ViewVC Help
View File | Revision Log | Show Annotations | View Changeset | Root Listing
root/gclib/fqtrim/fqtrim.cpp
(Generate patch)
# Line 2 | Line 2
2   #include "GStr.h"
3   #include "GHash.hh"
4   #include "GList.hh"
5 + #include <ctype.h>
6 + #include "GAlnExtend.h"
7  
8   #define USAGE "Usage:\n\
9 < fqtrim [-5 <5'adapter>] [-3 <3'adapter>] [-l <minlen>] [-q <minqv>] [-C] [-D]\\\n\
10 <   [-p {64|33}] [-n <rename_prefix>] [-o <trimmed.fq>] [-r <discarded.lst>]\\\n\
11 <   [-Q] <input.fq>\n\
9 > fqtrim [{-5 <5adaptor> -3 <3adaptor>|-f <adaptors_file>}] [-a <min_matchlen>]\\\n\
10 >   [-R] [-q <minq> [-t <trim_max_len>]] [-p {64|33}] [-o <outsuffix>]\\\n\
11 >   [-l <minlen>] [-C] [-D] [-Q] [-n <rename_prefix>] [-r <discarded.lst>]\\\n\
12 >    <input.fq>[,<input_mates.fq>\n\
13   \n\
14 < Trim low quality bases at 3' end, optionally trim adapter sequence, filter\n\
15 < for low complexity and collapse duplicate reads\n\
14 > Trim low quality bases at the 3' end and can trim adaptor sequence(s), filter\n\
15 > for low complexity and collapse duplicate reads.\n\
16 > If read pairs should be trimmed and kept together (i.e. without discarding\n\
17 > one read in a pair), the two file names should be given delimited by a comma\n\
18 > or a colon character\n\
19   \n\
20   Options:\n\
21   -n  rename all the reads using the <prefix> followed by a read counter;\n\
22      if -C option was given, the suffix \"_x<N>\" is appended, with <N> being\n\
23      the read duplication count\n\
24 < -o  write the trimmed/filtered fastq into <trimmed.fq>(instead of stdout)\n\
25 < -5  trim the given adapter or primer sequence at the 5' end of each read\n\
24 > -o  unless this parameter is '-', write the trimmed/filtered reads to \n\
25 >    file(s) named <input>.<outsuffix> which will be created in the \n\
26 >    current (working) directory; (writes to stdout if -o- is given);\n\
27 >    a suffix ending with .gz, .gzip or .bz2 will enforce compression\n\
28 > -f  file with adaptor sequences to trim, each line having this format:\n\
29 >    <5'-adaptor-sequence> <3'-adaptor-sequence>\n\
30 > -5  trim the given adaptor or primer sequence at the 5' end of each read\n\
31      (e.g. -5 CGACAGGTTCAGAGTTCTACAGTCCGACGATC)\n\
32 < -3  trim the given adapter sequence at the 3' end of each read\n\
32 > -3  trim the given adaptor sequence at the 3' end of each read\n\
33      (e.g. -3 TCGTATGCCGTCTTCTGCTTG)\n\
34 < -q  trim bases with quality value lower than <minq> (starting the 3' end)\n\
34 > -A  disable polyA/T trimming (enabled by default)\n\
35 > -y  minimum length of exact match to adaptor sequence at the proper end (6)\n\
36 > -q  trim bases with quality value lower than <minq> (starting at the 3' end)\n\
37 > -t  for -q option, maximum trimming at the 3' end is limited to <trim_max_len>\n\
38   -m  maximum percentage of Ns allowed in a read after trimming (default 7)\n\
39   -l  minimum \"clean\" length after trimming that a read must have\n\
40      in order to pass the filter (default: 16)\n\
# Line 34 | Line 48
48   -Q  convert quality values to the other Phred qv type\n\
49   -V  verbose processing\n\
50   "
37 // example 3' adapter for miRNAs: TCGTATGCCGTCTTCTGCTTG
51  
52 < //For pair ends sequencing:
52 > //-z  for -o option, the output stream(s) will be first piped into the given\n
53 > //   <zcmd> command, which must output to stdout (e.g. -z 'bzip2 -9 -c')\n
54 >
55 >
56 > // example 3' adaptor for miRNAs: TCGTATGCCGTCTTCTGCTTG
57 >
58 > //For paired reads sequencing:
59   //3' : ACACTCTTTCCCTACACGACGCTCTTCCGATCT
60   //5' : GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
61 < FILE* f_out=NULL; //stdout if not provided
62 < FILE* f_in=NULL; //input fastq (stdin if not provided)
61 > //FILE* f_out=NULL; //stdout if not provided
62 > //FILE* f_out2=NULL; //for paired reads
63 > //FILE* f_in=NULL; //input fastq (stdin if not provided)
64 > //FILE* f_in2=NULL; //for paired reads
65 >
66   FILE* freport=NULL;
67 +
68   bool debug=false;
69   bool verbose=false;
70   bool doCollapse=false;
71   bool doDust=false;
72 + bool doPolyTrim=true;
73 + bool fastaOutput=false;
74   bool trashReport=false;
75 < //bool rawFormat=false;
75 > bool revCompl=false; //also reverse complement adaptor sequences
76   int min_read_len=16;
77   double max_perc_N=7.0;
78   int dust_cutoff=16;
79   bool isfasta=false;
80   bool convert_phred=false;
81 + GStr outsuffix; // -o
82   GStr prefix;
83 < GStr adapter3;
84 < GStr adapter5;
85 <
86 < int qvtrim_min=0;
83 > GStr zcmd;
84 > int num_trimmed5=0;
85 > int num_trimmed3=0;
86 > int num_trimmedN=0;
87 > int num_trimmedQ=0;
88 > int min_trimmed5=INT_MAX;
89 > int min_trimmed3=INT_MAX;
90  
91 + int qvtrim_qmin=0;
92 + int qvtrim_max=0;  //for -q, do not trim at 3'-end more than this number of bases
93   int qv_phredtype=0; // could be 64 or 33 (0 means undetermined yet)
94   int qv_cvtadd=0; //could be -31 or +31
95  
96 < int a3len=0;
97 < int a5len=0;
98 < // adaptor matching metrics -- for extendMatch() function
99 < const int a_m_score=2; //match score
100 < const int a_mis_score=-3; //mismatch
101 < const int a_dropoff_score=7;
102 < const int a_min_score=8; //an exact match of 4 bases at the proper ends WILL be trimmed
103 < const int a_min_chain_score=15; //for gapped alignments
104 <
105 < class CSegChain;
106 <
107 < class CSegPair {
108 <  public:
109 <   GSeg a;
110 <   GSeg b; //the adapter segment
111 <   int score;
112 <   int flags;
113 <   CSegChain* chain;
114 <   CSegPair(int astart=0, int aend=0, int bstart=0, int bend=0, int mscore=0):a(astart,aend),b(bstart, bend) {
115 <      score=mscore;
116 <      if (score==0) score=a.len()*a_m_score;
117 <      flags=0;
118 <      chain=NULL;
119 <      }
120 <   int len() { return  a.len(); }
121 <   bool operator==(CSegPair& d){
122 <      //return (a.start==d.a.start && a.end==d.a.end && b.start==d.b.start && b.end==d.b.end);
123 <      //make equal even segments that are included into one another:
124 <      return (d.a.start>=a.start && d.a.end<=a.end && d.b.start>=b.start && d.b.end<=b.end);
125 <      }
126 <   bool operator>(CSegPair& d){ //ordering based on b (adaptor) start coord and score
96 <     if (b.start==d.b.start) {
97 <        if (score==d.score) {
98 <           //just try to be consistent:
99 <           if (b.end==d.b.end) {
100 <             return (a.start==d.a.start)?(a.end<d.a.end):(a.start<d.a.start);
101 <             }
102 <           return (b.end>d.b.end);
103 <           }
104 <         else return (score<d.score);
96 > // adaptor matching metrics -- for X-drop ungapped extension
97 > //const int match_reward=2;
98 > //const int mismatch_penalty=3;
99 > const int match_reward=2;
100 > const int mismatch_penalty=4;
101 > const int Xdrop=10;
102 >
103 > const int poly_m_score=2; //match score
104 > const int poly_mis_score=-3; //mismatch
105 > const int poly_dropoff_score=7;
106 > int poly_minScore=12; //i.e. an exact match of 6 bases at the proper ends WILL be trimmed
107 >
108 > const char *polyA_seed="AAAA";
109 > const char *polyT_seed="TTTT";
110 >
111 > struct CASeqData {
112 >   //positional data for every possible hexamer in an adaptor
113 >   GVec<uint16>* pz[4096]; //0-based coordinates of all possible hexamers in the adaptor sequence
114 >   GVec<uint16>* pzr[4096]; //0-based coordinates of all possible hexamers for the reverse complement of the adaptor sequence
115 >   GStr seq; //actual adaptor sequence data
116 >   GStr seqr; //reverse complement sequence
117 >   int amlen; //fraction of adaptor length matching that's
118 >              //enough to consider the alignment
119 >   GAlnTrimType trim_type;
120 >   bool use_reverse;
121 >   CASeqData(bool rev=false):seq(),seqr(),
122 >             amlen(0), use_reverse(rev) {
123 >     trim_type=galn_None; //should be updated later!
