ViewVC Help
View File | Revision Log | Show Annotations | View Changeset | Root Listing
root/gclib/fqtrim/fqtrim.cpp
(Generate patch)
# Line 2 | Line 2
2   #include "GStr.h"
3   #include "GHash.hh"
4   #include "GList.hh"
5 + #include <ctype.h>
6  
7   #define USAGE "Usage:\n\
8 < fqtrim [-5 <5'adapter>] [-3 <3'adapter>] [-l <minlen>] [-q <minqv>] [-C] [-D]\\\n\
9 <   [-p {64|33}] [-n <rename_prefix>] [-o <trimmed.fq>] [-r <discarded.lst>]\\\n\
10 <   [-Q] <input.fq>\n\
8 > fqtrim [-5 <5adapter>] [-3 <3adapter>] [-a <min_matchlen>] [-p {64|33}] [-q <minq> [-t <trim_max>]]\\\n\
9 >   [-n <rename_prefix>] [-o <outsuffix>] [-z <zcmd>] [-r <discarded.lst>]\\\n\
10 >   [-l <minlen>] [-C] [-D] [-Q] <input.fq>[,<input_mates.fq>\n\
11   \n\
12 < Trim low quality bases at 3' end, optionally trim adapter sequence, filter\n\
12 > Trim low quality bases at the 3' end, optionally trim adapter sequence, filter\n\
13   for low complexity and collapse duplicate reads\n\
14 + If read pairs should be trimmed and kept together (i.e. without discarding\n\
15 + one read in a pair), the two file names should be given delimited by a comma\n\
16 + or a colon character\n\
17   \n\
18   Options:\n\
19   -n  rename all the reads using the <prefix> followed by a read counter;\n\
20      if -C option was given, the suffix \"_x<N>\" is appended, with <N> being\n\
21      the read duplication count\n\
22 < -o  write the trimmed/filtered fastq into <trimmed.fq>(instead of stdout)\n\
22 > -o  write the trimmed/filtered reads to file(s) named <input>.<outsuffix>\n\
23 >    which will be created in the current (working) directory\n\
24   -5  trim the given adapter or primer sequence at the 5' end of each read\n\
25      (e.g. -5 CGACAGGTTCAGAGTTCTACAGTCCGACGATC)\n\
26   -3  trim the given adapter sequence at the 3' end of each read\n\
27      (e.g. -3 TCGTATGCCGTCTTCTGCTTG)\n\
28 < -q  trim bases with quality value lower than <minq> (starting the 3' end)\n\
28 > -a  minimum bases to match to adaptor sequence (default 5)\n\
29 > -q  trim bases with quality value lower than <minq> (starting at the 3' end)\n\
30 > -t  for -q option, maximum trimming at the 3' end is limited to <trim_max>\n\
31   -m  maximum percentage of Ns allowed in a read after trimming (default 7)\n\
32   -l  minimum \"clean\" length after trimming that a read must have\n\
33      in order to pass the filter (default: 16)\n\
# Line 34 | Line 41
41   -Q  convert quality values to the other Phred qv type\n\
42   -V  verbose processing\n\
43   "
44 +
45 + //-z  for -o option, the output stream(s) will be first piped into the given\n
46 + //   <zcmd> command, which must output to stdout (e.g. -z 'bzip2 -9 -c')\n
47 +
48 +
49   // example 3' adapter for miRNAs: TCGTATGCCGTCTTCTGCTTG
50  
51   //For pair ends sequencing:
52   //3' : ACACTCTTTCCCTACACGACGCTCTTCCGATCT
53   //5' : GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
54 < FILE* f_out=NULL; //stdout if not provided
55 < FILE* f_in=NULL; //input fastq (stdin if not provided)
54 > //FILE* f_out=NULL; //stdout if not provided
55 > //FILE* f_out2=NULL; //for paired reads
56 > //FILE* f_in=NULL; //input fastq (stdin if not provided)
57 > //FILE* f_in2=NULL; //for paired reads
58   FILE* freport=NULL;
59 +
60   bool debug=false;
61   bool verbose=false;
62   bool doCollapse=false;
63   bool doDust=false;
64 + bool fastaOutput=false;
65   bool trashReport=false;
66   //bool rawFormat=false;
67   int min_read_len=16;
# Line 53 | Line 69
69   int dust_cutoff=16;
70   bool isfasta=false;
71   bool convert_phred=false;
72 < GStr prefix;
72 > GStr outsuffix; // -o
73   GStr adapter3;
74   GStr adapter5;
75 + GStr prefix;
76 + GStr zcmd;
77 + int num_trimmed5=0;
78 + int num_trimmed3=0;
79 + int num_trimmedN=0;
80 + int num_trimmedQ=0;
81 + int min_trimmed5=INT_MAX;
82 + int min_trimmed3=INT_MAX;
83  
84 < int qvtrim_min=0;
85 <
84 > int qvtrim_qmin=0;
85 > int qvtrim_max=0;  //for -q, do not trim at 3'-end more than this number of bases
86   int qv_phredtype=0; // could be 64 or 33 (0 means undetermined yet)
87   int qv_cvtadd=0; //could be -31 or +31
88  
# Line 68 | Line 92
92   const int a_m_score=2; //match score
93   const int a_mis_score=-3; //mismatch
94   const int a_dropoff_score=7;
95 < const int a_min_score=8; //an exact match of 4 bases at the proper ends WILL be trimmed
95 > int a_min_score=10; //an exact match of 5 bases at the proper ends WILL be trimmed
96   const int a_min_chain_score=15; //for gapped alignments
97  
98   class CSegChain;
# Line 273 | Line 297
297    if (!s.is_empty()) {
298        if (s=='-') f=stdout;
299        else {
300 <       f=fopen(s,"w");
300 >       f=fopen(s.chars(),"w");
301         if (f==NULL) GError("Error creating file: %s\n", s.chars());
302         }
303       }
# Line 284 | Line 308
308  
309   GHash<FqDupRec> dhash; //hash to keep track of duplicates
310  
311 + void setupFiles(FILE*& f_in, FILE*& f_in2, FILE*& f_out, FILE*& f_out2,
312 +                       GStr& s, GStr& infname, GStr& infname2);
