ViewVC Help
View File | Revision Log | Show Annotations | Root Listing
root/PrimerMatch/primer_match.htm
Revision: 1.1.1.1 (vendor branch)
Committed: Wed Dec 22 21:37:18 2004 UTC (11 years, 5 months ago) by nje01
Branch: MAIN
CVS Tags: HEAD, RELEASE-20041222, HEAD
Changes since 1.1: +0 -0 lines
Log Message:
Initial primer_match import

Line File contents
1 <html>
2 <p align="center"><font size="+2" face="Arial">primer_match</font></p>
3
4 <h3>Name</h3>
5 <blockquote>
6 <p><b>primer_match</b> - Find and count primers in a DNA
7 sequence database</p>
8 </blockquote>
9 <h3>Synopsis</h3>
10 <blockquote>
11 <p><b>primer_match</b> [
12 <i> options</i> ]</p>
13 </blockquote>
14 <h3>Description</h3>
15 <blockquote>
16 <p><b>primer_match</b> finds and counts exact and near exact instances of short
17 DNA sequences, usually primers, in a (much) larger DNA sequence database such as the human genome.&nbsp;</p>
18 <p>By default, <b> primer_match</b> outputs a human readable
19 alignment for each occurance of a primer in the sequence database. With
20 appropriate option, <u>-c</u>, <b>primer_match</b> will output the number of
21 occurances of each primer. The format of the alignments and counts is completely configurable with the
22 <u> -A</u> and <u> -C</u> options.</p>
23 <p><b>primer_match </b>runs fastest when the sequence database has been
24 pre-processed with <b>compress_seq</b>, but this is not necessary. If the
25 sequence database has not been pre-processed with <b>compress_seq</b>, the
26 sequence database <u>must</u> be in a regular FASTA format. Each line, except
27 for the last, of every sequence entry must hold the same number of sequence
28 characters. If the sequence database is not in a regular FASTA format, the
29 results may be incorrect. <b>primer_match</b> will warn the user if the FASTA
30 format is not in a regular format.&nbsp;</p>
31 </blockquote>
32 <h3>Options</h3>
33 <blockquote>
34 <p>-i <i>FASTA</i><i>_sequence_database</i></p>
35 <blockquote>
36 <p>Name of the sequence database to search. Required.</p>
37 </blockquote>
38 <p>-p <i> primers</i></p>
39 <blockquote>
40 <p>White space (space, tab, new line) separated list of primer sequences to find in the sequence database. When this
41 opition is used on the command line, the primers will usually need to be placed in quotes (&quot;). One of
42 <u>-p</u>, <u>-P</u>, <u>-F, </u>or <u>-S</u> must be supplied.</p>
43 </blockquote>
44 <p>-P <i>primer_file</i></p>
45 <blockquote>
46 <p>File containing a white space (space, tab, new line) separated list of primer
47 sequences to find in the sequence database. One of
48 <u>-p</u>, <u>-P</u>, <u>-F, </u>or <u>-S</u> must be supplied.</p>
49 </blockquote>
50 <p>-F <i>fasta_primer_file</i></p>
51 <blockquote>
52 <p>FASTA file containing a list of primer sequences to find in the sequence
53 database. One of
54 <u>-p</u>, <u>-P</u>, <u>-F, </u>or <u>-S</u> must be supplied.</p>
55 </blockquote>
56 <p>-S <i>sts-format-file</i></p>
57 <blockquote>
58 <p>UniSTS format file containing a list of primer sequences to find in the
59 sequence database. One of
60 <u>-p</u>, <u>-P</u>, <u>-F, </u>or <u>-S</u> must be supplied.</p>
61 </blockquote>
62 <p>-o <i> output_file</i></p>
63 <blockquote>
64 <p>Output is redirected into the file <i>output_file</i>. If absent, output goes to standard out.</p>
65 </blockquote>
66 <p>-k <i> edit_distance</i></p>
67 <blockquote>
68 <p>The maximum number of insertions, deletions, and substitutions permitted in any primer alignment. If absent, edit distance 0 is assumed.&nbsp;</p>
69 </blockquote>
70 <p>-K <i>mismatches</i></p>