124 >     for (int i=0;i<4096;i++) {
125 >        pz[i]=NULL;
126 >        pzr[i]=NULL;
127          }
106     return (b.start>d.b.start);
128       }
108   bool operator<(CSegPair& d){ //ordering based on b (adaptor) coord
109     /*if (b.start==d.b.start && b.end==d.b.end) {
110          return (a.start==d.a.start)?(a.end<d.a.end):(a.start<d.a.start);
111          }
112     return (b.start==d.b.start)?(b.end<d.b.end):(b.start<d.b.start);*/
113     if (b.start==d.b.start) {
114        if (score==d.score) {
115           //just try to be consistent:
116           if (b.end==d.b.end) {
117             return (a.start==d.a.start)?(a.end>d.a.end):(a.start>d.a.start);
118             }
119           return (b.end<d.b.end);
120           }
121         else return (score>d.score);
122        }
123     return (b.start<d.b.start);
124     }
125 };
129  
130 < int cmpSegEnds(pointer sa, pointer sb) { //sort by adaptor seg ends AND score
131 < CSegPair& x = *(CSegPair *)sa;
132 < CSegPair& y = *(CSegPair *)sb;
133 < /*
134 < if (x.b.end==y.b.end) {
135 <     if (x.b.start==y.b.start) {
136 <         if (x.a.end==y.a.end) {
137 <            if (x.a.start==y.a.start) return 0;
138 <            return ((x.a.start>y.a.start) ? -1 : 1);
139 <            }
140 <          else {
141 <            return ((x.a.end>y.a.end) ? -1 : 1);
142 <            }
143 <          }
144 <      else {
145 <       return ((x.b.start>y.b.start) ? -1 : 1);
146 <       }
147 <     }
148 <    else {
146 <     return ((x.b.end>y.b.end) ? -1 : 1);
147 <     }
148 < */
149 <  if (x.b.end==y.b.end) {
150 <     if (x.score==y.score) {
151 <     if (x.b.start==y.b.start) {
152 <         if (x.a.end==y.a.end) {
153 <            if (x.a.start==y.a.start) return 0;
154 <            return ((x.a.start<y.a.start) ? -1 : 1);
155 <            }
156 <          else {
157 <            return ((x.a.end<y.a.end) ? -1 : 1);
158 <            }
159 <          }
160 <      else {
161 <       return ((x.b.start<y.b.start) ? -1 : 1);
162 <       }
163 <      } else return ((x.score>y.score) ? -1 : 1);
164 <     }
165 <    else {
166 <     return ((x.b.end>y.b.end) ? -1 : 1);
130 >   void update(const char* s) {
131 >         seq=s;
132 >         table6mers(seq.chars(), seq.length(), pz);
133 >         amlen=iround(double(seq.length())*0.8);
134 >         if (amlen<12)
135 >                amlen=12;
136 >         if (!use_reverse) return;
137 >         //reverse complement
138 >         seqr=s;
139 >         int slen=seq.length();
140 >         for (int i=0;i<slen;i++)
141 >           seqr[i]=ntComplement(seq[slen-i-1]);
142 >         table6mers(seqr.chars(), seqr.length(), pzr);
143 >   }
144 >
145 >   ~CASeqData() {
146 >     for (int i=0;i<4096;i++) {
147 >       delete pz[i];
148 >       delete pzr[i];
149       }
150 +   }
151 + };
152  
153 < }
153 > GVec<CASeqData> adaptors5;
154 > GVec<CASeqData> adaptors3;
155  
156 < class CSegChain:public GList<CSegPair> {
157 < public:
173 <   uint astart;
174 <   uint aend;
175 <   uint bstart;
176 <   uint bend;
177 <   int score;
178 <   bool endSort;
179 <  CSegChain(bool aln5=false):GList<CSegPair>(true,true,true) {//sorted, free elements, unique
180 <   //as SegPairs are inserted, they will be sorted by a.start coordinate
181 <   score=0;
182 <   astart=MAX_UINT;
183 <   aend=0;
184 <   bstart=MAX_UINT;
185 <   bend=0;
186 <   endSort=aln5;
187 <   if (aln5) { setSorted(cmpSegEnds); }
188 <   }
189 < bool operator==(CSegChain& d) {
190 <   //return (score==d.score);
191 <    return (astart==d.astart && aend==d.aend && bstart==d.bstart && bend==d.bend);
192 <   }
193 < bool operator>(CSegChain& d) { // order based on b (adaptor) coordinate
194 <   //return (score<d.score);
195 <   if (bstart==d.bstart && bend==d.bend) {
196 <          return (astart==d.astart)?(aend>d.aend):(astart>d.astart);
197 <          }
198 <     return (bstart==d.bstart)?(bend>d.bend):(bstart>d.bstart);
199 <   }
200 < bool operator<(CSegChain& d) {
201 <   //return (score>d.score);
202 <   if (bstart==d.bstart && bend==d.bend) {
203 <          return (astart==d.astart)?(aend<d.aend):(astart<d.astart);
204 <          }
205 <     return (bstart==d.bstart)?(bend<d.bend):(bstart<d.bstart);
206 <   }
207 < void addSegPair(CSegPair* segp) {
208 <   if (AddIfNew(segp)!=segp) return;
209 <   score+=segp->score;
210 <   if (astart>segp->a.start) astart=segp->a.start;
211 <   if (aend<segp->a.end) aend=segp->a.end;
212 <   if (bstart>segp->b.start) bstart=segp->b.start;
213 <   if (bend<segp->b.end) bend=segp->b.end;
214 <   }
215 < //for building actual chains:
216 < bool extendChain(CSegPair* segp) { //segp expected to be "Greater Than" current chain
217 <   int bgap=0;
218 <   int agap=0;
219 <   //if (endSort) {
220 <   if (bstart>segp->b.start) {
221 <      bgap = (int)(bstart-segp->b.end);
222 <      if (abs(bgap)>2) return false;
223 <      agap = (int)(astart-segp->a.end);
224 <      if (abs(agap)>2) return false;
225 <      }
226 <     else {
227 <      bgap = (int) (segp->b.start-bend);
228 <      if (abs(bgap)>2) return false;
229 <      agap = (int)(segp->a.start-aend);
230 <      if (abs(agap)>2) return false;
231 <      }
232 <   if (agap*bgap<0) return false;
233 <   addSegPair(segp);
234 <   score-=abs(agap)+abs(bgap);
235 <   return true;
236 <   }
237 < };
156 > CGreedyAlignData* gxmem_l=NULL;
157 > CGreedyAlignData* gxmem_r=NULL;
158  
159   // element in dhash:
160   class FqDupRec {
# Line 273 | Line 193
193    if (!s.is_empty()) {
194        if (s=='-') f=stdout;
195        else {
196 <       f=fopen(s,"w");
196 >       f=fopen(s.chars(),"w");
197         if (f==NULL) GError("Error creating file: %s\n", s.chars());
198         }
199       }
# Line 284 | Line 204
204  
205   GHash<FqDupRec> dhash; //hash to keep track of duplicates
206  
207 + void addAdaptor(GVec<CASeqData>& adaptors, GStr& seq, GAlnTrimType trim_type);
208 + int loadAdaptors(const char* fname);
209 +
210 + void setupFiles(FILE*& f_in, FILE*& f_in2, FILE*& f_out, FILE*& f_out2,
211 +                       GStr& s, GStr& infname, GStr& infname2);
212 + // uses outsuffix to generate output file names and open file handles as needed
213 +
214 + void writeRead(FILE* f_out, GStr& rname, GStr& rinfo, GStr& rseq, GStr& rqv, int& outcounter);
215 + void trash_report(char trashcode, GStr& rname, FILE* freport);
216 +
217 + bool getFastxRec(GLineReader& fq, GStr& rseq, GStr& rqv,
218 +          GStr& rname, GStr& rinfo, GStr& infname);
219 +
220 + char process_read(GStr& rname, GStr& rseq, GStr& rqv, int &l5, int &l3);
221 + //returns 0 if the read was untouched, 1 if it was trimmed and a trash code if it was trashed
222 +
223   bool ntrim(GStr& rseq, int &l5, int &l3); //returns true if any trimming occured
224   bool qtrim(GStr& qvs, int &l5, int &l3); //return true if any trimming occured
225   int dust(GStr& seq);
226 < bool trim_adapter3(GStr& seq, int &l5, int &l3); //returns true if any trimming occured
227 < bool trim_adapter5(GStr& seq, int &l5, int &l3); //returns true if any trimming occured
226 > bool trim_poly5(GStr &seq, int &l5, int &l3, const char* poly_seed); //returns true if any trimming occured
227 > bool trim_poly3(GStr &seq, int &l5, int &l3, const char* poly_seed);
228 > bool trim_adaptor5(GStr& seq, int &l5, int &l3); //returns true if any trimming occured
229 > bool trim_adaptor3(GStr& seq, int &l5, int &l3);
230  
231   void convertPhred(char* q, int len);
232   void convertPhred(GStr& q);
233  
234   int main(int argc, char * const argv[]) {
235 <  GArgs args(argc, argv, "YQDCVl:d:3:5:m:n:r:p:q:o:");
235 >  GArgs args(argc, argv, "YQDCRVAl:d:3:5:m:n:r:p:q:f:t:o:z:a:");
236    int e;
299  int icounter=0; //counter for input reads
300  int outcounter=0; //counter for output reads
237    if ((e=args.isError())>0) {
238        GMessage("%s\nInvalid argument: %s\n", USAGE, argv[e]);
239        exit(224);
240        }
241    debug=(args.getOpt('Y')!=NULL);
242 <  debug=(args.getOpt('V')!=NULL);
242 >  verbose=(args.getOpt('V')!=NULL);
243    convert_phred=(args.getOpt('Q')!=NULL);
244    doCollapse=(args.getOpt('C')!=NULL);
245    doDust=(args.getOpt('D')!=NULL);
246 +  revCompl=(args.getOpt('R')!=NULL);
247 +  if (args.getOpt('A')) doPolyTrim=false;
248    /*
249    rawFormat=(args.getOpt('R')!=NULL);
250    if (rawFormat) {
# Line 315 | Line 253
253    */
254    prefix=args.getOpt('n');
255    GStr s=args.getOpt('l');
256 <  if (!s.is_empty())
256 >  if (!s.is_empty())
257       min_read_len=s.asInt();
258    s=args.getOpt('m');
259 <  if (!s.is_empty())
259 >  if (!s.is_empty())
260       max_perc_N=s.asDouble();
261    s=args.getOpt('d');
262    if (!s.is_empty()) {
# Line 327 | Line 265
265       }
266    s=args.getOpt('q');
267    if (!s.is_empty()) {
268 <     qvtrim_min=s.asInt();
268 >     qvtrim_qmin=s.asInt();
269 >     }
270 >  s=args.getOpt('t');
271 >  if (!s.is_empty()) {
272 >     qvtrim_max=s.asInt();
273       }
274    s=args.getOpt('p');
275    if (!s.is_empty()) {
# Line 340 | Line 282
282          qv_phredtype=64;
283          qv_cvtadd=-31;
284          }
285 <       else
285 >       else
286           GMessage("%s\nInvalid value for -p option (can only be 64 or 33)!\n",USAGE);
287       }
288 <  if (args.getOpt('3')!=NULL) {
289 <    adapter3=args.getOpt('3');
290 <    adapter3.upper();
291 <    a3len=adapter3.length();