313 + // uses outsuffix to generate output file names and open file handles as needed
314 +
315 + void writeRead(FILE* f_out, GStr& rname, GStr& rinfo, GStr& rseq, GStr& rqv, int& outcounter);
316 + void trash_report(char trashcode, GStr& rname, FILE* freport);
317 +
318 + bool getFastxRec(GLineReader& fq, GStr& rseq, GStr& rqv,
319 +          GStr& rname, GStr& rinfo, GStr& infname);
320 +
321 + char process_read(GStr& rname, GStr& rseq, GStr& rqv, int &l5, int &l3);
322 + //returns 0 if the read was untouched, 1 if it was trimmed and a trash code if it was trashed
323 +
324   bool ntrim(GStr& rseq, int &l5, int &l3); //returns true if any trimming occured
325   bool qtrim(GStr& qvs, int &l5, int &l3); //return true if any trimming occured
326   int dust(GStr& seq);
# Line 294 | Line 331
331   void convertPhred(GStr& q);
332  
333   int main(int argc, char * const argv[]) {
334 <  GArgs args(argc, argv, "YQDCVl:d:3:5:m:n:r:p:q:o:");
334 >  GArgs args(argc, argv, "YQDCVl:d:3:5:m:n:r:p:q:t:o:z:a:");
335    int e;
299  int icounter=0; //counter for input reads
300  int outcounter=0; //counter for output reads
336    if ((e=args.isError())>0) {
337        GMessage("%s\nInvalid argument: %s\n", USAGE, argv[e]);
338        exit(224);
339        }
340    debug=(args.getOpt('Y')!=NULL);
341 <  debug=(args.getOpt('V')!=NULL);
341 >  verbose=(args.getOpt('V')!=NULL);
342    convert_phred=(args.getOpt('Q')!=NULL);
343    doCollapse=(args.getOpt('C')!=NULL);
344    doDust=(args.getOpt('D')!=NULL);
# Line 327 | Line 362
362       }
363    s=args.getOpt('q');
364    if (!s.is_empty()) {
365 <     qvtrim_min=s.asInt();
365 >     qvtrim_qmin=s.asInt();
366 >     }
367 >  s=args.getOpt('t');
368 >  if (!s.is_empty()) {
369 >     qvtrim_max=s.asInt();
370       }
371    s=args.getOpt('p');
372    if (!s.is_empty()) {
# Line 353 | Line 392
392      adapter5.upper();
393      a5len=adapter5.length();
394      }
395 +  s=args.getOpt('a');
396 +  if (!s.is_empty()) {
397 +     int a_minmatch=s.asInt();
398 +     a_min_score=a_minmatch<<1;
399 +     }
400 +
401 +  if (args.getOpt('o')!=NULL) outsuffix=args.getOpt('o');
402    trashReport=  (args.getOpt('r')!=NULL);
403 <  if (args.startNonOpt()==0) {
403 >  int fcount=args.startNonOpt();
404 >  if (fcount==0) {
405      GMessage(USAGE);
406      exit(224);
407      }
408 <
409 <  openfw(f_out, args, 'o');
410 <  if (f_out==NULL) f_out=stdout;
408 >   if (fcount>1 && doCollapse) {
409 >    GError("%s Sorry, the -C option only works with a single input.\n", USAGE);
410 >    }
411 >  //openfw(f_out, args, 'o');
412 >  //if (f_out==NULL) f_out=stdout;
413    if (trashReport)
414      openfw(freport, args, 'r');
415    char* infile=NULL;
416    while ((infile=args.nextNonOpt())!=NULL) {
417 <    GStr infname(infile);
418 <    if (strcmp(infile,"-")==0) {
419 <       f_in=stdin; infname="stdin"; }
420 <     else {
421 <        f_in=fopen(infile,"r");
422 <        if (f_in==NULL)
423 <            GError("Cannot open input file %s!\n",infile);
424 <        }
425 <     GLineReader fq(f_in);
426 <     char* l=NULL;
427 <     while ((l=fq.getLine())!=NULL) {
428 <        GStr rname; //current read name
429 <        GStr rseq;  //current read sequence
430 <        GStr rqv;   //current read quality values
431 <        GStr s;
432 <        /* if (rawFormat) {
433 <          //TODO: implement qseq parsing here
434 <          //if (raw type=N) then continue; //skip invalid/bad records
435 <          
436 <          } //raw qseq format
437 <         else { // FASTQ or FASTA */
438 <          isfasta=(l[0]=='>');
439 <          if (!isfasta && l[0]!='@') GError("Error: fastq record marker not detected!\n");
440 <          s=l;
441 <          rname=&(l[1]);
442 <          icounter++;
443 <          for (int i=0;i<rname.length();i++)
444 <            if (rname[i]<=' ') { rname.cut(i); break; }
445 <          //now get the sequence
446 <          if ((l=fq.getLine())==NULL)
447 <              GError("Error: unexpected EOF after header for %s\n",rname.chars());
448 <          rseq=l; //this must be the DNA line
449 <          while ((l=fq.getLine())!=NULL) {
450 <              //seq can span multiple lines
451 <              if (l[0]=='>' || l[0]=='+') {
452 <                   fq.pushBack();
453 <                   break; //
417 >    int incounter=0; //counter for input reads
418 >    int outcounter=0; //counter for output reads
419 >    int trash_s=0; //too short from the get go
420 >    int trash_Q=0;
421 >    int trash_N=0;
422 >    int trash_D=0;
423 >    int trash_A3=0;
424 >    int trash_A5=0;
425 >    s=infile;
426 >    GStr infname;
427 >    GStr infname2;
428 >    FILE* f_in=NULL;
429 >    FILE* f_in2=NULL;
430 >    FILE* f_out=NULL;
431 >    FILE* f_out2=NULL;
432 >    bool paired_reads=false;
433 >    setupFiles(f_in, f_in2, f_out, f_out2, s, infname, infname2);
434 >    GLineReader fq(f_in);
435 >    GLineReader* fq2=NULL;
436 >    if (f_in2!=NULL) {
437 >       fq2=new GLineReader(f_in2);
438 >       paired_reads=true;
439 >       }
440 >    GStr rseq, rqv, seqid, seqinfo;