71 <blockquote>
72 <p>The maximum number of mismatches permitted in any primer alignment. </p>
73 </blockquote>
74 <p>-r&nbsp;</p>
75 <blockquote>
76 <p> Search for the reverse complements of the primers too.</p>
77 </blockquote>
78 <p>-<i>x l&nbsp;</i></p>
79 <blockquote>
80 <p>Length of exact seed or word size, ala blast, required by any primer
81 alignment. Can be combined with other options.</p>
82 </blockquote>
83 <p>-s (<i> l | ~l </i>)<i>&nbsp;</i></p>
84 <blockquote>
85 <p> Constrain the first<i> l </i>primer characters to match exactly; any insertions, deletions or substitutions must occur after position<i>
86 l</i>. The reverse complement of a primer must also have its first <i> l </i> characters
87 match exactly. Note that a wildcard match is considered an exact match. With
88 the ~ modifier, the first <i>l</i> primer characters are constrained to
89 match inexactly, the remaining characters must match exactly.&nbsp;</p>
90 </blockquote>
91 <p>-e (<i> l | ~l </i>)<i>&nbsp;</i></p>
92 <blockquote>
93 <p> Constrain the last <i> l </i>primer characters to match exactly; any insertions, deletions or substitutions must occur before position<i>
94 l</i>. The reverse complement of a primer must also have its last<i> l</i> characters
95 match exactly. Note that a wildcard match is considered an exact
96 match.&nbsp; With the ~ modifier, the last <i>l</i> primer characters are
97 constrained to match inexactly, the remaining characters must match exactly.</p>
98 </blockquote>
99 <p>-5<i> </i>(<i> l | ~l </i>)</p>
100 <blockquote>
101 <p> Constrain the<i> l </i>primer characters at the 5' end of the primer to match
102 exactly; any insertions, deletions or substitutions must occur after position<i> l
103 </i> from the 5' end of the primer. The reverse complement of a primer must also
104 have the<i> l </i>characters at its 5' end match exactly. Note that a wildcard
105 match is considered an exact match. With the ~ modifier, the <i>l</i> primer
106 characters at the 5' end of the primer are constrained to match inexactly, the
107 remaining characters must match exactly.&nbsp;</p>
108 </blockquote>
109 <p>-3<i> </i>(<i> l | ~l </i>)&nbsp;</p>
110 <blockquote>
111 <p> Constrain the<i> l </i>primer characters at the 3' end of a primer to match
112 exactly; any insertions, deletions or substitutions must occur after position<i> l
113 </i> from the 3' end of the primer. The reverse complement of a primer must also have the<i> l
114 </i> characters at its 3' end match exactly. Note that a wildcard match is
115 considered an exact match. With the ~ modifier, the <i>l</i> primer characters
116 at the 3' end of the primer are constrained to match inexactly, the remaining
117 characters must match exactly.&nbsp;</p>
118 </blockquote>
119 <p>-w&nbsp;</p>
120 <blockquote>
121 <p> Respect IUPAC ambiguity codes as wildcards, in both the sequence database <i>and</i>
122 the primers. A symbol from the sequence database is considered a wildcard match
123 to a primer symbol if either set of represented DNA symbols contains the other.
124 The only exception is that a N in the sequence database does not match any
125 primer symbol. Note: this is almost certainly what you want, as long stretches
126 of Ns are often used to indicate gaps in assembled sequence.&nbsp;</p>
127 </blockquote>
128 <p>-W&nbsp;</p>
129 <blockquote>
130 <p>Respect IUPAC ambiguity codes as wildcards, in both the sequence database <i>and</i>
131 the primers. A symbol from the sequence database is considered a wildcard match
132 to a primer symbol if either set of represented DNA symbols contains the other.