292 <    }
293 <  if (args.getOpt('5')!=NULL) {
294 <    adapter5=args.getOpt('5');
295 <    adapter5.upper();
296 <    a5len=adapter5.length();
288 >  s=args.getOpt('f');
289 >  if (!s.is_empty()) {
290 >   loadAdaptors(s.chars());
291 >   }
292 >  bool fileAdaptors=adaptors5.Count()+adaptors3.Count();
293 >  s=args.getOpt('5');
294 >  if (!s.is_empty()) {
295 >    if (fileAdaptors)
296 >      GError("Error: options -5 and -f cannot be used together!\n");
297 >    s.upper();
298 >    addAdaptor(adaptors5, s, galn_TrimLeft);
299 >    }
300 >  s=args.getOpt('3');
301 >  if (!s.is_empty()) {
302 >    if (fileAdaptors)
303 >      GError("Error: options -3 and -f cannot be used together!\n");
304 >      s.upper();
305 >      addAdaptor(adaptors3, s, galn_TrimRight);
306      }
307 +  s=args.getOpt('y');
308 +  if (!s.is_empty()) {
309 +     int minmatch=s.asInt();
310 +     poly_minScore=minmatch*poly_m_score;
311 +     }
312 +
313 +  if (args.getOpt('o')!=NULL) outsuffix=args.getOpt('o');
314 +                         else outsuffix="-";
315    trashReport=  (args.getOpt('r')!=NULL);
316 <  if (args.startNonOpt()==0) {
316 >  int fcount=args.startNonOpt();
317 >  if (fcount==0) {
318      GMessage(USAGE);
319      exit(224);
320      }
321 <
322 <  openfw(f_out, args, 'o');
323 <  if (f_out==NULL) f_out=stdout;
321 >   if (fcount>1 && doCollapse) {
322 >    GError("%s Sorry, the -C option only works with a single input.\n", USAGE);
323 >    }
324 >  //openfw(f_out, args, 'o');
325 >  //if (f_out==NULL) f_out=stdout;
326    if (trashReport)
327      openfw(freport, args, 'r');
328    char* infile=NULL;
329 +
330 +  if (adaptors5.Count()>0)
331 +    //gxmem_l=new CGreedyAlignData(match_reward, mismatch_penalty, Xdrop-2);
332 +        gxmem_l=new CGreedyAlignData(match_reward, mismatch_penalty, Xdrop);
333 +  if (adaptors3.Count()>0)
334 +    gxmem_r=new CGreedyAlignData(match_reward, mismatch_penalty, Xdrop);
335 +
336    while ((infile=args.nextNonOpt())!=NULL) {
337 <    GStr infname(infile);
338 <    if (strcmp(infile,"-")==0) {
339 <       f_in=stdin; infname="stdin"; }
340 <     else {
341 <        f_in=fopen(infile,"r");
342 <        if (f_in==NULL)
343 <            GError("Cannot open input file %s!\n",infile);
344 <        }
345 <     GLineReader fq(f_in);
346 <     char* l=NULL;
347 <     while ((l=fq.getLine())!=NULL) {
348 <        GStr rname; //current read name
349 <        GStr rseq;  //current read sequence
350 <        GStr rqv;   //current read quality values
351 <        GStr s;
352 <        /* if (rawFormat) {
353 <          //TODO: implement qseq parsing here
354 <          //if (raw type=N) then continue; //skip invalid/bad records
355 <          
356 <          } //raw qseq format
357 <         else { // FASTQ or FASTA */
358 <          isfasta=(l[0]=='>');
359 <          if (!isfasta && l[0]!='@') GError("Error: fastq record marker not detected!\n");
360 <          s=l;
361 <          rname=&(l[1]);
362 <          icounter++;
363 <          for (int i=0;i<rname.length();i++)
364 <            if (rname[i]<=' ') { rname.cut(i); break; }
365 <          //now get the sequence
366 <          if ((l=fq.getLine())==NULL)
367 <              GError("Error: unexpected EOF after header for %s\n",rname.chars());
368 <          rseq=l; //this must be the DNA line
369 <          while ((l=fq.getLine())!=NULL) {
370 <              //seq can span multiple lines
371 <              if (l[0]=='>' || l[0]=='+') {
372 <                   fq.pushBack();
373 <                   break; //
337 >    //for each input file
338 >    int incounter=0; //counter for input reads
339 >    int outcounter=0; //counter for output reads
340 >    int trash_s=0; //too short from the get go
341 >    int trash_Q=0;
342 >    int trash_N=0;
343 >    int trash_D=0;
344 >    int trash_poly=0;
345 >    int trash_A3=0;
346 >    int trash_A5=0;
347 >    s=infile;
348 >    GStr infname;
349 >    GStr infname2;
350 >    FILE* f_in=NULL;
351 >    FILE* f_in2=NULL;
352 >    FILE* f_out=NULL;
353 >    FILE* f_out2=NULL;
354 >    bool paired_reads=false;
355 >    setupFiles(f_in, f_in2, f_out, f_out2, s, infname, infname2);
356 >    GLineReader fq(f_in);
357 >    GLineReader* fq2=NULL;
358 >    if (f_in2!=NULL) {
359 >       fq2=new GLineReader(f_in2);
360 >       paired_reads=true;
361 >       }
362 >    GStr rseq, rqv, seqid, seqinfo;
363 >    GStr rseq2, rqv2, seqid2, seqinfo2;
364 >    while (getFastxRec(fq, rseq, rqv, seqid, seqinfo, infname)) {
365 >       incounter++;
366 >       int a5=0, a3=0, b5=0, b3=0;
367 >       char tcode=0, tcode2=0;
368 >       tcode=process_read(seqid, rseq, rqv, a5, a3);
369 >       if (fq2!=NULL) {
370 >            getFastxRec(*fq2, rseq2, rqv2, seqid2, seqinfo2, infname2);
371 >            if (seqid.substr(0,seqid.length()-1)!=seqid2.substr(0,seqid2.length()-1)) {
372 >               GError("Error: no paired match for read %s vs %s (%s,%s)\n",
373 >                  seqid.chars(), seqid2.chars(), infname.chars(), infname2.chars());
374 >               }
375 >            tcode2=process_read(seqid2, rseq2, rqv2, b5, b3);
376 >            //decide what to do with this pair and print rseq2 if the pair makes it
377 >            if (tcode>1 && tcode2<=1) {
378 >               //"untrash" rseq
379 >               if (a3-a5+1<min_read_len) {
380 >                   a5=1;
381 >                   if (a3<min_read_len) { a3= GMIN(rseq.length()-1, min_read_len+1); }
382                     }
383 <              rseq+=l;
384 <              } //check for multi-line seq
385 <          if (!isfasta) { //reading fastq quality values, which can also be multi-line
386 <            if ((l=fq.getLine())==NULL)
387 <                GError("Error: unexpected EOF after sequence for %s\n", rname.chars());
388 <            if (l[0]!='+') GError("Error: fastq qv header marker not detected!\n");
389 <            if ((l=fq.getLine())==NULL)
390 <                GError("Error: unexpected EOF after qv header for %s\n", rname.chars());
391 <            rqv=l;
392 <            //if (rqv.length()!=rseq.length())
393 <            //  GError("Error: qv len != seq len for %s\n", rname.chars());
394 <            while (rqv.length()<rseq.length() && ((l=fq.getLine())!=NULL)) {
395 <              rqv+=l; //append to qv string
396 <              }
420 <            }// fastq
421 <        // } //<-- FASTA or FASTQ
422 <        rseq.upper();
423 <        int l5=0;
424 <        int l3=rseq.length()-1;
425 <        if (l3-l5+1<min_read_len) {
426 <           if (trashReport) {
427 <                  fprintf(freport, "%s\ts\t%s\n",rname.chars(), rseq.chars());
428 <                  }
429 <           continue;
430 <           }
431 <        if (ntrim(rseq, l5, l3)) { // N-trimming
432 <           //GMessage("before: %s\n",rseq.chars());
433 <           //GMessage("after : %s (%d)\n",rseq.substr(l5,l3-l5+1).chars(),l3-l5+1);
434 <           if (l3-l5+1<min_read_len) {
435 <             if (trashReport) {
436 <                    fprintf(freport, "%s\tN\t%s\n", rname.chars(), rseq.chars());
437 <                    }
438 <             continue; //invalid read
439 <             }
440 <            //-- keep only the l5..l3 range
441 <           rseq=rseq.substr(l5, l3-l5+1);
442 <           if (!rqv.is_empty())
443 <              rqv=rqv.substr(l5, l3-l5+1);
444 <           l5=0;
445 <           l3=rseq.length()-1;
446 <           }
447 <        if (qvtrim_min!=0 && !rqv.is_empty() && qtrim(rqv, l5, l3)) { // qv-threshold trimming
448 <           if (l3-l5+1<min_read_len) {
449 <             if (trashReport) {
450 <                    fprintf(freport, "%s\tQ\t%s\n", rname.chars(), rseq.chars());
451 <                    }
452 <             continue; //invalid read
453 <             }
454 <            //-- keep only the l5..l3 range
455 <           rseq=rseq.substr(l5, l3-l5+1);
456 <           if (!rqv.is_empty())
457 <              rqv=rqv.substr(l5, l3-l5+1);
458 <           } //qv trimming
459 <        if (a3len>0) {
460 <          if (trim_adapter3(rseq, l5, l3)) {
461 <             if (l3-l5+1<min_read_len) {
462 <                 if (trashReport) {
463 <                     fprintf(freport, "%s\tA3\t%s\n",rname.chars(), rseq.chars());
464 <                     }
465 <                 continue;
466 <                 }
467 <              //-- keep only the l5..l3 range
468 <              rseq=rseq.substr(l5, l3-l5+1);
469 <              if (!rqv.is_empty())
470 <                 rqv=rqv.substr(l5, l3-l5+1);
471 <              }//some adapter was trimmed
472 <           } //adapter trimming
473 <        if (a5len>0) {
474 <          if (trim_adapter5(rseq, l5, l3)) {
475 <             if (l3-l5+1<min_read_len) {
476 <                 if (trashReport) {
477 <                     fprintf(freport, "%s\tA5\t%s\n",rname.chars(), rseq.chars());
478 <                     }
479 <                 continue;
383 >               tcode=1;
384 >               }
385 >             else if (tcode<=1 && tcode2>1) {
386 >               //"untrash" rseq2
387 >               if (b3-b5+1<min_read_len) {
388 >                   b5=1;
389 >                   if (b3<min_read_len) { b3= GMIN((rseq2.length()-1),(min_read_len+1)); }
390 >                   }
391 >               tcode2=1;
392 >               }
393 >            if (tcode<=1) { //trimmed or left intact -- write it!