441 >    GStr rseq2, rqv2, seqid2, seqinfo2;
442 >    while (getFastxRec(fq, rseq, rqv, seqid, seqinfo, infname)) {
443 >       incounter++;
444 >       int a5=0, a3=0, b5=0, b3=0;
445 >       char tcode=0, tcode2=0;
446 >       tcode=process_read(seqid, rseq, rqv, a5, a3);
447 >       //if (!doCollapse) {
448 >         if (fq2!=NULL) {
449 >            getFastxRec(*fq2, rseq2, rqv2, seqid2, seqinfo2, infname2);
450 >            if (seqid.substr(0,seqid.length()-1)!=seqid2.substr(0,seqid2.length()-1)) {
451 >               GError("Error: no paired match for read %s vs %s (%s,%s)\n",
452 >                  seqid.chars(), seqid2.chars(), infname.chars(), infname2.chars());
453 >               }
454 >            tcode2=process_read(seqid2, rseq2, rqv2, b5, b3);
455 >            //decide what to do with this pair and print rseq2 if the pair makes it
456 >            if (tcode>1 && tcode2<=1) {
457 >               //"untrash" rseq
458 >               if (a3-a5+1<min_read_len) {
459 >                   a5=1;
460 >                   if (a3<min_read_len) { a3= GMIN(rseq.length()-1, min_read_len+1); }
461                     }
462 <              rseq+=l;
463 <              } //check for multi-line seq
464 <          if (!isfasta) { //reading fastq quality values, which can also be multi-line
465 <            if ((l=fq.getLine())==NULL)
466 <                GError("Error: unexpected EOF after sequence for %s\n", rname.chars());
467 <            if (l[0]!='+') GError("Error: fastq qv header marker not detected!\n");
468 <            if ((l=fq.getLine())==NULL)
469 <                GError("Error: unexpected EOF after qv header for %s\n", rname.chars());
470 <            rqv=l;
471 <            //if (rqv.length()!=rseq.length())
472 <            //  GError("Error: qv len != seq len for %s\n", rname.chars());
473 <            while (rqv.length()<rseq.length() && ((l=fq.getLine())!=NULL)) {
474 <              rqv+=l; //append to qv string
475 <              }
420 <            }// fastq
421 <        // } //<-- FASTA or FASTQ
422 <        rseq.upper();
423 <        int l5=0;
424 <        int l3=rseq.length()-1;
425 <        if (l3-l5+1<min_read_len) {
426 <           if (trashReport) {
427 <                  fprintf(freport, "%s\ts\t%s\n",rname.chars(), rseq.chars());
428 <                  }
429 <           continue;
430 <           }
431 <        if (ntrim(rseq, l5, l3)) { // N-trimming
432 <           //GMessage("before: %s\n",rseq.chars());
433 <           //GMessage("after : %s (%d)\n",rseq.substr(l5,l3-l5+1).chars(),l3-l5+1);
434 <           if (l3-l5+1<min_read_len) {
435 <             if (trashReport) {
436 <                    fprintf(freport, "%s\tN\t%s\n", rname.chars(), rseq.chars());
437 <                    }
438 <             continue; //invalid read
439 <             }
440 <            //-- keep only the l5..l3 range
441 <           rseq=rseq.substr(l5, l3-l5+1);
442 <           if (!rqv.is_empty())
443 <              rqv=rqv.substr(l5, l3-l5+1);
444 <           l5=0;
445 <           l3=rseq.length()-1;
446 <           }
447 <        if (qvtrim_min!=0 && !rqv.is_empty() && qtrim(rqv, l5, l3)) { // qv-threshold trimming
448 <           if (l3-l5+1<min_read_len) {
449 <             if (trashReport) {
450 <                    fprintf(freport, "%s\tQ\t%s\n", rname.chars(), rseq.chars());
451 <                    }
452 <             continue; //invalid read
453 <             }
454 <            //-- keep only the l5..l3 range
455 <           rseq=rseq.substr(l5, l3-l5+1);
456 <           if (!rqv.is_empty())
457 <              rqv=rqv.substr(l5, l3-l5+1);
458 <           } //qv trimming
459 <        if (a3len>0) {
460 <          if (trim_adapter3(rseq, l5, l3)) {
461 <             if (l3-l5+1<min_read_len) {
462 <                 if (trashReport) {
463 <                     fprintf(freport, "%s\tA3\t%s\n",rname.chars(), rseq.chars());
464 <                     }
465 <                 continue;
466 <                 }
467 <              //-- keep only the l5..l3 range
468 <              rseq=rseq.substr(l5, l3-l5+1);
469 <              if (!rqv.is_empty())
470 <                 rqv=rqv.substr(l5, l3-l5+1);
471 <              }//some adapter was trimmed
472 <           } //adapter trimming
473 <        if (a5len>0) {
474 <          if (trim_adapter5(rseq, l5, l3)) {
475 <             if (l3-l5+1<min_read_len) {
476 <                 if (trashReport) {
477 <                     fprintf(freport, "%s\tA5\t%s\n",rname.chars(), rseq.chars());
478 <                     }
479 <                 continue;
462 >               tcode=1;
463 >               }
464 >             else if (tcode<=1 && tcode2>1) {
465 >               //"untrash" rseq2
466 >               if (b3-b5+1<min_read_len) {
467 >                   b5=1;
468 >                   if (b3<min_read_len) { b3= GMIN((rseq2.length()-1),(min_read_len+1)); }
469 >                   }
470 >               tcode2=1;
471 >               }
472 >            if (tcode<=1) { //trimmed or left intact -- write it!
