot;right&quot; primer alignment in the sequence entry (space
303 based).</td>
304 </tr>
305 <tr>
306 <td width="12%" valign="top" align="left" height="19"></td>
307 <td width="8%" valign="top" align="left" height="19">%&gt;3</td>
308 <td width="89%" valign="top" align="left" height="19"> Position of the 3' end of the
309 &quot;left&quot; primer alignment in the sequence entry (space
310 based).</td>
311 </tr>
312 <tr>
313 <td width="12%" valign="top" align="left" height="19"></td>
314 <td width="8%" valign="top" align="left" height="19">%&lt;3</td>
315 <td width="89%" valign="top" align="left" height="19"> Position of the 3' end of the
316 &quot;right&quot; primer alignment in the sequence entry (space
317 based).</td>
318 </tr>
319 <tr>
320 <td width="12%" valign="top" align="left" height="19"></td>
321 <td width="8%" valign="top" align="left" height="19">%&gt;S</td>
322 <td width="89%" valign="top" align="left" height="19"> Start position (absolute) of the
323 &quot;left&quot; primer alignment in the sequence database.</td>
324 </tr>
325 <tr>
326 <td width="12%" valign="top" align="left" height="19"></td>
327 <td width="8%" valign="top" align="left" height="19">%&lt;S</td>
328 <td width="89%" valign="top" align="left" height="19"> Start position (absolute) of the
329 &quot;right&quot; primer alignment in the sequence database.</td>
330 </tr>
331 <tr>
332 <td width="12%" valign="top" align="left" height="19"></td>
333 <td width="8%" valign="top" align="left" height="19">%&gt;E&nbsp;</td>
334 <td width="89%" valign="top" align="left" height="19"> End position (absolute) of the
335 &quot;left&quot; primer alignment in the sequence database.</td>
336 </tr>
337 <tr>
338 <td width="12%" valign="top" align="left" height="19"></td>
339 <td width="8%" valign="top" align="left" height="19">%&lt;E&nbsp;</td>
340 <td width="89%" valign="top" align="left" height="19"> End position (absolute) of the
341 &quot;right&quot; primer alignment in the sequence database.</td>
342 </tr>
343 <tr>
344 <td width="12%" valign="top" align="left" height="19"></td>
345 <td width="8%" valign="top" align="left" height="19">%i</td>
346 <td width="89%" valign="top" align="left" height="19"> Index of the aligned primer
347 pair.</td>
348 </tr>
349 <tr>
350 <td width="12%" valign="top" align="left" height="19"></td>
351 <td width="8%" valign="top" align="left" height="19">%&gt;d</td>
352 <td width="89%" valign="top" align="left" height="19">Edit distance (number of insertions, deletions, substitutions) of the
353 &quot;left&quot; primer alignment.</td>
354 </tr>
355 <tr>
356 <td width="12%" valign="top" align="left" height="19"></td>
357 <td width="8%" valign="top" align="left" height="19">%&lt;d</td>
358 <td width="89%" valign="top" align="left" height="19">Edit distance (number of insertions, deletions, substitutions) of the
359 &quot;right&quot; primer alignment.</td>
360 </tr>
361 <tr>
362 <td width="12%" valign="top" align="left" height="19"></td>
363 <td width="8%" valign="top" align="left" height="19">%&gt;p</td>
364 <td width="89%" valign="top" align="left" height="19"> The (forward) sequence of the
365 &quot;left&quot; primer, whether it was found in its
366 forward or reverse complement form.</td>
367 </tr>
368 <tr>
369 <td width="12%" valign="top" align="left" height="19"></td>
370 <td width="8%" valign="top" align="left" height="19">%&lt;p</td>
371 <td width="89%" valign="top" align="left" height="19"> The (forward) sequence of the
372 &quot;right&quot; primer, whether it was found in its
373 forward or reverse complement form.</td>
374 </tr>
375 <tr>
376 <td width="12%" valign="top" align="left" height="19"></td>
377 <td width="8%" valign="top" align="left" height="19">%&gt;P</td>
378 <td width="89%" valign="top" align="left" height="19"> The FASTA header (defline) of
379 the &quot;left&quot; primer, if the primers came from a FASTA format file. Otherwise,
380 &quot;&quot;.</td>
381 </tr>
382 <tr>
383 <td width="12%" valign="top" align="left" height="19"></td>
384 <td width="8%" valign="top" align="left" height="19">%&lt;P</td>
385 <td width="89%" valign="top" align="left" height="19"> The FASTA header (defline) of
386 the &quot;right&quot; primer, if the primers came from a FASTA format file. Otherwise,
387 &quot;&quot;.</td>
388 </tr>
389 <tr>
390 <td width="12%" valign="top" align="left" height="19"></td>
391 <td width="8%" valign="top" align="left" height="19">%I</td>