394 >               if (tcode>0) {
395 >                 rseq2=rseq2.substr(b5,b3-b5+1);
396 >                 if (!rqv2.is_empty()) rqv2=rqv2.substr(b5,b3-b5+1);
397                   }
398 <              //-- keep only the l5..l3 range
399 <              rseq=rseq.substr(l5, l3-l5+1);
400 <              if (!rqv.is_empty())
401 <                 rqv=rqv.substr(l5, l3-l5+1);
402 <              }//some adapter was trimmed
403 <           } //adapter trimming
404 <        if (doCollapse) {
405 <           //keep read for later
406 <           FqDupRec* dr=dhash.Find(rseq.chars());
407 <           if (dr==NULL) { //new entry
408 <                  //if (prefix.is_empty())
409 <                     dhash.Add(rseq.chars(),
410 <                          new FqDupRec(&rqv, rname.chars()));
411 <                  //else dhash.Add(rseq.chars(), new FqDupRec(rqv.chars(),rqv.length()));
398 >               int nocounter=0;
399 >               writeRead(f_out2, seqid2, seqinfo2, rseq2, rqv2, nocounter);
400 >               }
401 >            } //pair read
402 >       if (tcode>1) { //trashed
403 >         #ifdef GDEBUG
404 >         GMessage(" !!!!TRASH code = %c\n",tcode);
405 >         #endif
406 >          if (tcode=='s') trash_s++;
407 >          else if (tcode=='A' || tcode=='T') trash_poly++;
408 >            else if (tcode=='Q') trash_Q++;
409 >              else if (tcode=='N') trash_N++;
410 >               else if (tcode=='D') trash_D++;
411 >                else if (tcode=='3') trash_A3++;
412 >                 else if (tcode=='5') trash_A5++;
413 >          if (trashReport) trash_report(tcode, seqid, freport);
414 >          }
415 >         else if (!doCollapse) { //write it
416 >          if (tcode>0) {
417 >            rseq=rseq.substr(a5,a3-a5+1);
418 >            if (!rqv.is_empty()) rqv=rqv.substr(a5,a3-a5+1);
419 >            }
420 >         #ifdef GDEBUG
421 >            GMessage("  After trimming:\n");
422 >            GMessage("%s\n",rseq.chars());
423 >         #endif
424 >          writeRead(f_out, seqid, seqinfo, rseq, rqv, outcounter);
425 >          }
426 >       } //for each fastq record
427 >    delete fq2;
428 >    FRCLOSE(f_in);
429 >    FRCLOSE(f_in2);
430 >    if (doCollapse) {
431 >       outcounter=0;
432 >       int maxdup_count=1;
433 >       char* maxdup_seq=NULL;
434 >       dhash.startIterate();
435 >       FqDupRec* qd=NULL;
436 >       char* seq=NULL;
437 >       while ((qd=dhash.NextData(seq))!=NULL) {
438 >         GStr rseq(seq);
439 >         //do the dusting here
440 >         if (doDust) {
441 >            int dustbases=dust(rseq);
442 >            if (dustbases>(rseq.length()>>1)) {
443 >               if (trashReport && qd->firstname!=NULL) {
444 >                 fprintf(freport, "%s_x%d\tD\n",qd->firstname, qd->count);
445                   }
446 <              else    
447 <                 dr->add(rqv);
448 <           } //collapsing duplicates
449 <         else { //not collapsing duplicates
450 <           //do the dust filter now
451 <           if (doDust) {
452 <             int dustbases=dust(rseq);
453 <             if (dustbases>(rseq.length()>>1)) {
454 <                if (trashReport) {
455 <                  fprintf(freport, "%s\tD\t%s\n",rname.chars(),rseq.chars());
456 <                  }
457 <                continue;
458 <                }
509 <             }
510 <           //print this record here  
511 <           outcounter++;
512 <           if (isfasta) {
513 <            if (prefix.is_empty())
514 <               fprintf(f_out, ">%s\n%s\n", rname.chars(), rseq.chars());
515 <              else
516 <               fprintf(f_out, ">%s%08d\n%s\n", prefix.chars(), outcounter,
517 <                                  rseq.chars());
446 >               trash_D+=qd->count;
447 >               continue;
448 >               }
449 >            }
450 >         outcounter++;
451 >         if (qd->count>maxdup_count) {
452 >            maxdup_count=qd->count;
453 >            maxdup_seq=seq;
454 >            }
455 >         if (isfasta) {
456 >           if (prefix.is_empty()) {
457 >             fprintf(f_out, ">%s_x%d\n%s\n", qd->firstname, qd->count,
458 >                           rseq.chars());
459               }
460 <           else {  //fastq
461 <            if (convert_phred) convertPhred(rqv);
462 <            if (prefix.is_empty())
522 <               fprintf(f_out, "@%s\n%s\n+\n%s\n", rname.chars(), rseq.chars(),rqv.chars());
523 <              else
524 <               fprintf(f_out, "@%s_%08d\n%s\n+\n%s\n", prefix.chars(), outcounter,
525 <                                  rseq.chars(),rqv.chars() );
460 >           else { //use custom read name
461 >             fprintf(f_out, ">%s%08d_x%d\n%s\n", prefix.chars(), outcounter,
462 >                        qd->count, rseq.chars());
463               }
464 <           } //not collapsing duplicates
465 <        } //for each fastq record
466 <   } //while each input file
467 < FRCLOSE(f_in);
468 < if (doCollapse) {
469 <    outcounter=0;
533 <    int maxdup_count=1;
534 <    char* maxdup_seq=NULL;
535 <    dhash.startIterate();
536 <    FqDupRec* qd=NULL;
537 <    char* seq=NULL;
538 <    while ((qd=dhash.NextData(seq))!=NULL) {
539 <      GStr rseq(seq);
540 <      //do the dusting here
541 <      if (doDust) {
542 <         int dustbases=dust(rseq);
543 <         if (dustbases>(rseq.length()>>1)) {
544 <            if (trashReport && qd->firstname!=NULL) {
545 <              fprintf(freport, "%s_x%d\tD\t%s\n",qd->firstname, qd->count,seq);
546 <              }
547 <            continue;
464 >           }
465 >         else { //fastq format
466 >          if (convert_phred) convertPhred(qd->qv, qd->len);
467 >          if (prefix.is_empty()) {
468 >            fprintf(f_out, "@%s_x%d\n%s\n+\n%s\n", qd->firstname, qd->count,
469 >                           rseq.chars(), qd->qv);
470              }
471 +          else { //use custom read name
472 +            fprintf(f_out, "@%s%08d_x%d\n%s\n+\n%s\n", prefix.chars(), outcounter,
473 +                        qd->count, rseq.chars(), qd->qv);
474 +            }
475 +           }
476 +         }//for each element of dhash
477 +       if (maxdup_count>1) {
478 +         GMessage("Maximum read multiplicity: x %d (read: %s)\n",maxdup_count, maxdup_seq);
479           }
480 <      outcounter++;
481 <      if (qd->count>maxdup_count) {
482 <         maxdup_count=qd->count;
483 <         maxdup_seq=seq;
484 <         }
485 <      if (isfasta) {
486 <        if (prefix.is_empty()) {
487 <          fprintf(f_out, ">%s_x%d\n%s\n", qd->firstname, qd->count,
488 <                        rseq.chars());
489 <          }
490 <        else { //use custom read name
491 <          fprintf(f_out, ">%s%08d_x%d\n%s\n", prefix.chars(), outcounter,
492 <                     qd->count, rseq.chars());
480 >       } //collapse entries
481 >    if (verbose) {
482 >       if (paired_reads) {
483 >           GMessage(">Input files : %s , %s\n", infname.chars(), infname2.chars());
484 >           GMessage("Number of input pairs :%9d\n", incounter);
485 >           GMessage("         Output pairs :%9d\n", outcounter);
486 >           }
487 >         else {
488 >           GMessage(">Input file : %s\n", infname.chars());
489 >           GMessage("Number of input reads :%9d\n", incounter);
490 >           GMessage("         Output reads :%9d\n", outcounter);
491 >           }
492 >       GMessage("------------------------------------\n");
493 >       if (num_trimmed5)
494 >          GMessage("           5' trimmed :%9d  (min. trim: %d)\n", num_trimmed5, min_trimmed5);
495 >       if (num_trimmed3)
496 >          GMessage("           3' trimmed :%9d  (min. trim: %d)\n", num_trimmed3, min_trimmed3);
497 >       GMessage("------------------------------------\n");
498 >       if (trash_s>0)
499 >         GMessage("     Trashed by length:%9d\n", trash_s);
500 >       if (trash_N>0)
501 >         GMessage("         Trashed by N%%:%9d\n", trash_N);
502 >       if (trash_Q>0)
503 >         GMessage("Trashed by low quality:%9d\n", trash_Q);
504 >       if (trash_poly>0)
505 >         GMessage("   Trashed by poly-A/T:%9d\n", trash_poly);
506 >       if (trash_A5>0)
507 >         GMessage(" Trashed by 5' adaptor:%9d\n", trash_A5);
508 >       if (trash_A3>0)
509 >         GMessage(" Trashed by 3' adaptor:%9d\n", trash_A3);
510 >       }
511 >    if (trashReport) {
512 >          FWCLOSE(freport);
513            }
514 <        }
515 <      else { //fastq format
516 <       if (convert_phred) convertPhred(qd->qv, qd->len);
517 <       if (prefix.is_empty()) {
518 <         fprintf(f_out, "@%s_x%d\n%s\n+\n%s\n", qd->firstname, qd->count,
569 <                        rseq.chars(), qd->qv);
570 <         }
571 <       else { //use custom read name
572 <         fprintf(f_out, "@%s%08d_x%d\n%s\n+\n%s\n", prefix.chars(), outcounter,
573 <                     qd->count, rseq.chars(), qd->qv);
574 <         }
575 <        }
576 <      }//for each element of dhash
577 <    if (maxdup_count>1) {
578 <      GMessage("Maximum read multiplicity: x %d (read: %s)\n",maxdup_count, maxdup_seq);
579 <      }
580 <   } //report collapsed dhash entries
581 < GMessage("Number of input reads: %9d\n", icounter);
582 < GMessage("       Output records: %9d\n", outcounter);
583 < if (trashReport) {
584 <    FWCLOSE(freport);
585 <    }
586 <
587 < FWCLOSE(f_out);
514 >    FWCLOSE(f_out);
515 >    FWCLOSE(f_out2);
516 >   } //while each input file
517 > delete gxmem_l;
518 > delete gxmem_r;
519   //getc(stdin);
520   }
521  
# Line 599 | Line 530
530     const char* seq;
531     bool valid;
532     NData() {
533 +    seqlen=0;
534      NCount=0;
535      end5=0;
536      end3=0;
# Line 629 | Line 561
561       perc_N=(n*100.0)/(end5-end3+1);
562       }
563   };
564 <
564 >
565   static NData feat;
566   int perc_lenN=12; // incremental distance from ends, in percentage of
567            // sequence length, where N-trimming is done (default:12 %) (autolimited to 20)
568 <          
568 >
569   void N_analyze(int l5, int l3, int p5, int p3) {
570   /* assumes feat was filled properly */
571   int old_dif, t5,t3,v;
572   if (l3<l5+2 || p5>p3 ) {
573     feat.end5=l5+1;
574     feat.end3=l3+1;
575 <   return;
575 >   return;
576     }
577  
578   t5=feat.NPos[p5]-l5;
579   t3=l3-feat.NPos[p3];
580   old_dif=p3-p5;
581   v=(int)((((double)(l3-l5))*perc_lenN)/100);
582 < if (v>20) v=20; /* enforce N-search limit for very long reads */
582 > if (v>20) v=20; /* enforce N-search limit for very long reads */
583   if (t5 < v ) {
584     l5=feat.NPos[p5]+1;
585     p5++;
# Line 664 | Line 596
596             feat.end3=l3+1;
597             return;
598             }
599 <    else
599 >    else
600        N_analyze(l5,l3, p5,p3);
601   }
602  
603  
604   bool qtrim(GStr& qvs, int &l5, int &l3) {
605 < if (qvtrim_min==0 || qvs.is_empty()) return false;
605 > if (qvtrim_qmin==0 || qvs.is_empty()) return false;
606   if (qv_phredtype==0) {
607    //try to guess the Phred type
608    int vmin=256, vmax=0;
# Line 683 | Line 615
615    if (qv_phredtype==0) {
616      GError("Error: couldn't determine Phred type, please use the -p33 or -p64 !\n");
617      }
618 <  } //guessing the Phred type
618 >  if (verbose)
619 >    GMessage("Input reads have Phred-%d quality values.\n", (qv_phredtype==33 ? 33 : 64));
620 >  } //guessing Phred type
621   for (l3=qvs.length()-1;l3>2;l3--) {
622 <  if (qvs[l3]-qv_phredtype>=qvtrim_min && qvs[l3-1]-qv_phredtype>=qvtrim_min) break;
622 >  if (qvs[l3]-qv_phredtype>=qvtrim_qmin && qvs[l3-1]-qv_phredtype>=qvtrim_qmin) break;
623    }
624   //just in case, check also the 5' the end (?)