473 >               if (tcode>0) {
474 >                 rseq2=rseq2.substr(b5,b3-b5+1);
475 >                 if (!rqv2.is_empty()) rqv2=rqv2.substr(b5,b3-b5+1);
476                   }
477 <              //-- keep only the l5..l3 range
478 <              rseq=rseq.substr(l5, l3-l5+1);
479 <              if (!rqv.is_empty())
480 <                 rqv=rqv.substr(l5, l3-l5+1);
481 <              }//some adapter was trimmed
482 <           } //adapter trimming
483 <        if (doCollapse) {
484 <           //keep read for later
485 <           FqDupRec* dr=dhash.Find(rseq.chars());
486 <           if (dr==NULL) { //new entry
487 <                  //if (prefix.is_empty())
488 <                     dhash.Add(rseq.chars(),
489 <                          new FqDupRec(&rqv, rname.chars()));
490 <                  //else dhash.Add(rseq.chars(), new FqDupRec(rqv.chars(),rqv.length()));
477 >               int nocounter=0;
478 >               writeRead(f_out2, seqid2, seqinfo2, rseq2, rqv2, nocounter);
479 >               }
480 >            } //paired read
481 >       // }
482 >       if (tcode>1) { //trashed
483 >          if (tcode=='s') trash_s++;
484 >            else if (tcode=='Q') trash_Q++;
485 >              else if (tcode=='N') trash_N++;
486 >               else if (tcode=='D') trash_D++;
487 >                else if (tcode=='3') trash_A3++;
488 >                 else if (tcode=='5') trash_A5++;
489 >          if (trashReport) trash_report(tcode, seqid, freport);
490 >          }
491 >         else if (!doCollapse) { //write it
492 >          if (tcode>0) {
493 >            rseq=rseq.substr(a5,a3-a5+1);
494 >            if (!rqv.is_empty()) rqv=rqv.substr(a5,a3-a5+1);
495 >            }
496 >          writeRead(f_out, seqid, seqinfo, rseq, rqv, outcounter);
497 >          }
498 >       } //for each fastq record
499 >    delete fq2;
500 >    FRCLOSE(f_in);
501 >    FRCLOSE(f_in2);
502 >    if (doCollapse) {
503 >       outcounter=0;
504 >       int maxdup_count=1;
505 >       char* maxdup_seq=NULL;
506 >       dhash.startIterate();
507 >       FqDupRec* qd=NULL;
508 >       char* seq=NULL;
509 >       while ((qd=dhash.NextData(seq))!=NULL) {
510 >         GStr rseq(seq);
511 >         //do the dusting here
512 >         if (doDust) {
513 >            int dustbases=dust(rseq);
514 >            if (dustbases>(rseq.length()>>1)) {
515 >               if (trashReport && qd->firstname!=NULL) {
516 >                 fprintf(freport, "%s_x%d\tD\n",qd->firstname, qd->count);
517                   }
518 <              else    
519 <                 dr->add(rqv);
520 <           } //collapsing duplicates
521 <         else { //not collapsing duplicates
522 <           //do the dust filter now
523 <           if (doDust) {
524 <             int dustbases=dust(rseq);
525 <             if (dustbases>(rseq.length()>>1)) {
526 <                if (trashReport) {
527 <                  fprintf(freport, "%s\tD\t%s\n",rname.chars(),rseq.chars());
528 <                  }
529 <                continue;
530 <                }
509 <             }
510 <           //print this record here  
511 <           outcounter++;
512 <           if (isfasta) {
513 <            if (prefix.is_empty())
514 <               fprintf(f_out, ">%s\n%s\n", rname.chars(), rseq.chars());
515 <              else
516 <               fprintf(f_out, ">%s%08d\n%s\n", prefix.chars(), outcounter,
517 <                                  rseq.chars());
518 >               trash_D+=qd->count;
519 >               continue;
520 >               }
521 >            }
522 >         outcounter++;
523 >         if (qd->count>maxdup_count) {
524 >            maxdup_count=qd->count;
525 >            maxdup_seq=seq;
526 >            }
527 >         if (isfasta) {
528 >           if (prefix.is_empty()) {
529 >             fprintf(f_out, ">%s_x%d\n%s\n", qd->firstname, qd->count,
530 >                           rseq.chars());
531               }
532 <           else {  //fastq
533 <            if (convert_phred) convertPhred(rqv);
534 <            if (prefix.is_empty())
522 <               fprintf(f_out, "@%s\n%s\n+\n%s\n", rname.chars(), rseq.chars(),rqv.chars());
523 <              else
524 <               fprintf(f_out, "@%s_%08d\n%s\n+\n%s\n", prefix.chars(), outcounter,
525 <                                  rseq.chars(),rqv.chars() );
532 >           else { //use custom read name
533 >             fprintf(f_out, ">%s%08d_x%d\n%s\n", prefix.chars(), outcounter,
534 >                        qd->count, rseq.chars());
535               }
536 <           } //not collapsing duplicates
537 <        } //for each fastq record
538 <   } //while each input file
539 < FRCLOSE(f_in);
540 < if (doCollapse) {
541 <    outcounter=0;
533 <    int maxdup_count=1;
534 <    char* maxdup_seq=NULL;
535 <    dhash.startIterate();
536 <    FqDupRec* qd=NULL;
537 <    char* seq=NULL;
538 <    while ((qd=dhash.NextData(seq))!=NULL) {
539 <      GStr rseq(seq);
540 <      //do the dusting here
541 <      if (doDust) {