133 Also respects Ns in the sequence databases.&nbsp;&nbsp;</p>
134 </blockquote>
135 <p>-u&nbsp;</p>
136 <blockquote>
137 <p>Force all primers to uppercase characters.</p>
138 </blockquote>
139 <p>-M <i> max</i></p>
140 <blockquote>
141 <p>Stop counting primer occurrences once a primer has been seen <i> max</i>
142 times.</p>
143 </blockquote>
144 <p>-A <i> format</i></p>
145 <blockquote>
146 <p>Output format for primer alignments. See <b> Output Format</b> below. If present, alignments will be output.</p>
147 </blockquote>
148 <p>-C <i> format</i></p>
149 <blockquote>
150 <p>Output format for primer counts. See <b> Output Format</b> below. If present,
151 counts will be output.</p>
152 </blockquote>
153 <p>-R <i> report_interval</i></p>
154 <blockquote>
155 <p>Usually, <b> primer_match</b> accumulates many matches before taking the time
156 to output alignments. This reduces the running time tremendously. However, if you are debugging or want reassurance that
157 <b> primer_match</b> is actually doing something, setting <i> report_interval</i>
158 to 1 will force <b>primer_match</b> to report alignments as they are found.</p>
159 </blockquote>
160 <p>-E <i> eos</i></p>
161 <blockquote>
162 <p>Consider the sequence character with ascii code <i> eos</i> to represent the
163 end of the sequence in a FASTA entry. This character can never be part of an alignment, except if explicitly included in a primer sequence.
164 By default, 12 (new line) is considered the end of sequence character. The end of sequence character is inserted by
165 <b> compress_seq</b>.</p>
166 </blockquote>
167 <p>-D ( <i>0</i> | <i>1</i> | <i>2</i> | <i>3</i> | <i>4</i> )&nbsp;</p>
168 <blockquote>
169 <p>Select the sequence database pre-processing strategy. The default, 0, will
170 choose the fastest strategy, based on the pre-processing done, or not done, by <b>compress_seq</b>.</p>
171 <ol>
172 <li>Sequence database has not been pre-processed.</li>
173 <li>Sequence database has been indexed by <b>compress_seq</b>. This is the
174 default behavior of <b>compress_seq</b>.</li>
175 <li>Sequence database has been indexed and normalized by <b>compress_seq</b>,
176 using the option <u>-n true</u>.</li>
177 <li>Sequence database has been indexed, normalized and compressed by <b>compress_seq</b>,
178 using the option <u>-z true</u>.</li>
179 </ol>
180 <p>Given the availability of pre-processed sequence database files, option 3 is
181 selected first, then option 4, then option 2, then option 1. This will typically
182 represent the fastest possible run time.&nbsp;</p>
183 </blockquote>
184 <p>-B</p>
185 <blockquote>
186 <p>Use buffered standard I/O rather than mmap to stream through the sequence
187 database. On some platforms, where the use of mmap is somewhat unpredictable,
188 this option may make it possible to run <b>primer_match</b> reliably.&nbsp;</p>
189 </blockquote>
190 <p>-v&nbsp;</p>
191 <blockquote>
192 <p>Verbose (version &amp; diagnostic) output.</p>
193 </blockquote>
194 <p>-h&nbsp;</p>
195 <blockquote>
196 <p> Command-line help.</p>
197 </blockquote>
198 </blockquote>
199 <h3>Output Format</h3>
200 <blockquote>
201 <p>The default alignment output format is</p>
202 <blockquote>
203 <pre>&gt;defline
204 sequence start end edits
205 alignment
206 primer index rc?</pre>
207 </blockquote>
208 <p>where <u> defline</u> is the FASTA header line of the sequence entry containing the
209 alignment; <u> sequence</u> is the aligned sequence from the sequence database; <u>start</u> and