625   for (l5=0;l5<qvs.length()-3;l5++) {
626 <  if (qvs[l5]-qv_phredtype>=qvtrim_min && qvs[l5+1]-qv_phredtype>=qvtrim_min) break;
626 >  if (qvs[l5]-qv_phredtype>=qvtrim_qmin && qvs[l5+1]-qv_phredtype>=qvtrim_qmin) break;
627 >  }
628 > if (qvtrim_max>0) {
629 >  if (qvs.length()-1-l3>qvtrim_max) l3=qvs.length()-1-qvtrim_max;
630 >  if (l5>qvtrim_max) l5=qvtrim_max;
631    }
632   return (l5>0 || l3<qvs.length()-1);
633   }
# Line 699 | Line 637
637   feat.init(rseq);
638   l5=feat.end5-1;
639   l3=feat.end3-1;
640 < N_analyze(feat.end5-1, feat.end3-1, 0, feat.NCount-1);
640 > N_analyze(feat.end5-1, feat.end3-1, 0, feat.NCount-1);
641   if (l5==feat.end5-1 && l3==feat.end3-1) {
642      if (feat.perc_N>max_perc_N) {
643             feat.valid=false;
# Line 717 | Line 655
655     return true;
656     }
657   feat.N_calc();
658 <
658 >
659   if (feat.perc_N>max_perc_N) {
660        feat.valid=false;
661        l3=l5+1;
# Line 729 | Line 667
667   //--------------- dust functions ----------------
668   class DNADuster {
669   public:
670 <  int dustword;
671 <  int dustwindow;
672 <  int dustwindow2;
670 >  int dustword;
671 >  int dustwindow;
672 >  int dustwindow2;
673    int dustcutoff;
674    int mv, iv, jv;
675    int counts[32*32*32];
# Line 826 | Line 764
764                      }
765             }
766           }
767 < //return first;
767 > //return first;
768   }
769   };
770  
# Line 844 | Line 782
782   return ncount;
783   }
784  
785 + struct SLocScore {
786 +  int pos;
787 +  int score;
788 +  SLocScore(int p=0,int s=0) {
789 +    pos=p;
790 +    score=s;
791 +    }
792 +  void set(int p, int s) {
793 +    pos=p;
794 +    score=s;
795 +    }
796 +  void add(int p, int add) {
797 +    pos=p;
798 +    score+=add;
799 +    }
800 + };
801  
802 < // ------------------ adapter matching - simple k-mer seed & extend, no indels for now
803 < //when a k-mer match is found, simply try to extend the alignment using a drop-off scheme
804 < //check minimum score and
805 < //for 3' adapter trimming:
806 < //     require that the right end of the alignment for either the adaptor OR the read must be
807 < //     < 3 distance from its right end
808 < // for 5' adapter trimming:
809 < //     require that the left end of the alignment for either the adaptor OR the read must
810 < //     be at coordinate < 3 from start
811 <
812 < bool extendMatch(const char* a, int alen, int ai,
813 <                 const char* b, int blen, int bi, int mlen, int& l5, int& l3, CSegChain& segs, bool end5=false) {
814 < //so the alignment starts at ai in a, bi in b, with a perfect match of length mlen
815 < #ifdef DEBUG
816 < GStr dbg(b);
817 < #endif
864 < //if (debug) {
865 < //  GMessage(">> in %s\n\textending hit: %s at position %d\n", a, (dbg.substr(bi, mlen)).chars(), ai);
866 < //  }
867 < int a_l=ai; //alignment coordinates on a
868 < int a_r=ai+mlen-1;
869 < int b_l=bi; //alignment coordinates on b
870 < int b_r=bi+mlen-1;
871 < int ai_maxscore=ai;
872 < int bi_maxscore=bi;
873 < int score=mlen*a_m_score;
874 < int maxscore=score;
875 < int mism5score=a_mis_score;
876 < if (end5 && ai<(alen>>1)) mism5score-=2; // increase penalty for mismatches at 5' end
877 < //try to extend to the left first, if possible
878 < while (ai>0 && bi>0) {
879 <   ai--;
880 <   bi--;
881 <   score+= (a[ai]==b[bi])? a_m_score : mism5score;
882 <   if (score>maxscore) {
883 <       ai_maxscore=ai;
884 <       bi_maxscore=bi;
885 <       maxscore=score;
886 <       }
887 <     else if (maxscore-score>a_dropoff_score) break;
802 > bool trim_poly3(GStr &seq, int &l5, int &l3, const char* poly_seed) {
803 > if (!doPolyTrim) return false;
804 > int rlen=seq.length();
805 > l5=0;
806 > l3=rlen-1;
807 > int32 seedVal=*(int32*)poly_seed;
808 > char polyChar=poly_seed[0];
809 > //assumes N trimming was already done
810 > //so a poly match should be very close to the end of the read
811 > // -- find the initial match (seed)
812 > int lmin=GMAX((rlen-16), 0);
813 > int li;
814 > for (li=rlen-4;li>lmin;li--) {
815 >   if (seedVal==*(int*)&(seq[li])) {
816 >      break;
817 >      }
818     }
819 < a_l=ai_maxscore;
820 < b_l=bi_maxscore;
821 < //if (debug) GMessage("  after l-extend: %*s%s\t\t(score=%d)\n",a_l," ",dbg.substr(b_l,b_r-b_l+1).chars(),maxscore);
822 < //now extend to the right
823 < ai_maxscore=a_r;
824 < bi_maxscore=b_r;
825 < ai=a_r;
826 < bi=b_r;
827 < score=maxscore;
828 < //sometimes there are extra AAAAs at the end of the read, ignore those
829 < if (strcmp(&a[alen-4],"AAAA")==0) {
830 <    alen-=3;
831 <    while (a[alen-1]=='A' && alen>ai) alen--;
832 <    }
833 < while (ai<alen-1 && bi<blen-1) {
834 <   ai++;
835 <   bi++;
836 <   //score+= (a[ai]==b[bi])? a_m_score : a_mis_score;
837 <   if (a[ai]==b[bi]) { //match
838 <      score+=a_m_score;
839 <      if (ai>=alen-2) {
910 <           score+=a_m_score-(alen-ai-1);
911 <           }
819 > if (li<=lmin) return false;
820 > //seed found, try to extend it both ways
821 > //extend right
822 > int ri=li+3;
823 > SLocScore loc(ri, poly_m_score<<2);
824 > SLocScore maxloc(loc);
825 > //extend right
826 > while (ri<rlen-1) {
827 >   ri++;
828 >   if (seq[ri]==polyChar) {
829 >                loc.add(ri,poly_m_score);
830 >                }
831 >   else if (seq[ri]=='N') {
832 >                loc.add(ri,0);
833 >                }
834 >   else { //mismatch
835 >        loc.add(ri,poly_mis_score);
836 >        if (maxloc.score-loc.score>poly_dropoff_score) break;
837 >        }
838 >   if (maxloc.score<=loc.score) {
839 >      maxloc=loc;
840        }
841 +   }
842 + ri=maxloc.pos;
843 + if (ri<rlen-6) return false; //no trimming wanted, too far from 3' end
844 + //ri = right boundary for the poly match
845 + //extend left
846 + loc.set(li, maxloc.score);
847 + maxloc.pos=li;
848 + while (li>0) {
849 +    li--;
850 +    if (seq[li]==polyChar) {
851 +                 loc.add(li,poly_m_score);
852 +                 }
853 +    else if (seq[li]=='N') {
854 +                 loc.add(li,0);
855 +                 }
856      else { //mismatch
857 <      score+=a_mis_score;
858 <      }  
859 <   if (score>maxscore) {
860 <       ai_maxscore=ai;
861 <       bi_maxscore=bi;
919 <       maxscore=score;
857 >         loc.add(li,poly_mis_score);
858 >         if (maxloc.score-loc.score>poly_dropoff_score) break;
859 >         }
860 >    if (maxloc.score<=loc.score) {
861 >       maxloc=loc;
862         }
863 <     else if (maxscore-score>a_dropoff_score) break;
864 <   }
865 <  a_r=ai_maxscore;
866 <  b_r=bi_maxscore;
867 <  int a_ovh3=alen-a_r-1;
868 <  int b_ovh3=blen-b_r-1;
869 <  int mmovh3=(a_ovh3<b_ovh3)? a_ovh3 : b_ovh3;
870 <  int mmovh5=(a_l<b_l)? a_l : b_l;
871 <  //if (debug) GMessage("  after r-extend: %*s%s\t\t(score=%d)\n",a_l," ",dbg.substr(b_l,b_r-b_l+1).chars(),maxscore);
872 < #ifdef DEBUG
873 <  if (debug) GMessage("     extended to: %*s\n",a_r+1,dbg.substr(b_l,b_r-b_l+1).chars());
874 < #endif
933 <  if (maxscore>=a_min_score && mmovh3<2 && mmovh5<2) {
934 <     if (a_l<a_ovh3) {
935 <        //adapter closer to the left end (typical for 5' adapter)
936 <        l5=a_r+1;
937 <        l3=alen-1;
938 <        }
939 <      else {
940 <        //adapter matching at the right end (typical for 3' adapter)
941 <        l5=0;
942 <        l3=a_l-1;
943 <        }
944 <     return true;
945 <     }
946 < else { //keep this segment pair for later (gapped alignment)
947 <   segs.addSegPair(new CSegPair(a_l+1, a_r+1, b_l+1, b_r+1, maxscore));
948 <   //this will also update min & max coordinates in segs (segs.astart, .aend, .bstart, .bend)
949 <   }
950 <  //do not trim:
951 <  l5=0;
952 <  l3=alen-1;
953 <  return false;
954 < }
863 >    }
864 > li=maxloc.pos;
865 > if ((maxloc.score==poly_minScore && ri==rlen-1) ||
866 >    (maxloc.score>poly_minScore && ri>=rlen-3) ||
867 >    (maxloc.score>(poly_minScore*3) && ri>=rlen-8)) {
868 >  //trimming this li-ri match at 3' end
869 >    l3=li-1;
870 >    if (l3<0) l3=0;
871 >    return true;
872 >    }
873 > return false;
874 > }
875  
876 < /*
877 < int getWordValue(const char* s, int wlen) {
878 < int r=0;
879 < while (wlen--) { r+=(((int)s[wlen])<<wlen) }
880 < return r;
881 < }
882 < */
883 < int get3mer_value(const char* s) {
884 < return (s[0]<<16)+(s[1]<<8)+s[2];
885 < }
886 <
887 < int w3_match(int qv, const char* str, int slen, int start_index=0) {
888 < if (start_index>=slen || start_index<0) return -1;
889 < for (int i=start_index;i<slen-3;i++) {
890 <   int rv=get3mer_value(str+i);
891 <   if (rv==qv) return i;
876 > bool trim_poly5(GStr &seq, int &l5, int &l3, const char* poly_seed) {
877 > if (!doPolyTrim) return false;
878 > int rlen=seq.length();
879 > l5=0;
880 > l3=rlen-1;
881 > int32 seedVal=*(int32*)poly_seed;
882 > char polyChar=poly_seed[0];
883 > //assumes N trimming was already done
884 > //so a poly match should be very close to the end of the read
885 > // -- find the initial match (seed)
886 > int lmax=GMIN(12, rlen-4);//how far from 5' end to look for 4-mer seeds
887 > int li;