542 <         int dustbases=dust(rseq);
543 <         if (dustbases>(rseq.length()>>1)) {
544 <            if (trashReport && qd->firstname!=NULL) {
545 <              fprintf(freport, "%s_x%d\tD\t%s\n",qd->firstname, qd->count,seq);
546 <              }
547 <            continue;
536 >           }
537 >         else { //fastq format
538 >          if (convert_phred) convertPhred(qd->qv, qd->len);
539 >          if (prefix.is_empty()) {
540 >            fprintf(f_out, "@%s_x%d\n%s\n+\n%s\n", qd->firstname, qd->count,
541 >                           rseq.chars(), qd->qv);
542              }
543 +          else { //use custom read name
544 +            fprintf(f_out, "@%s%08d_x%d\n%s\n+\n%s\n", prefix.chars(), outcounter,
545 +                        qd->count, rseq.chars(), qd->qv);
546 +            }
547 +           }
548 +         }//for each element of dhash
549 +       if (maxdup_count>1) {
550 +         GMessage("Maximum read multiplicity: x %d (read: %s)\n",maxdup_count, maxdup_seq);
551           }
552 <      outcounter++;
553 <      if (qd->count>maxdup_count) {
554 <         maxdup_count=qd->count;
555 <         maxdup_seq=seq;
556 <         }
557 <      if (isfasta) {
558 <        if (prefix.is_empty()) {
559 <          fprintf(f_out, ">%s_x%d\n%s\n", qd->firstname, qd->count,
560 <                        rseq.chars());
561 <          }
562 <        else { //use custom read name
563 <          fprintf(f_out, ">%s%08d_x%d\n%s\n", prefix.chars(), outcounter,
564 <                     qd->count, rseq.chars());
552 >       } //collapse entries
553 >    if (verbose) {
554 >       if (paired_reads) {
555 >           GMessage(">Input files : %s , %s\n", infname.chars(), infname2.chars());
556 >           GMessage("Number of input pairs :%9d\n", incounter);
557 >           GMessage("         Output pairs :%9d\n", outcounter);
558 >           }
559 >         else {
560 >           GMessage(">Input file : %s\n", infname.chars());
561 >           GMessage("Number of input reads :%9d\n", incounter);
562 >           GMessage("         Output reads :%9d\n", outcounter);
563 >           }
564 >       GMessage("------------------------------------\n");
565 >       if (num_trimmed5)
566 >          GMessage("           5' trimmed :%9d  (min. trim: %d)\n", num_trimmed5, min_trimmed5);
567 >       if (num_trimmed3)
568 >          GMessage("           3' trimmed :%9d  (min. trim: %d)\n", num_trimmed3, min_trimmed3);
569 >       GMessage("------------------------------------\n");
570 >       if (trash_s>0)
571 >         GMessage("     Trashed by length:%9d\n", trash_s);
572 >       if (trash_N>0)
573 >         GMessage("         Trashed by N%%:%9d\n", trash_N);
574 >       if (trash_Q>0)
575 >         GMessage("Trashed by low quality:%9d\n", trash_Q);
576 >       if (trash_A5>0)
577 >         GMessage(" Trashed by 5' adapter:%9d\n", trash_A5);
578 >       if (trash_A3>0)
579 >         GMessage(" Trashed by 3' adapter:%9d\n", trash_A3);
580 >       }
581 >    if (trashReport) {
582 >          FWCLOSE(freport);
583            }
584 <        }
585 <      else { //fastq format
586 <       if (convert_phred) convertPhred(qd->qv, qd->len);
567 <       if (prefix.is_empty()) {
568 <         fprintf(f_out, "@%s_x%d\n%s\n+\n%s\n", qd->firstname, qd->count,
569 <                        rseq.chars(), qd->qv);
570 <         }
571 <       else { //use custom read name
572 <         fprintf(f_out, "@%s%08d_x%d\n%s\n+\n%s\n", prefix.chars(), outcounter,
573 <                     qd->count, rseq.chars(), qd->qv);
574 <         }
575 <        }
576 <      }//for each element of dhash
577 <    if (maxdup_count>1) {
578 <      GMessage("Maximum read multiplicity: x %d (read: %s)\n",maxdup_count, maxdup_seq);
579 <      }
580 <   } //report collapsed dhash entries
581 < GMessage("Number of input reads: %9d\n", icounter);
582 < GMessage("       Output records: %9d\n", outcounter);
583 < if (trashReport) {
584 <    FWCLOSE(freport);
585 <    }
584 >    FWCLOSE(f_out);
585 >    FWCLOSE(f_out2);
586 >   } //while each input file
587  
587 FWCLOSE(f_out);
588   //getc(stdin);
589   }
590  
# Line 670 | Line 670
670  
671  
672   bool qtrim(GStr& qvs, int &l5, int &l3) {
673 < if (qvtrim_min==0 || qvs.is_empty()) return false;
673 > if (qvtrim_qmin==0 || qvs.is_empty()) return false;
674   if (qv_phredtype==0) {
675    //try to guess the Phred type
676    int vmin=256, vmax=0;
# Line 683 | Line 683
683    if (qv_phredtype==0) {
684      GError("Error: couldn't determine Phred type, please use the -p33 or -p64 !\n");
685      }
686 <  } //guessing the Phred type
686 >  if (verbose)
687 >    GMessage("Input reads have Phred-%d quality values.\n", (qv_phredtype==33 ? 33 : 64));
688 >  } //guessing Phred type
689   for (l3=qvs.length()-1;l3>2;l3--) {
690 <  if (qvs[l3]-qv_phredtype>=qvtrim_min && qvs[l3-1]-qv_phredtype>=qvtrim_min) break;
690 >  if (qvs[l3]-qv_phredtype>=qvtrim_qmin && qvs[l3-1]-qv_phredtype>=qvtrim_qmin) break;
691    }
692   //just in case, check also the 5' the end (?)