210 <u> end</u> are the space based start and end positions of the aligned sequence in the sequence entry;
211 <u> edits</u> is the number of insertions, deletions, and substitutions in the alignment;
212 <u> alignment</u> is a series of alignment characters indicating match, insertion, deletion or substitution at
213 each position of the alignment; <u> primer</u> is the aligned primer sequence; <u>index</u> is the index of this primer in the primer input set; and
214 <u> rc?</u> is &quot;REVCOMP&quot; if the primer matched in its reverse complement form.</p>
215 <p>For example</p>
216 <blockquote>
217 <pre>&gt;CCO_UID:219000002141424:BAC_UID:human_12212001_reproc:LEN:33337
218 AGATCGCAGGTACATAAATGCTTCT 20115 20140 0
219 |||||||||||||||||||||||||
220 AGATCGCAGGTACATAAATGCTTCT 3242
221 &gt;CCO_UID:219000002142926:BAC_UID:human_12212001_reproc:LEN:2262
222 CCCATTCAGTCTTTCTTTTAAAAACATTTATTTTTAATTCAT 1671 1713 0
223 ||||||||||||||||||||||||||||||||||||||||||
224 CCCATTCAGTCTTTCTTTTAAAAACATTTATTTTTAATTCAT 4781 REVCOMP</pre>
225 </blockquote>
226 <p>and</p>
227 <blockquote>
228 <pre>&gt;gi|683734|gb|U20581.1|MFU20581 Macaca fascicularis endothelin 3 mRNA
229 CAGCCAGATCTGAG 44 58 1
230 |||*||||||||||
231 CAGTCAGATCTGAG 3
232 &gt;gi|9967394|dbj|AB047965.1| Macaca fascicularis brain cDNA
233 CTCAGATCTGA-TG 1569 1582 1
234 |||||||||||v||
235 CTCAGATCTGACTG 3 REVCOMP</pre>
236 </blockquote>
237 <p>and</p>
238 <blockquote>
239 <pre>&gt;gi|21320903|dbj|AB059653.1| Macaca fascicularis PGDH1 mRNA
240 TGGATAATTTTT 2338 2350 1
241 +++|^|+||||+
242 WRRA-AWTTTTW 13
243 &gt;gi|21320905|dbj|AB059654.1| Macaca fascicularis PGDH2 mRNA
244 ACCGAGGAGGA 502 513 1
245 ||*||+|||||
246 ACAGAKGAGGA 11
247 &gt;gi|21320905|dbj|AB059654.1| Macaca fascicularis PGDH2 mRNA
248 AGCTG-GTGGG 512 522 1
249 |||||v|||||
250 AGCTGYGTGGG 18
251 &gt;gi|7593035|dbj|AB041420.1| Gorilla gorilla gene for alpha-1
252 CGCCRGCACGAGTT 596 610 1
253 ||||+|||^|||||
254 CGCCAGCA-GAGTT 2
255 </pre>
256 </blockquote>
257 <p>The default counts output format is</p>
258 <blockquote>
259 <pre>index rc? primer count ( 0-count 1-count ... )</pre>
260 </blockquote>
261 <p>where <u> index</u> is the index of the primer; <u> rc?</u> is &quot;R&quot; for the reverse
262 complement of the primer and &quot;F&quot; otherwise; <u> primer</u> is the sequence of
263 the primer if <u> rc?</u> is &quot;F&quot; and the sequence of the primer's reverse
264 complement if <u>rc?</u> is &quot;R&quot;; <u> count</u> is the number of occurrences of primer in the
265 sequence database; and <u><i>k</i>-count</u> is the number of occurrences of primer in the
266 sequence database with <i> k</i> insertions, deletions, or substitutions.</p>
267 <p>For example</p>
268 <blockquote>
269 <pre>1 F TTACGGGCAGCTCA 9 ( 6 3 )
270 1 R TGAGCTGCCCGTAA 0 ( 0 0 )
271 2 F CCTTGCCAGTCAGATC 23 ( 8 15 )
272 2 R GATCTGACTGGCAAGG 0 ( 0 0 )
273 3 F CAGTCAGATCTGAG 15 ( 2 13 )
274 3 R CTCAGATCTGACTG 6 ( 0 6 )</pre>
275 </blockquote>
276 <p>The command line options <u> -A</u> and <u> -C</u> give the user explicit control over the
277 output of alignments and counts respectively. Each format string contains conversion characters, which specify pieces of the alignment or count
278 output.</p>
279 <p>Alignment format conversion characters:</p>
280 </blockquote>
281 <div align="center">
282 <center>
283 <table border="0" width="100%">
284 <tr>
285 <td width="12%" valign="top" align="left"></td>