888 > for (li=0;li<=lmax;li++) {
889 >   if (seedVal==*(int*)&(seq[li])) {
890 >      break;
891 >      }
892     }
893 < return -1;
894 < }
895 <
896 < int w3_rmatch(int qv, const char* str, int slen, int end_index=-1) {
897 < if (end_index>=slen) return -1;
898 < if (end_index<0) end_index=slen-1;
899 < for (int i=end_index-2;i>=0;i--) {
900 <   int rv=get3mer_value(str+i);
901 <   if (rv==qv) return i;
893 > if (li>lmax) return false;
894 > //seed found, try to extend it both ways
895 > //extend left
896 > int ri=li+3; //save rightmost base of the seed
897 > SLocScore loc(li, poly_m_score<<2);
898 > SLocScore maxloc(loc);
899 > while (li>0) {
900 >    li--;
901 >    if (seq[li]==polyChar) {
902 >                 loc.add(li,poly_m_score);
903 >                 }
904 >    else if (seq[li]=='N') {
905 >                 loc.add(li,0);
906 >                 }
907 >    else { //mismatch
908 >         loc.add(li,poly_mis_score);
909 >         if (maxloc.score-loc.score>poly_dropoff_score) break;
910 >         }
911 >    if (maxloc.score<=loc.score) {
912 >       maxloc=loc;
913 >       }
914 >    }
915 > li=maxloc.pos;
916 > if (li>5) return false; //no trimming wanted, too far from 5' end
917 > //li = right boundary for the poly match
918 >
919 > //extend right
920 > loc.set(ri, maxloc.score);
921 > maxloc.pos=ri;
922 > while (ri<rlen-1) {
923 >   ri++;
924 >   if (seq[ri]==polyChar) {
925 >                loc.add(ri,poly_m_score);
926 >                }
927 >   else if (seq[ri]=='N') {
928 >                loc.add(ri,0);
929 >                }
930 >   else { //mismatch
931 >        loc.add(ri,poly_mis_score);
932 >        if (maxloc.score-loc.score>poly_dropoff_score) break;
933 >        }
934 >   if (maxloc.score<=loc.score) {
935 >      maxloc=loc;
936 >      }
937     }
938 < return -1;
939 < }
938 > ri=maxloc.pos;
939 > if ((maxloc.score==poly_minScore && li==0) ||
940 >     (maxloc.score>poly_minScore && li<2)
941 >     || (maxloc.score>(poly_minScore*3) && li<8)) {
942 >    //adjust l5 to reflect this trimming of 5' end
943 >    l5=ri+1;
944 >    if (l5>rlen-1) l5=rlen-1;
945 >    return true;
946 >    }
947 > return false;
948 > }
949  
950 < int fast4match(int32 qv, const char* str, int slen, int start_index=0) {
951 < if (start_index>=slen || start_index<0) return -1;
952 < for (int i=start_index;i<slen-4;i++) {
953 <   int32* rv=(int32*)(str+i);
954 <   if (*rv==qv) return i;
955 <   }
956 < return -1;
957 < }
950 > bool trim_adaptor3(GStr& seq, int&l5, int &l3) {
951 > if (adaptors3.Count()==0) return false;
952 > int rlen=seq.length();
953 > l5=0;
954 > l3=rlen-1;
955 > bool trimmed=false;
956 > GStr wseq(seq);
957 > int wlen=rlen;
958 > GXSeqData seqdata;
959 > int numruns=revCompl ? 2 : 1;
960 >
961 > for (int ai=0;ai<adaptors3.Count();ai++) {
962 >   for (int r=0;r<numruns;r++) {
963 >     if (r) {
964 >          seqdata.update(adaptors3[ai].seqr.chars(), adaptors3[ai].seqr.length(),
965 >                 adaptors3[ai].pzr, wseq.chars(), wlen, adaptors3[ai].amlen);
966 >        }
967 >     else {
968 >            seqdata.update(adaptors3[ai].seq.chars(), adaptors3[ai].seq.length(),
969 >                 adaptors3[ai].pz, wseq.chars(), wlen, adaptors3[ai].amlen);
970 >        }
971  
972 < int fast4rmatch(int32 qv, const char* str, int slen, int end_index=-1) {
973 < if (end_index>=slen) return -1;
974 < if (end_index<0) end_index=slen-1;
975 < for (int i=end_index-3;i>=0;i--) {
976 <   int32* rv=(int32*)(str+i);
977 <   if (*rv==qv) return i;
978 <   }
979 < return -1;
972 >  GXAlnInfo* aln=match_adaptor(seqdata, adaptors3[ai].trim_type, gxmem_r, 86);
973 >  if (aln) {
974 >     trimmed=true;
975 >     //keep unmatched region on the left OR right (the longer one)
976 >     if (aln->sl > wlen-aln->sr) {
977 >         //keep left side
978 >         l3-=(wlen-aln->sl+1);
979 >         if (l3<0) l3=0;
980 >         }
981 >     else { //keep right side
982 >         l5+=aln->sr;
983 >         if (l5>=rlen) l5=rlen-1;
984 >         }
985 >     delete aln;
986 >     if (l3-l5+1<min_read_len) return true;
987 >     wseq=seq.substr(l5,l3-l5+1);
988 >     wlen=wseq.length();
989 >     }
990 >   }//forward and reverse adaptors
991 >  }//for each 3' adaptor
992 >  return trimmed;
993   }
994  
995 < #ifdef DEBUG
996 < void dbgPrintChain(CSegChain& chain, const char* aseq) {
1007 <  GStr s(aseq);
1008 <  for (int i=0;i<chain.Count();i++) {
1009 <   CSegPair& seg=*chain[i];
1010 <   GMessage("  dbg chain seg%d: %*s [%d-%d:%d-%d]\n",i,seg.a.start-1+seg.len(),
1011 <            s.substr(seg.b.start-1, seg.len()).chars(), seg.b.start,seg.b.end,seg.a.start,seg.a.end);
1012 <   }
1013 < }
1014 < #endif
1015 <
1016 < bool trim_adapter3(GStr& seq, int&l5, int &l3) {
995 > bool trim_adaptor5(GStr& seq, int&l5, int &l3) {
996 > if (adaptors5.Count()==0) return false;
997   int rlen=seq.length();
998   l5=0;
999   l3=rlen-1;
1000 < //first try a full match, we might get lucky
1001 < int fi=-1;
1002 < if ((fi=seq.index(adapter3))>=0) {
1003 <   if (fi<rlen-fi-a3len) {//match is closer to the right end
1004 <      l5=fi+a3len;
1005 <      l3=rlen-1;
1006 <      }
1007 <    else {
1008 <      l5=0;
1009 <      l3=fi-1;
1010 <      }
1011 <   return true;
1012 <   }
1013 < #ifdef DEBUG
1014 < if (debug) GMessage(">TRIM3 >>   Read: %s\n",seq.chars());
1015 < #endif
1000 > bool trimmed=false;
1001 > GStr wseq(seq);
1002 > int wlen=rlen;
1003 > GXSeqData seqdata;
1004 > int numruns=revCompl ? 2 : 1;
1005 > for (int ai=0;ai<adaptors5.Count();ai++) {
1006 >   for (int r=0;r<numruns;r++) {
1007 >     if (r) {
1008 >          seqdata.update(adaptors5[ai].seqr.chars(), adaptors5[ai].seqr.length(),
1009 >                 adaptors5[ai].pzr, wseq.chars(), wlen, adaptors5[ai].amlen);
1010 >        }
1011 >     else {
1012 >            seqdata.update(adaptors5[ai].seq.chars(), adaptors5[ai].seq.length(),
1013 >                 adaptors5[ai].pz, wseq.chars(), wlen, adaptors5[ai].amlen);
1014 >        }
1015 >         GXAlnInfo* aln=match_adaptor(seqdata, adaptors5[ai].trim_type, gxmem_l, 90);
1016 >         if (aln) {
1017 >           trimmed=true;
1018 >           if (aln->sl-1 > wlen-aln->sr) {
1019 >                   //keep left side
1020 >                   l3-=(wlen-aln->sl+1);
1021 >                   if (l3<0) l3=0;
1022 >                   }
1023 >           else { //keep right side
1024 >                   l5+=aln->sr;
1025 >                   if (l5>=rlen) l5=rlen-1;
1026 >                   }
1027 >           delete aln;
1028 >           if (l3-l5+1<min_read_len) return true;
1029 >           wseq=seq.substr(l5,l3-l5+1);
1030 >           wlen=wseq.length();
1031 >           }
1032 >         } //forward and reverse?
1033 >  }//for each 5' adaptor
1034 >  return trimmed;
1035 > }
1036  
1037 < //also, for fast detection of other adapter-only reads that start past
1038 < // the beginning of the adapter sequence, try to see if the first a3len-4
1039 < // bases of the read are a substring of the adapter
1040 < if (rlen>a3len-3) {
1041 <   GStr rstart=seq.substr(1,a3len-4);
1042 <   if ((fi=adapter3.index(rstart))>=0) {
1043 <     l3=rlen-1;
1044 <     l5=a3len-4;
1045 <     while (fi+l5<a3len && l5<l3 && adapter3[fi+l5]==seq[l5]) l5++;
1046 <     return true;
1047 <     }
1048 <  }
1049 < CSegChain a3segs; //no chains here, just an ordered collection of segment pairs
1050 <  //check the easy cases - 11 bases exact match at the end
1051 < int fdlen=11;
1052 <  if (a3len<16) {
1053 <   fdlen=a3len>>1;
1054 <   }
1055 < if (fdlen>4) {
1056 <     //check if we're lucky enough to have the last 11 bases of the read a part of the adapter
1057 <     GStr rstart=seq.substr(-fdlen-3,fdlen);
1058 <     if ((fi=adapter3.index(rstart))>=0) {
1059 < #ifdef DEBUG
1060 <       if (debug) GMessage("  W11match found: %*s\n", rlen-3, (adapter3.substr(fi,fdlen)).chars());
1061 < #endif
1062 <       if (extendMatch(seq.chars(), rlen, rlen-fdlen-3,
1063 <                     adapter3.chars(), a3len, fi,  fdlen, l5,l3, a3segs))
1064 <            return true;
1065 <       }
1066 <     //another easy case: first 11 characters of the adaptor found as a substring of the read
1067 <     GStr bstr=adapter3.substr(0, fdlen);
1068 <     if ((fi=seq.rindex(bstr))>=0) {
1069 < #ifdef DEBUG
1070 <       if (debug) GMessage("  A11match found: %*s\n", fi+fdlen, bstr.chars());
1071 < #endif
1072 <       if (extendMatch(seq.chars(), rlen, fi,
1073 <                     adapter3.chars(), a3len, 0,  fdlen, l5,l3, a3segs))
1074 <            return true;
1075 <       }
1076 <     } //tried to match 11 bases first
1077 <    
1078 < //no easy cases, so let's do the wmer hashing for the first 12 bases of the adaptor
1079 < //-- only extend if the match is in the 3' (ending) region of the read
1080 < int wordSize=3;
1081 < int hlen=12;
1082 < if (hlen>a3len-wordSize) hlen=a3len-wordSize;
1083 < int imin=rlen>>1; //last half of the read, left boundary for the wmer match
1084 < if (imin<a3len) { imin=GMIN(a3len, rlen-wordSize); }
1085 < imin=rlen-imin;