693   for (l5=0;l5<qvs.length()-3;l5++) {
694 <  if (qvs[l5]-qv_phredtype>=qvtrim_min && qvs[l5+1]-qv_phredtype>=qvtrim_min) break;
694 >  if (qvs[l5]-qv_phredtype>=qvtrim_qmin && qvs[l5+1]-qv_phredtype>=qvtrim_qmin) break;
695 >  }
696 > if (qvtrim_max>0) {
697 >  if (qvs.length()-1-l3>qvtrim_max) l3=qvs.length()-1-qvtrim_max;
698 >  if (l5>qvtrim_max) l5=qvtrim_max;
699    }
700   return (l5>0 || l3<qvs.length()-1);
701   }
# Line 1313 | Line 1319
1319   for (int i=0;i<len;i++) q[i]+=qv_cvtadd;
1320   }
1321  
1322 + bool getFastxRec(GLineReader& fq, GStr& rseq, GStr& rqv,
1323 +          GStr& rname, GStr& rinfo, GStr& infname) {
1324 + rseq="";
1325 + rqv="";
1326 + rname="";
1327 + rinfo="";
1328 + if (fq.eof()) return false;
1329 + char* l=fq.getLine();
1330 + while (l!=NULL && (l[0]==0 || isspace(l[0]))) l=fq.getLine(); //ignore empty lines
1331 + if (l==NULL) return false;
1332 + /* if (rawFormat) {
1333 +      //TODO: implement raw qseq parsing here
1334 +      //if (raw type=N) then continue; //skip invalid/bad records
1335 +      } //raw qseq format
1336 + else { // FASTQ or FASTA */
1337 + isfasta=(l[0]=='>');
1338 + if (!isfasta && l[0]!='@') GError("Error: fasta/fastq record marker not found(%s)\n%s\n",
1339 +      infname.chars(), l);
1340 + GStr s(l);
1341 + rname=&(l[1]);
1342 + for (int i=0;i<rname.length();i++)
1343 +    if (rname[i]<=' ') {
1344 +       if (i<rname.length()-2) rinfo=rname.substr(i+1);
1345 +       rname.cut(i);
1346 +       break;
1347 +       }
1348 +  //now get the sequence
1349 + if ((l=fq.getLine())==NULL)
1350 +      GError("Error: unexpected EOF after header for read %s (%s)\n",
1351 +                   rname.chars(), infname.chars());
1352 + rseq=l; //this must be the DNA line
1353 + while ((l=fq.getLine())!=NULL) {
1354 +      //seq can span multiple lines
1355 +      if (l[0]=='>' || l[0]=='+') {
1356 +           fq.pushBack();
1357 +           break; //
1358 +           }
1359 +      rseq+=l;
1360 +      } //check for multi-line seq
1361 + if (!isfasta) { //reading fastq quality values, which can also be multi-line
1362 +    if ((l=fq.getLine())==NULL)
1363 +        GError("Error: unexpected EOF after sequence for %s\n", rname.chars());
1364 +    if (l[0]!='+') GError("Error: fastq qv header marker not detected!\n");
1365 +    if ((l=fq.getLine())==NULL)
1366 +        GError("Error: unexpected EOF after qv header for %s\n", rname.chars());
1367 +    rqv=l;
1368 +    //if (rqv.length()!=rseq.length())
1369 +    //  GError("Error: qv len != seq len for %s\n", rname.chars());
1370 +    while (rqv.length()<rseq.length() && ((l=fq.getLine())!=NULL)) {
1371 +      rqv+=l; //append to qv string
1372 +      }
1373 +    }// fastq
1374 + // } //<-- FASTA or FASTQ
1375 + rseq.upper(); //TODO: what if we care about masking?
1376 + return true;
1377 + }
1378 +
1379 + char process_read(GStr& rname, GStr& rseq, GStr& rqv, int &l5, int &l3) {
1380 + //returns 0 if the read was untouched, 1 if it was just trimmed
1381 + // and a trash code if it was trashed
1382 + l5=0;
1383 + l3=rseq.length()-1;
1384 + if (l3-l5+1<min_read_len) {
1385 +   return 's';
1386 +   }
1387 + GStr wseq(rseq.chars());
1388 + GStr wqv(rqv.chars());
1389 + int w5=l5;
1390 + int w3=l3;
1391 + //first do the q-based trimming
1392 + if (qvtrim_qmin!=0 && !wqv.is_empty() && qtrim(wqv, w5, w3)) { // qv-threshold trimming
1393 +   if (w3-w5+1<min_read_len) {
1394 +     return 'Q'; //invalid read
1395 +     }
1396 +    //-- keep only the w5..w3 range
1397 +   l5=w5;
1398 +   l3=w3;
1399 +   wseq=wseq.substr(w5, w3-w5+1);
1400 +   if (!wqv.is_empty())
1401 +      wqv=wqv.substr(w5, w3-w5+1);
1402 +   } //qv trimming
1403 + // N-trimming on the remaining read seq
1404 + if (ntrim(wseq, w5, w3)) {
1405 +   //GMessage("before: %s\n",wseq.chars());
1406 +   //GMessage("after : %s (%d)\n",wseq.substr(w5,w3-w5+1).chars(),w3-w5+1);
1407 +   l5+=w5;
1408 +   l3-=(wseq.length()-1-w3);
1409 +   if (w3-w5+1<min_read_len) {
1410 +     return 'N'; //to be trashed
1411 +     }
1412 +    //-- keep only the w5..w3 range
1413 +   wseq=wseq.substr(w5, w3-w5+1);
1414 +   if (!wqv.is_empty())
1415 +      wqv=wqv.substr(w5, w3-w5+1);
1416 +   w5=0;
1417 +   w3=wseq.length()-1;
1418 +   }