286 <td width="8%" valign="top" align="left">%h&nbsp;</td>
287 <td width="89%" valign="top" align="left">FASTA header (defline) of the sequence entry containing the alignment.</td>
288 </tr>
289 <tr>
290 <td width="12%" valign="top" align="left"></td>
291 <td width="8%" valign="top" align="left">%H</td>
292 <td width="89%" valign="top" align="left"> First &quot;word&quot; of the FASTA
293 header (defline) of the sequence entry containing the alignment. The first word is everything up to (but not
294 including) the first whitespace character of the defline.</td>
295 </tr>
296 <tr>
297 <td width="12%" valign="top" align="left"></td>
298 <td width="8%" valign="top" align="left">%f</td>
299 <td width="89%" valign="top" align="left"> Index of the FASTA entry containing
300 the alignment.</td>
301 </tr>
302 <tr>
303 <td width="12%" valign="top" align="left"></td>
304 <td width="8%" valign="top" align="left">%s</td>
305 <td width="89%" valign="top" align="left"> Start position of the alignment
306 within the FASTA entry (space based).</td>
307 </tr>
308 <tr>
309 <td width="12%" valign="top" align="left"></td>
310 <td width="8%" valign="top" align="left">%e</td>
311 <td width="89%" valign="top" align="left"> End position of the alignment in the
312 FASTA entry (space based).</td>
313 </tr>
314 <tr>
315 <td width="12%" valign="top" align="left"></td>
316 <td width="8%" valign="top" align="left">%l</td>
317 <td width="89%" valign="top" align="left"> Length of the alignment.</td>
318 </tr>
319 <tr>
320 <td width="12%" valign="top" align="left"></td>
321 <td width="8%" valign="top" align="left">%5</td>
322 <td width="89%" valign="top" align="left"> Position of the 5' end of the alignment in the sequence entry (space
323 based).</td>
324 </tr>
325 <tr>
326 <td width="12%" valign="top" align="left"></td>
327 <td width="8%" valign="top" align="left">%3</td>
328 <td width="89%" valign="top" align="left"> Position of the 3' end of the alignment in the sequence entry (space
329 based).</td>
330 </tr>
331 <tr>
332 <td width="12%" valign="top" align="left"></td>
333 <td width="8%" valign="top" align="left">%S</td>
334 <td width="89%" valign="top" align="left"> Start position (absolute) of the alignment in the sequence database.</td>
335 </tr>
336 <tr>
337 <td width="12%" valign="top" align="left"></td>
338 <td width="8%" valign="top" align="left">%E&nbsp;</td>
339 <td width="89%" valign="top" align="left"> End position (absolute) of the alignment in the sequence database.</td>
340 </tr>
341 <tr>
342 <td width="12%" valign="top" align="left"></td>
343 <td width="8%" valign="top" align="left">%i</td>
344 <td width="89%" valign="top" align="left"> Index of the aligned primer.</td>
345 </tr>
346 <tr>
347 <td width="12%" valign="top" align="left"></td>
348 <td width="8%" valign="top" align="left">%d</td>
349 <td width="89%" valign="top" align="left">Edit distance (number of insertions, deletions, substitutions) of the
350 alignment.</td>
351 </tr>
352 <tr>
353 <td width="12%" valign="top" align="left"></td>
354 <td width="8%" valign="top" align="left">%p</td>
355 <td width="89%" valign="top" align="left"> The (forward) sequence of the primer, whether it was found in its
356 forward or reverse complement form.</td>
357 </tr>
358 <tr>
359 <td width="12%" valign="top" align="left"></td>
360 <td width="8%" valign="top" align="left">%P</td>
361 <td width="89%" valign="top" align="left"> The FASTA header (defline) of