1086 < for (int iw=0;iw<hlen;iw++) {
1087 <   //int32* qv=(int32*)(adapter3.chars()+iw);
1088 <   int qv=get3mer_value(adapter3.chars()+iw);
1089 <   fi=-1;
1090 <   //while ((fi=fast4rmatch(*qv, seq.chars(), rlen, fi))>=0 && fi>=imin) {
1091 <   while ((fi=w3_rmatch(qv, seq.chars(), rlen, fi))>=0 && fi>=imin) {
1092 <     //GMessage(" ... fi=%d after w3_rmatch() (imin=%d)\n", fi, imin);
1037 > //convert qvs to/from phred64 from/to phread33
1038 > void convertPhred(GStr& q) {
1039 > for (int i=0;i<q.length();i++) q[i]+=qv_cvtadd;
1040 > }
1041  
1042 < #ifdef DEBUG
1043 <     if (debug) GMessage("    Wmatch found: %*s\n", fi+wordSize, (adapter3.substr(iw,wordSize)).chars());
1044 < #endif
1045 <     if (extendMatch(seq.chars(), rlen, fi, adapter3.chars(),
1046 <                   a3len, iw, wordSize, l5,l3, a3segs)) return true;
1047 <     fi--;
1048 <     if (fi<imin) break;
1049 <     }
1050 <   } //for each wmer in the first hlen bases of the adaptor
1051 < /*
1052 < //couldn't find a good trimming extension, hash 12 more bases of the adapter to collect more segment pairs there
1053 < //but only do this if we already have segment pairs collected in the last 12 bases of the adapter
1054 < if (a3segs.bstart>3 || a3segs.bend<(uint)(hlen-wordSize)) return false;
1055 < int hlen2=a3len-wordSize;
1056 < //if (hlen2>a3len-4) hlen2=a3len-4;
1057 < if (hlen2>hlen) {
1058 < #ifdef DEBUG
1059 <     if (debug && a3segs.Count()>0) {
1060 <        GMessage("  >>>>>2nd. hash: %s\n",seq.chars());
1061 <        }
1062 < #endif
1063 <     for (int iw=hlen;iw<hlen2;iw++) {
1064 <         //int* qv=(int32 *)(adapter3.chars()+iw);
1065 <         int qv=get3mer_value(adapter3.chars()+iw);
1066 <         fi=-1;
1067 <         //while ((fi=fast4rmatch(*qv, seq.chars(), rlen, fi))>=0 && fi>=imin) {
1068 <         while ((fi=w3_rmatch(qv, seq.chars(), rlen, fi))>=0 && fi>=imin) {
1069 <           extendMatch(seq.chars(), rlen, fi, adapter3.chars(),
1070 <                         a3len, iw, wordSize, l5,l3, a3segs);
1123 <           fi--;
1124 <           if (fi<imin) break;
1125 <           }
1126 <         } //for each wmer between hlen2 and hlen bases of the adaptor
1127 <     }
1128 < //lastly, analyze collected a3segs for a possible gapped alignment:
1129 < GList<CSegChain> segchains(false,true,false);
1130 < #ifdef DEBUG
1131 < if (debug && a3segs.Count()>0) {
1132 <   GMessage(">>>>>>>>>   Read: %s\n",seq.chars());
1133 <   }
1134 < #endif
1135 < for (int i=0;i<a3segs.Count();i++) {
1136 <   if (a3segs[i]->chain==NULL) {
1137 <       if (a3segs[i]->b.start>3) continue; //don't start a hopeless chain
1138 <       CSegChain* newchain=new CSegChain();
1139 <       newchain->setFreeItem(false);
1140 <       newchain->addSegPair(a3segs[i]);
1141 <       a3segs[i]->chain=newchain;
1142 <       segchains.Add(newchain); //just to free them when done
1042 > void convertPhred(char* q, int len) {
1043 > for (int i=0;i<len;i++) q[i]+=qv_cvtadd;
1044 > }
1045 >
1046 > bool getFastxRec(GLineReader& fq, GStr& rseq, GStr& rqv,
1047 >          GStr& rname, GStr& rinfo, GStr& infname) {
1048 > rseq="";
1049 > rqv="";
1050 > rname="";
1051 > rinfo="";
1052 > if (fq.eof()) return false;
1053 > char* l=fq.getLine();
1054 > while (l!=NULL && (l[0]==0 || isspace(l[0]))) l=fq.getLine(); //ignore empty lines
1055 > if (l==NULL) return false;
1056 > /* if (rawFormat) {
1057 >      //TODO: implement raw qseq parsing here
1058 >      //if (raw type=N) then continue; //skip invalid/bad records
1059 >      } //raw qseq format
1060 > else { // FASTQ or FASTA */
1061 > isfasta=(l[0]=='>');
1062 > if (!isfasta && l[0]!='@') GError("Error: fasta/fastq record marker not found(%s)\n%s\n",
1063 >      infname.chars(), l);
1064 > GStr s(l);
1065 > rname=&(l[1]);
1066 > for (int i=0;i<rname.length();i++)
1067 >    if (rname[i]<=' ') {
1068 >       if (i<rname.length()-2) rinfo=rname.substr(i+1);
1069 >       rname.cut(i);
1070 >       break;
1071         }
1072 <   for (int j=i+1;j<a3segs.Count();j++) {
1073 <      CSegChain* chain=a3segs[i]->chain;
1074 <      if (chain->extendChain(a3segs[j])) {
1075 <          a3segs[j]->chain=chain;
1076 < #ifdef DEBUG
1077 <          if (debug) dbgPrintChain(*chain, adapter3.chars());
1078 < #endif      
1079 <          //save time by checking here if the extended chain is already acceptable for trimming
1080 <          if (chain->aend>(uint)(rlen-4) && chain->bstart<4 && chain->score>a_min_chain_score) {
1081 <            l5=0;
1082 <            l3=chain->astart-2;
1083 < #ifdef DEBUG
1084 <          if (debug && a3segs.Count()>0) {
1085 <            GMessage(">>> >> trimmed-3: %*s\n",l3-l5+1,seq.substr(l5,l3-l5+1).chars());
1086 <            }
1087 < #endif
1088 <            return true;
1089 <            }
1090 <          } //chain can be extended
1072 >  //now get the sequence
1073 > if ((l=fq.getLine())==NULL)
1074 >      GError("Error: unexpected EOF after header for read %s (%s)\n",
1075 >                   rname.chars(), infname.chars());
1076 > rseq=l; //this must be the DNA line
1077 > while ((l=fq.getLine())!=NULL) {
1078 >      //seq can span multiple lines
1079 >      if (l[0]=='>' || l[0]=='+') {
1080 >           fq.pushBack();
1081 >           break; //
1082 >           }
1083 >      rseq+=l;
1084 >      } //check for multi-line seq
1085 > if (!isfasta) { //reading fastq quality values, which can also be multi-line
1086 >    if ((l=fq.getLine())==NULL)
1087 >        GError("Error: unexpected EOF after sequence for %s\n", rname.chars());
1088 >    if (l[0]!='+') GError("Error: fastq qv header marker not detected!\n");
1089 >    if ((l=fq.getLine())==NULL)
1090 >        GError("Error: unexpected EOF after qv header for %s\n", rname.chars());
1091 >    rqv=l;
1092 >    //if (rqv.length()!=rseq.length())
1093 >    //  GError("Error: qv len != seq len for %s\n", rname.chars());
1094 >    while (rqv.length()<rseq.length() && ((l=fq.getLine())!=NULL)) {
1095 >      rqv+=l; //append to qv string
1096        }
1097 <   } //collect segment alignments into chains
1098 < */  
1099 < return false; //no adapter parts found
1100 < }
1097 >    }// fastq
1098 > // } //<-- FASTA or FASTQ
1099 > rseq.upper();
1100 > return true;
1101 > }
1102  
1103 < bool trim_adapter5(GStr& seq, int&l5, int &l3) {
1104 < //if (debug) GMessage("trim_adapter5 on: %s\n", seq.chars());
1105 < int rlen=seq.length();
1103 > #ifdef GDEBUG
1104 > void showTrim(GStr& s, int l5, int l3) {
1105 >  if (l5>0 || l3==0) {
1106 >    color_bg(c_red);
1107 >    }
1108 >  for (int i=0;i<s.length()-1;i++) {
1109 >    if (i && i==l5) color_resetbg();
1110 >    fprintf(stderr, "%c", s[i]);
1111 >    if (i && i==l3) color_bg(c_red);
1112 >   }
1113 >  fprintf(stderr, "%c", s[s.length()-1]);
1114 >  color_reset();
1115 >  fprintf(stderr, "\n");
1116 > }
1117 > #endif
1118 >
1119 > char process_read(GStr& rname, GStr& rseq, GStr& rqv, int &l5, int &l3) {
1120 > //returns 0 if the read was untouched, 1 if it was just trimmed
1121 > // and a trash code if it was trashed
1122   l5=0;
1123 < l3=rlen-1;
1124 < //try to see if adapter is fully included in the read
1125 < int fi=-1;
1126 < if ((fi=seq.index(adapter5))>=0) {
1127 <   if (fi<rlen-fi-a5len) {//match is closer to the right end
1128 <      l5=fi+a5len;
1129 <      l3=rlen-1;
1123 > l3=rseq.length()-1;
1124 > #ifdef GDEBUG
1125 >   //rseq.reverse();
1126 >   GMessage(">%s\n", rname.chars());
1127 >   GMessage("%s\n",rseq.chars());
1128 > #endif
1129 > if (l3-l5+1<min_read_len) {
1130 >   return 's';
1131 >   }
1132 > GStr wseq(rseq.chars());
1133 > GStr wqv(rqv.chars());
1134 > int w5=l5;
1135 > int w3=l3;
1136 > //first do the q-based trimming
1137 > if (qvtrim_qmin!=0 && !wqv.is_empty() && qtrim(wqv, w5, w3)) { // qv-threshold trimming
1138 >   if (w3-w5+1<min_read_len) {
1139 >     return 'Q'; //invalid read
1140 >     }
1141 >    //-- keep only the w5..w3 range
1142 >   l5=w5;
1143 >   l3=w3;
1144 >   wseq=wseq.substr(w5, w3-w5+1);
1145 >   if (!wqv.is_empty())
1146 >      wqv=wqv.substr(w5, w3-w5+1);
1147 >   } //qv trimming
1148 > // N-trimming on the remaining read seq
1149 > if (ntrim(wseq, w5, w3)) {
1150 >   //GMessage("before: %s\n",wseq.chars());
1151 >   //GMessage("after : %s (%d)\n",wseq.substr(w5,w3-w5+1).chars(),w3-w5+1);
1152 >   l5+=w5;
1153 >   l3-=(wseq.length()-1-w3);
1154 >   if (w3-w5+1<min_read_len) {
1155 >     return 'N'; //to be trashed
1156 >     }
1157 >    //-- keep only the w5..w3 range
1158 >   wseq=wseq.substr(w5, w3-w5+1);
1159 >   if (!wqv.is_empty())
1160 >      wqv=wqv.substr(w5, w3-w5+1);
1161 >   w5=0;
1162 >   w3=wseq.length()-1;
1163 >   }
1164 > char trim_code;
1165 > //clean the more dirty end first - 3'
1166 > int prev_w5=0;
1167 > int prev_w3=0;
1168 > bool w3upd=true;
1169 > bool w5upd=true;
1170 > do {
1171 >  trim_code=0;
1172 >  if (w3upd && trim_poly3(wseq, w5, w3, polyA_seed)) {
1173 >      trim_code='A';
1174        }
1175 <    else {
1176 <      l5=0;
1183 <      l3=fi-1;
1175 >  else if (w3upd && trim_poly3(wseq, w5, w3, polyT_seed)) {