1419 + if (a3len>0) {
1420 +  if (trim_adapter3(wseq, w5, w3)) {
1421 +     int trimlen=wseq.length()-(w3-w5+1);
1422 +     num_trimmed3++;
1423 +     if (trimlen<min_trimmed3)
1424 +         min_trimmed3=trimlen;
1425 +     l5+=w5;
1426 +     l3-=(wseq.length()-1-w3);
1427 +     if (w3-w5+1<min_read_len) {
1428 +         return '3';
1429 +         }
1430 +      //-- keep only the w5..w3 range
1431 +      wseq=wseq.substr(w5, w3-w5+1);
1432 +      if (!wqv.is_empty())
1433 +         wqv=wqv.substr(w5, w3-w5+1);
1434 +      }//some adapter was trimmed
1435 +   } //adapter trimming
1436 + if (a5len>0) {
1437 +  if (trim_adapter5(wseq, w5, w3)) {
1438 +     int trimlen=wseq.length()-(w3-w5+1);
1439 +     num_trimmed5++;
1440 +     if (trimlen<min_trimmed5)
1441 +         min_trimmed5=trimlen;
1442 +     l5+=w5;
1443 +     l3-=(wseq.length()-1-w3);
1444 +     if (w3-w5+1<min_read_len) {
1445 +         return '5';
1446 +         }
1447 +      //-- keep only the w5..w3 range
1448 +      wseq=wseq.substr(w5, w3-w5+1);
1449 +      if (!wqv.is_empty())
1450 +         wqv=wqv.substr(w5, w3-w5+1);
1451 +      }//some adapter was trimmed
1452 +   } //adapter trimming
1453 + if (doCollapse) {
1454 +   //keep read for later
1455 +   FqDupRec* dr=dhash.Find(wseq.chars());
1456 +   if (dr==NULL) { //new entry
1457 +          //if (prefix.is_empty())
1458 +             dhash.Add(wseq.chars(),
1459 +                  new FqDupRec(&wqv, rname.chars()));
1460 +          //else dhash.Add(wseq.chars(), new FqDupRec(wqv.chars(),wqv.length()));
1461 +         }
1462 +      else
1463 +         dr->add(wqv);
1464 +   } //collapsing duplicates
1465 + else { //not collapsing duplicates
1466 +   //apply the dust filter now
1467 +   if (doDust) {
1468 +     int dustbases=dust(wseq);
1469 +     if (dustbases>(wseq.length()>>1)) {
1470 +        return 'D';
1471 +        }
1472 +     }
1473 +   } //not collapsing duplicates
1474 + return (l5>0 || l3<rseq.length()-1) ? 1 : 0;
1475 + }
1476 +
1477 + void printHeader(FILE* f_out, char recmarker, GStr& rname, GStr& rinfo) {
1478 + //GMessage("printing Header..%c%s\n",recmarker, rname.chars());
1479 + if (rinfo.is_empty()) fprintf(f_out, "%c%s\n",recmarker,rname.chars());
1480 +  else fprintf(f_out, "%c%s %s\n",recmarker, rname.chars(), rinfo.chars());
1481 + }
1482 +
1483 + void writeRead(FILE* f_out, GStr& rname, GStr& rinfo, GStr& rseq, GStr& rqv, int& outcounter) {
1484 +   outcounter++;
1485 +   bool asFasta=(rqv.is_empty() || fastaOutput);
1486 +   if (asFasta) {
1487 +    if (prefix.is_empty()) {
1488 +       printHeader(f_out, '>',rname,rinfo);
1489 +       fprintf(f_out, "%s\n", rseq.chars()); //plain one-line fasta for now
1490 +       }
1491 +      else {
1492 +       fprintf(f_out, ">%s%08d\n%s\n", prefix.chars(), outcounter,
1493 +                          rseq.chars());
1494 +       }
1495 +     }
1496 +   else {  //fastq
1497 +    if (convert_phred) convertPhred(rqv);
1498 +    if (prefix.is_empty()) {
1499 +       printHeader(f_out, '@', rname, rinfo);
1500 +       fprintf(f_out, "%s\n+\n%s\n", rseq.chars(), rqv.chars());
1501 +       }
1502 +      else
1503 +       fprintf(f_out, "@%s_%08d\n%s\n+\n%s\n", prefix.chars(), outcounter,
1504 +                          rseq.chars(),rqv.chars() );
1505 +     }
1506 + }
1507 +
1508 + void trash_report(char trashcode, GStr& rname, FILE* freport) {
1509 + if (freport==NULL || trashcode<=' ') return;
1510 + if (trashcode=='3' || trashcode=='5') {
1511 +   fprintf(freport, "%s\tA%c\n",rname.chars(),trashcode);
1512 +   }
1513 + else {
1514 +   fprintf(freport, "%s\t%c\n",rname.chars(),trashcode);
1515 +   }
1516 + //tcounter++;
1517 + }
1518 +
1519 + GStr getFext(GStr& s, int* xpos=NULL) {
1520 + //s must be a filename without a path
1521 + GStr r("");
1522 + if (xpos!=NULL) *xpos=0;
1523 + if (s.is_empty() || s=="-") return r;
1524 + int p=s.rindex('.');
1525 + int d=s.rindex('/');
1526 + if (p<=0 || p>s.length()-2 || p<s.length()-7 || p<d) return r;
1527 + r=s.substr(p+1);
1528 + if (xpos!=NULL) *xpos=p+1;
1529 + r.lower();
1530 + return r;
1531 + }
1532 +
1533 + void baseFileName(GStr& fname) {
1534 + //remove all known extensions, like .txt,fq,fastq,fasta,fa)(.gz .gzip .bz2 .bzip2) .