362 the primer, if the primers came from a FASTA format file. Otherwise,
363 &quot;&quot;.</td>
364 </tr>
365 <tr>
366 <td width="12%" valign="top" align="left"></td>
367 <td width="8%" valign="top" align="left">%I&nbsp;</td>
368 <td width="89%" valign="top" align="left">STS id (first column) of primer
369 entry, if the primers came from a UniSTS format file. Otherwise, &quot;&quot;.</td>
370 </tr>
371 <tr>
372 <td width="12%" valign="top" align="left"></td>
373 <td width="8%" valign="top" align="left">%L&nbsp;</td>
374 <td width="89%" valign="top" align="left">STS length for primer entry, if
375 the primers came from a UniSTS format file. Otherwise, &quot;&quot;.</td>
376 </tr>
377 <tr>
378 <td width="12%" valign="top" align="left"></td>
379 <td width="8%" valign="top" align="left">%a&nbsp;</td>
380 <td width="89%" valign="top" align="left">STS accession for primer entry,
381 if the primers came from a IUniSTS format file. Otherwise, &quot;&quot;.</td>
382 </tr>
383 <tr>
384 <td width="12%" valign="top" align="left"></td>
385 <td width="8%" valign="top" align="left">%O&nbsp;</td>
386 <td width="89%" valign="top" align="left">STS organism for primer entry,
387 if the primers came from a UniSTS format file. Otherwise, &quot;&quot;.</td>
388 </tr>
389 <tr>
390 <td width="12%" valign="top" align="left"></td>
391 <td width="8%" valign="top" align="left">%&amp;&nbsp;</td>
392 <td width="89%" valign="top" align="left">Alternative STS accessions for
393 primer entry, if the primers came from a UniSTS format file. Otherwise,
394 &quot;&quot;.</td>
395 </tr>
396 <tr>
397 <td width="12%" valign="top" align="left"></td>
398 <td width="8%" valign="top" align="left">%X&nbsp;</td>
399 <td width="89%" valign="top" align="left">STS chromosome for primer entry,
400 if the primers came from a UniSTS format file. Otherwise, &quot;&quot;.</td>
401 </tr>
402 <tr>
403 <td width="12%" valign="top" align="left"></td>
404 <td width="8%" valign="top" align="left">%q</td>
405 <td width="89%" valign="top" align="left"> The primer sequence of the alignment.</td>
406 </tr>
407 <tr>
408 <td width="12%" valign="top" align="left"></td>
409 <td width="8%" valign="top" align="left">%Q</td>
410 <td width="89%" valign="top" align="left">The primer sequence of the alignment, with alignment characters to
411 indicate an insertion.</td>
412 </tr>
413 <tr>
414 <td width="12%" valign="top" align="left"></td>
415 <td width="8%" valign="top" align="left">%t</td>
416 <td width="89%" valign="top" align="left"> The aligned sequence from the sequence database.</td>
417 </tr>
418 <tr>
419 <td width="12%" valign="top" align="left"></td>
420 <td width="8%" valign="top" align="left">%T</td>
421 <td width="89%" valign="top" align="left"> The aligned sequence from the sequence database, with alignment
422 characters to indicate deletion.</td>
423 </tr>
424 <tr>
425 <td width="12%" valign="top" align="left"></td>
426 <td width="8%" valign="top" align="left">%A</td>
427 <td width="89%" valign="top" align="left"> The string of alignment characters indicating exact match, insertion,
428 deletion and subsitution at each position of the alignment.</td>
429 </tr>
430 <tr>
431 <td width="12%" valign="top" align="left"></td>
432 <td width="8%" valign="top" align="left">%r</td>
433 <td width="89%" valign="top" align="left"> &quot;F&quot; if the forward form of the primer was found, &quot;R&quot;
434 if the reverse complement form of the primer was found.</td>
435 </tr>
436 <tr>
437 <td width="12%" valign="top" align="left"></td>