392 <td width="89%" valign="top" align="left" height="19"> The STS identifier
393 of the primer pair, if the primers came from a UniSTS format file. Otherwise,
394 &quot;&quot;.</td>
395 </tr>
396 <tr>
397 <td width="12%" valign="top" align="left" height="19"></td>
398 <td width="8%" valign="top" align="left" height="19">%L</td>
399 <td width="89%" valign="top" align="left" height="19"> The STS length of
400 the primer pair, if the primers came from a UniSTS format file. Otherwise,
401 &quot;&quot;.</td>
402 </tr>
403 <tr>
404 <td width="12%" valign="top" align="left" height="19"></td>
405 <td width="8%" valign="top" align="left" height="19">%D</td>
406 <td width="89%" valign="top" align="left" height="19"> The absolute value
407 of the difference between the length of the amplicon and the STS length of
408 the primer pair, if the primers came from a UniSTS format file.</td>
409 </tr>
410 <tr>
411 <td width="12%" valign="top" align="left" height="19"></td>
412 <td width="8%" valign="top" align="left" height="19">%a</td>
413 <td width="89%" valign="top" align="left" height="19"> The STS accession
414 of the primer pair, if the primers came from a UniSTS format file. Otherwise,
415 &quot;&quot;.</td>
416 </tr>
417 <tr>
418 <td width="12%" valign="top" align="left" height="19"></td>
419 <td width="8%" valign="top" align="left" height="19">%O</td>
420 <td width="89%" valign="top" align="left" height="19"> The STS organism of
421 the primer pair, if the primers came from a UniSTS format file. Otherwise,
422 &quot;&quot;.</td>
423 </tr>
424 <tr>
425 <td width="12%" valign="top" align="left" height="19"></td>
426 <td width="8%" valign="top" align="left" height="19">%&amp;</td>
427 <td width="89%" valign="top" align="left" height="19"> The alternative STS
428 accessions of the primer pair, if the primers came from a UniSTS format
429 file. Otherwise,
430 &quot;&quot;.</td>
431 </tr>
432 <tr>
433 <td width="12%" valign="top" align="left" height="19"></td>
434 <td width="8%" valign="top" align="left" height="19">%X</td>
435 <td width="89%" valign="top" align="left" height="19"> The STS chromosome
436 of the primer pair, if the primers came from a UniSTS format file. Otherwise,
437 &quot;&quot;.</td>
438 </tr>
439 <tr>
440 <td width="12%" valign="top" align="left" height="19"></td>
441 <td width="8%" valign="top" align="left" height="19">%&gt;q</td>
442 <td width="89%" valign="top" align="left" height="19"> The &quot;left&quot; primer sequence of the alignment.</td>
443 </tr>
444 <tr>
445 <td width="12%" valign="top" align="left" height="19"></td>
446 <td width="8%" valign="top" align="left" height="19">%&lt;q</td>
447 <td width="89%" valign="top" align="left" height="19"> The &quot;right&quot; primer sequence of the alignment.</td>
448 </tr>
449 <tr>
450 <td width="12%" valign="top" align="left" height="19"></td>
451 <td width="8%" valign="top" align="left" height="19">%&gt;Q</td>
452 <td width="89%" valign="top" align="left" height="19">The &quot;left&quot; primer sequence of the alignment, with alignment characters to
453 indicate an insertion.</td>
454 </tr>
455 <tr>
456 <td width="12%" valign="top" align="left" height="19"></td>
457 <td width="8%" valign="top" align="left" height="19">%&lt;Q</td>
458 <td width="89%" valign="top" align="left" height="19">The &quot;right&quot; primer sequence of the alignment, with alignment characters to
459 indicate an insertion.</td>
460 </tr>
461 <tr>
462 <td width="12%" valign="top" align="left" height="19"></td>
463 <td width="8%" valign="top" align="left" height="19">%&gt;t</td>
464 <td width="89%" valign="top" align="left" height="19"> The &quot;left&quot; aligned sequence from the sequence database.</td>
465 </tr>
466 <tr>
467 <td width="12%" valign="top" align="left" height="19"></td>
468 <td width="8%" valign="top" align="left" height="19">%&lt;t</td>
469 <td width="89%" valign="top" align="left" height="19"> The &quot;right&quot; aligned sequence from the sequence database.</td>
470 </tr>
471 <tr>
472 <td width="12%" valign="top" align="left" height="19"></td>
473 <td width="8%" valign="top" align="left" height="19">%&gt;T</td>
474 <td width="89%" valign="top" align="left" height="19"> The &quot;left&quot; aligned sequence from the sequence database, with alignment
475 characters to indicate deletion.</td>
476 </tr>
477 <tr>
478 <td width="12%" valign="top" align="left" height="19"></td>
479 <td width="8%" valign="top" align="left" height="19">%&lt;T</td>