1535 + int xpos=0;
1536 + GStr fext=getFext(fname, &xpos);
1537 + if (xpos<=1) return;
1538 + bool extdel=false;
1539 + GStr f2;
1540 + if (fext=="z" || fext=="zip") {
1541 +   extdel=true;
1542 +   }
1543 +  else if (fext.length()>=2) {
1544 +   f2=fext.substr(0,2);
1545 +   extdel=(f2=="gz" || f2=="bz");
1546 +   }
1547 + if (extdel) {
1548 +   fname.cut(xpos-1);
1549 +   fext=getFext(fname, &xpos);
1550 +   if (xpos<=1) return;
1551 +   }
1552 + extdel=false;
1553 + if (fext=="f" || fext=="fq" || fext=="txt" || fext=="seq" || fext=="sequence") {
1554 +   extdel=true;
1555 +   }
1556 +  else if (fext.length()>=2) {
1557 +   extdel=(fext.substr(0,2)=="fa");
1558 +   }
1559 + if (extdel) fname.cut(xpos-1);
1560 + GStr fncp(fname);
1561 + fncp.lower();
1562 + fncp.chomp("seq");
1563 + fncp.chomp("sequence");
1564 + fncp.trimR("_.");
1565 + if (fncp.length()<fname.length()) fname.cut(fncp.length());
1566 + }
1567 +
1568 + FILE* prepOutFile(GStr& infname, GStr& pocmd) {
1569 +  FILE* f_out=NULL;
1570 +  GStr fname(getFileName(infname.chars()));
1571 +  //eliminate known extensions
1572 +  baseFileName(fname);
1573 +  if (outsuffix.is_empty() || outsuffix=="-") { return stdout; }
1574 +    else if (pocmd.is_empty()) {
1575 +               GStr oname(fname);
1576 +               oname.append('.');
1577 +               oname.append(outsuffix);
1578 +               f_out=fopen(oname.chars(),"w");
1579 +               if (f_out==NULL) GError("Error: cannot create '%s'\n",oname.chars());
1580 +               }
1581 +            else {
1582 +              GStr oname(">");
1583 +              oname.append(fname);
1584 +              oname.append('.');
1585 +              oname.append(outsuffix);
1586 +              pocmd.append(oname);
1587 +              f_out=popen(pocmd.chars(), "w");
1588 +              if (f_out==NULL) GError("Error: cannot popen '%s'\n",pocmd.chars());
1589 +              }
1590 + return f_out;
1591 + }
1592 +
1593 + void guess_unzip(GStr& fname, GStr& picmd) {
1594 + GStr fext=getFext(fname);
1595 + if (fext=="gz" || fext=="gzip" || fext=="z") {
1596 +    picmd="gzip -cd ";
1597 +    }
1598 +   else if (fext=="bz2" || fext=="bzip2" || fext=="bz" || fext=="bzip") {
1599 +    picmd="bzip2 -cd ";
1600 +    }
1601 + }
1602 +
1603 + void setupFiles(FILE*& f_in, FILE*& f_in2, FILE*& f_out, FILE*& f_out2,
1604 +                       GStr& s, GStr& infname, GStr& infname2) {
1605 + // uses outsuffix to generate output file names and open file handles as needed
1606 + infname="";
1607 + infname2="";
1608 + f_in=NULL;
1609 + f_in2=NULL;
1610 + f_out=NULL;
1611 + f_out2=NULL;
1612 + //analyze outsuffix intent
1613 + GStr pocmd;
1614 + GStr ox=getFext(outsuffix);
1615 + if (ox.length()>2) ox=ox.substr(0,2);
1616 + if (ox=="gz") pocmd="gzip -9 -c ";
1617 +   else if (ox=="bz") pocmd="bzip2 -9 -c ";
1618 + if (s=="-") {
1619 +    f_in=stdin;
1620 +    infname="stdin";
1621 +    f_out=prepOutFile(infname, pocmd);
1622 +    return;
1623 +    } // streaming from stdin
1624 + s.startTokenize(",:");
1625 + s.nextToken(infname);
1626 + bool paired=s.nextToken(infname2);
1627 + if (fileExists(infname.chars())==0)
1628 +    GError("Error: cannot find file %s!\n",infname.chars());
1629 + GStr fname(getFileName(infname.chars()));
1630 + GStr picmd;
1631 + guess_unzip(fname, picmd);
1632 + if (picmd.is_empty()) {
1633 +   f_in=fopen(infname.chars(), "r");
1634 +   if (f_in==NULL) GError("Error opening file '%s'!\n",infname.chars());
1635 +   }
1636 +  else {
1637 +   picmd.append(infname);
1638 +   f_in=popen(picmd.chars(), "r");
1639 +   if (f_in==NULL) GError("Error at popen %s!\n", picmd.chars());
1640 +   }
1641 + f_out=prepOutFile(infname, pocmd);
1642 + if (!paired) return;
1643 + if (doCollapse) GError("Error: sorry, -C option cannot be used with paired reads!\n");
1644 + // ---- paired reads:-------------
1645 + if (fileExists(infname2.chars())==0)
1646 +     GError("Error: cannot find file %s!\n",infname2.chars());
1647 + picmd="";
1648 + GStr fname2(getFileName(infname2.chars()));
1649 + guess_unzip(fname2, picmd);
1650 + if (picmd.is_empty()) {
1651 +   f_in2=fopen(infname2.chars(), "r");
1652 +   if (f_in2==NULL) GError("Error opening file '%s'!\n",infname2.chars());
1653 +   }
1654 +  else {
1655 +   picmd.append(infname2);
1656 +   f_in2=popen(picmd.chars(), "r");
1657 +   if (f_in2==NULL) GError("Error at popen %s!\n", picmd.chars());
1658 +   }
1659 + f_out2=prepOutFile(infname2, pocmd);
1660 + }

Diff Legend

Removed lines
+ Added lines
< Changed lines
> Changed lines