438 <td width="8%" valign="top" align="left">%R</td>
439 <td width="89%" valign="top" align="left">
440 <p> &quot; REVCOMP&quot; if the reverse complement form of the primer was
441 found, &quot;&quot; otherwise.</p>
442 </td>
443 </tr>
444 <tr>
445 <td width="12%" valign="top" align="left"></td>
446 <td width="8%" valign="top" align="left">%%</td>
447 <td width="89%" valign="top" align="left"> Percent (%).</td>
448 </tr>
449 </table>
450 </center>
451 </div>
452 <blockquote>
453 <p>The default alignment format is &quot;&gt;%h\n %T %s %e %d\n %A\n %Q %i%R\n&quot;.</p>
454 <p>Count format conversion characters:</p>
455 </blockquote>
456 <table border="0" width="100%">
457 <tr>
458 <td width="12%" valign="top" align="left"></td>
459 <td width="8%" valign="top" align="left">%i</td>
460 <td width="89%" valign="top" align="left"> The primer index.</td>
461 </tr>
462 <tr>
463 <td width="12%" valign="top" align="left"></td>
464 <td width="8%" valign="top" align="left">%p</td>
465 <td width="89%" valign="top" align="left"> The (forward form of the) sequence of the primer.</td>
466 </tr>
467 <tr>
468 <td width="12%" valign="top" align="left"></td>
469 <td width="8%" valign="top" align="left">%P</td>
470 <td width="89%" valign="top" align="left"> The FASTA header (defline) of
471 the primer, if the primers came from a FASTA format file. Otherwise,
472 &quot;&quot;.</td>
473 </tr>
474 <tr>
475 <td width="12%" valign="top" align="left"></td>
476 <td width="8%" valign="top" align="left">%q</td>
477 <td width="89%" valign="top" align="left"> The forward or reverse complement form of the primer.</td>
478 </tr>
479 <tr>
480 <td width="12%" valign="top" align="left"></td>
481 <td width="8%" valign="top" align="left">%r</td>
482 <td width="89%" valign="top" align="left">&quot;F&quot; for the
483 forward form of the primer, &quot;R&quot; for the reverse complement form of the primer.</td>
484 </tr>
485 <tr>
486 <td width="12%" valign="top" align="left"></td>
487 <td width="8%" valign="top" align="left">%R</td>
488 <td width="89%" valign="top" align="left"> &quot; REVCOMP&quot; for the reverse complement form of the primer,
489 &quot;&quot; otherwise.</td>
490 </tr>
491 <tr>
492 <td width="12%" valign="top" align="left"></td>
493 <td width="8%" valign="top" align="left">%c</td>
494 <td width="89%" valign="top" align="left"> Count for primer or reverse complement.</td>
495 </tr>
496 <tr>
497 <td width="12%" valign="top" align="left"></td>
498 <td width="8%" valign="top" align="left">%C</td>
499 <td width="89%" valign="top" align="left"> Space separated list of counts for edit distance 0, 1,
500 etc.</td>
501 </tr>
502 <tr>
503 <td width="12%" valign="top" align="left"></td>
504 <td width="8%" valign="top" align="left">%+</td>
505 <td width="89%" valign="top" align="left"> Plus (+) if the count for this primer exceeded the maximum count
506 threshold.</td>
507 </tr>
508 <tr>
509 <td width="12%" valign="top" align="left"></td>
510 <td width="8%" valign="top" align="left">%%&nbsp;</td>
511 <td width="89%" valign="top" align="left"> Percent (%).</td>
512 </tr>
513 </table>
514 <blockquote>
515 <p>The default count format is &quot;%i %q %c%+ ( %C )\n&quot;.</p>
516 </blockquote>
517 <h3>See Also</h3>
518 <blockquote>
519 <p><b><a href="pcr_match.htm">pcr_match</a>, <a href="compress_seq.htm">compress_seq</a></b></p>
520 </blockquote>
521 <h3>Author</h3>
522 <blockquote>
523 <p>Nathan Edwards</p>
524 </blockquote>
525 </html>