480 <td width="89%" valign="top" align="left" height="19"> The &quot;right&quot; aligned sequence from the sequence database, with alignment
481 characters to indicate deletion.</td>
482 </tr>
483 <tr>
484 <td width="12%" valign="top" align="left" height="19"></td>
485 <td width="8%" valign="top" align="left" height="19">%&gt;A</td>
486 <td width="89%" valign="top" align="left" height="19"> The string of alignment characters indicating exact match, insertion,
487 deletion and subsitution at each position of the &quot;left&quot; primer alignment.</td>
488 </tr>
489 <tr>
490 <td width="12%" valign="top" align="left" height="19"></td>
491 <td width="8%" valign="top" align="left" height="19">%&lt;A</td>
492 <td width="89%" valign="top" align="left" height="19"> The string of alignment characters indicating exact match, insertion,
493 deletion and subsitution at each position of the &quot;right&quot; primer alignment.</td>
494 </tr>
495 <tr>
496 <td width="12%" valign="top" align="left" height="19"></td>
497 <td width="8%" valign="top" align="left" height="19">%&gt;r</td>
498 <td width="89%" valign="top" align="left" height="19"> &quot;F&quot; if the forward form of the
499 &quot;left&quot; primer was found, &quot;R&quot;
500 if the reverse complement form of the &quot;left&quot; primer was found.</td>
501 </tr>
502 <tr>
503 <td width="12%" valign="top" align="left" height="19"></td>
504 <td width="8%" valign="top" align="left" height="19">%&lt;r</td>
505 <td width="89%" valign="top" align="left" height="19"> &quot;F&quot; if the forward form of the
506 &quot;right&quot; primer was found, &quot;R&quot;
507 if the reverse complement form of the &quot;left&quot; primer was found.</td>
508 </tr>
509 <tr>
510 <td width="12%" valign="top" align="left" height="19"></td>
511 <td width="8%" valign="top" align="left" height="19">%&gt;R</td>
512 <td width="89%" valign="top" align="left" height="19">
513 <p> &quot; REVCOMP&quot; if the reverse complement form of the &quot;left&quot; primer was
514 found, &quot;&quot; otherwise.</p>
515 </td>
516 </tr>
517 <tr>
518 <td width="12%" valign="top" align="left" height="19"></td>
519 <td width="8%" valign="top" align="left" height="19">%&lt;R</td>
520 <td width="89%" valign="top" align="left" height="19">
521 <p> &quot; REVCOMP&quot; if the reverse complement form of the &quot;right&quot; primer was
522 found, &quot;&quot; otherwise.</p>
523 </td>
524 </tr>
525 <tr>
526 <td width="12%" valign="top" align="left" height="19"></td>
527 <td width="8%" valign="top" align="left" height="19">%R</td>
528 <td width="89%" valign="top" align="left" height="19">
529 <p> &quot; REVERSE-STRAND&quot; if the primer pair was found in reverse strand
530 orientation (second primer first), &quot;&quot; otherwise.</p>
531 </td>
532 </tr>
533 <tr>
534 <td width="12%" valign="top" align="left" height="19"></td>
535 <td width="8%" valign="top" align="left" height="19">%@</td>
536 <td width="89%" valign="top" align="left" height="19"> The sequence of the
537 amplicon amplified by the primer pair.</td>
538 </tr>
539 <tr>
540 <td width="12%" valign="top" align="left" height="19"></td>
541 <td width="8%" valign="top" align="left" height="19">%N</td>
542 <td width="89%" valign="top" align="left" height="19"> The number of N's
543 in the sequence of the amplicon &quot;amplified&quot; by the primer pair.</td>
544 </tr>
545 <tr>
546 <td width="12%" valign="top" align="left" height="19"></td>
547 <td width="8%" valign="top" align="left" height="19">%0</td>
548 <td width="89%" valign="top" align="left" height="19"> e-PCR format
549 output.</td>
550 </tr>
551 <tr>
552 <td width="12%" valign="top" align="left" height="19"></td>
553 <td width="8%" valign="top" align="left" height="19">%%</td>
554 <td width="89%" valign="top" align="left" height="19"> Percent (%).</td>
555 </tr>
556 </table>
557 </center>
558 </div>
559 <blockquote>
560 <p>The default alignment format is &quot;&gt;%h\n %&gt;T %&gt;s ... %l ... %&lt;e %&lt;T\n %&gt;A %!&gt;s
561 %!l %!&lt;e %&lt;A\n %&gt;Q %&gt;r%!&gt;s %!l %!&lt;e%&lt;r %&lt;Q %a%R\n&quot;. The character '!' in
562 the format indicates that the number of characters occupied by the formated data
563 should output as spaces.</p>
564 </blockquote>
565 <h3>See Also</h3>
566 <blockquote>
567 <p><b><a href="primer_match.htm">primer_match</a>, <a href="compress_seq.htm">compress_seq</a></b></p>
568 </blockquote>
569 <h3>Author</h3>
570 <blockquote>
571 <p>Nathan Edwards</p>
572 </blockquote>
573 </html>