1176 >      trim_code='T';
1177        }
1178 <   return true;
1179 <   }
1180 < #ifdef DEBUG
1181 < if (debug) GMessage(">TRIM5 >>   Read: %s\n",seq.chars());
1182 < #endif
1178 >  else if (w5upd && trim_poly5(wseq, w5, w3, polyA_seed)) {
1179 >      trim_code='A';
1180 >      }
1181 >  else if (w5upd && trim_poly5(wseq, w5, w3, polyT_seed)) {
1182 >      trim_code='T';
1183 >      }
1184 >  else if (trim_adaptor5(wseq, w5, w3)) {
1185 >      trim_code='5';
1186 >      }
1187 >  else if (trim_adaptor3(wseq, w5, w3)) {
1188 >      trim_code='3';
1189 >      }
1190 >  if (trim_code) {
1191 >     w3upd=(w3!=prev_w3);
1192 >         w5upd=(w5!=prev_w5);
1193 >         if (w3upd) prev_w3=w3;
1194 >         if (w5upd) prev_w5=w5;
1195 >   #ifdef GDEBUG
1196 >     GMessage("#### TRIM by '%c' code ( w5-w3 = %d-%d ):\n",trim_code, w5,w3);
1197 >     showTrim(wseq, w5, w3);
1198 >   #endif
1199 >     int trimlen=wseq.length()-(w3-w5+1);
1200 >     num_trimmed3++;
1201 >     if (trimlen<min_trimmed3)
1202 >         min_trimmed3=trimlen;
1203 >     l5+=w5;
1204 >     l3-=(wseq.length()-1-w3);
1205 >     if (w3-w5+1<min_read_len) {
1206 >         return trim_code;
1207 >         }
1208 >      //-- keep only the w5..w3 range
1209 >      wseq=wseq.substr(w5, w3-w5+1);
1210 >      if (!wqv.is_empty())
1211 >         wqv=wqv.substr(w5, w3-w5+1);
1212 >      }//trimming at 3' end
1213 > } while (trim_code);
1214 >
1215 > if (doCollapse) {
1216 >   //keep read for later
1217 >   FqDupRec* dr=dhash.Find(wseq.chars());
1218 >   if (dr==NULL) { //new entry
1219 >          //if (prefix.is_empty())
1220 >             dhash.Add(wseq.chars(),
1221 >                  new FqDupRec(&wqv, rname.chars()));
1222 >          //else dhash.Add(wseq.chars(), new FqDupRec(wqv.chars(),wqv.length()));
1223 >         }
1224 >      else
1225 >         dr->add(wqv);
1226 >   } //collapsing duplicates
1227 > else { //not collapsing duplicates
1228 >   //apply the dust filter now
1229 >   if (doDust) {
1230 >     int dustbases=dust(wseq);
1231 >     if (dustbases>(wseq.length()>>1)) {
1232 >        return 'D';
1233 >        }
1234 >     }
1235 >   } //not collapsing duplicates
1236 > return (l5>0 || l3<rseq.length()-1) ? 1 : 0;
1237 > }
1238  
1239 < CSegChain a5segs(true); //list of segment pairs to analyze later if no extendMatch succeeded
1239 > void printHeader(FILE* f_out, char recmarker, GStr& rname, GStr& rinfo) {
1240 > //GMessage("printing Header..%c%s\n",recmarker, rname.chars());
1241 > if (rinfo.is_empty()) fprintf(f_out, "%c%s\n",recmarker,rname.chars());
1242 >  else fprintf(f_out, "%c%s %s\n",recmarker, rname.chars(), rinfo.chars());
1243 > }
1244  
1245 < //try the easy way out first - look for an exact match of 11 bases
1246 < int fdlen=11;
1247 <  if (a5len<16) {
1248 <   fdlen=a5len>>1;
1249 <   }
1250 < if (fdlen>4) {
1251 <     GStr rstart=seq.substr(1,fdlen); //skip the first base as it's sometimes bogus
1200 <     if ((fi=adapter5.index(rstart))>=0) {
1201 < #ifdef DEBUG
1202 <       if (debug) GMessage("  W11match found: %*s\n", 1+fdlen, (adapter3.substr(fi,fdlen)).chars());
1203 < #endif
1204 <       if (extendMatch(seq.chars(), rlen, 1,
1205 <                     adapter5.chars(), a5len, fi,  fdlen, l5,l3, a5segs, true))
1206 <           return true;
1245 > void writeRead(FILE* f_out, GStr& rname, GStr& rinfo, GStr& rseq, GStr& rqv, int& outcounter) {
1246 >   outcounter++;
1247 >   bool asFasta=(rqv.is_empty() || fastaOutput);
1248 >   if (asFasta) {
1249 >    if (prefix.is_empty()) {
1250 >       printHeader(f_out, '>',rname,rinfo);
1251 >       fprintf(f_out, "%s\n", rseq.chars()); //plain one-line fasta for now
1252         }
1253 <     //another easy case: last 11 characters of the adaptor found as a substring of the read
1254 <     GStr bstr=adapter5.substr(-fdlen);
1255 <     if ((fi=seq.index(bstr))>=0) {
1211 < #ifdef DEBUG
1212 <       if (debug) GMessage("  A11match found: %*s\n", fi+fdlen, bstr.chars());
1213 < #endif
1214 <       if (extendMatch(seq.chars(), rlen, fi,
1215 <                     adapter5.chars(), a5len, a5len-fdlen,  fdlen, l5,l3,a5segs,true))
1216 <          return true;
1253 >      else {
1254 >       fprintf(f_out, ">%s%08d\n%s\n", prefix.chars(), outcounter,
1255 >                          rseq.chars());
1256         }
1218     } //tried to matching at most 11 bases first
1219    
1220 //-- no easy cases, do the wmer hashing for the last 12 bases of the adaptor
1221 //-- only extend a wmer if it matches in the 5' (beginning) region of the read
1222 int wordSize=3;
1223 int hlen=12;
1224 if (hlen>a5len-wordSize) hlen=a5len-wordSize;
1225 int imax=rlen>>1; //first half of the read, right boundary for the wmer match
1226 if (imax<a5len) { imax=GMIN(a5len, rlen-wordSize); }
1227 for (int iw=0;iw<=hlen;iw++) {
1228   int apstart=a5len-iw-wordSize;
1229   fi=0;
1230   //int* qv=(int32 *)(adapter5.chars()+apstart);
1231   int qv=get3mer_value(adapter5.chars()+apstart);
1232   //while ((fi=fast4match(*qv, seq.chars(), rlen, fi))>=0 && fi<=imax) {
1233   while ((fi=w3_match(qv, seq.chars(), rlen, fi))>=0 && fi<=imax) {
1234 #ifdef DEBUG
1235     if (debug) GMessage("    Wmatch found: %*s\n", fi+wordSize, (adapter5.substr(apstart,wordSize)).chars());
1236 #endif
1237     if (extendMatch(seq.chars(), rlen, fi, adapter5.chars(),
1238                a5len, apstart, wordSize, l5,l3, a5segs, true)) return true;
1239     fi++;
1240     if (fi>imax) break;
1257       }
1258 <   } //for each wmer in the last hlen bases of the adaptor
1259 < /*
1260 <
1261 < //couldn't find a good trimming extension, hash 12 more bases of the adapter to collect more segment pairs there
1262 < //but only do this if we already have segment pairs collected in the last 12 bases of the adapter
1263 < if (a5segs.bend<(uint)(a5len-3) || a5segs.bstart>(uint)(a5len-hlen+4)) return false;
1264 < int hlen2=a5len-wordSize;
1265 < //if (hlen2>a5len-wordSize) hlen2=a5len-wordSize;
1266 < #ifdef DEBUG
1251 <      if (debug && a5segs.Count()>0) {
1252 <        GMessage("  >>>>>2nd. hash: %s\n",seq.chars());
1253 <        }
1254 < #endif
1255 < if (hlen2>hlen) {
1256 <     for (int iw=hlen+1;iw<=hlen2;iw++) {
1257 <         int apstart=a5len-iw-wordSize;
1258 <         fi=0;
1259 <         //int* qv=(int32 *)(adapter5.chars()+apstart);
1260 <         int qv=get3mer_value(adapter5.chars()+apstart);
1261 <         //while ((fi=fast4match(*qv, seq.chars(), rlen, fi))>=0 && fi<=imax) {
1262 <         while ((fi=w3_match(qv, seq.chars(), rlen, fi))>=0 && fi<=imax) {
1263 <           extendMatch(seq.chars(), rlen, fi, adapter5.chars(),
1264 <                      a5len, apstart, wordSize, l5,l3, a5segs, true);
1265 <           fi++;
1266 <           if (fi>imax) break;
1267 <           }
1268 <         } //for each wmer between hlen2 and hlen bases of the adaptor
1258 >   else {  //fastq
1259 >    if (convert_phred) convertPhred(rqv);
1260 >    if (prefix.is_empty()) {
1261 >       printHeader(f_out, '@', rname, rinfo);
1262 >       fprintf(f_out, "%s\n+\n%s\n", rseq.chars(), rqv.chars());
1263 >       }
1264 >      else
1265 >       fprintf(f_out, "@%s_%08d\n%s\n+\n%s\n", prefix.chars(), outcounter,
1266 >                          rseq.chars(),rqv.chars() );
1267       }
1268 < if (a5segs.bend<(uint)(a5len-3) || a5segs.bstart>(uint)(a5len-hlen+4)) return false;
1269 < // lastly, analyze collected a5segs for a possible gapped alignment:
1270 < GList<CSegChain> segchains(false,true,false);
1271 < #ifdef DEBUG
1272 < if (debug && a5segs.Count()>0) {
1273 <   GMessage(">>>>>>>>>   Read: %s\n",seq.chars());
1268 > }
1269 >
1270 > void trash_report(char trashcode, GStr& rname, FILE* freport) {
1271 > if (freport==NULL || trashcode<=' ') return;
1272 > if (trashcode=='3' || trashcode=='5') {
1273 >   fprintf(freport, "%s\ta%c\n",rname.chars(),trashcode);
1274     }
1275 < #endif
1276 < for (int i=0;i<a5segs.Count();i++) {
1277 <   if (a5segs[i]->chain==NULL) {
1278 <       if (a5segs[i]->b.end<(int)(a5len-4)) continue; //don't start a hopeless chain
1279 <       CSegChain* newchain=new CSegChain(true);
1280 <       newchain->setFreeItem(false);
1281 <       newchain->addSegPair(a5segs[i]);
1282 <       a5segs[i]->chain=newchain;
1283 <       segchains.Add(newchain); //just to free them when done
1284 <       }
1285 <   for (int j=i+1;j<a5segs.Count();j++) {
1286 <      CSegChain* chain=a5segs[i]->chain;
1287 <      if (chain->extendChain(a5segs[j])) {
1288 <         a5segs[j]->chain=chain;
1289 < #ifdef DEBUG
1290 <         if (debug) dbgPrintChain(*chain, adapter5.chars());
1291 < #endif      
1292 <      //save time by checking here if the extended chain is already acceptable for trimming
1295 <         if (chain->bend>(uint)(a5len-3) && chain->astart<4 && chain->score>a_min_chain_score) {
1296 <            l5=chain->aend;
1297 <            l3=rlen-1;
1298 <            return true;
1299 <            }
1300 <         } //chain can be extended
1301 <      }
1302 <   } //collect segment alignments into chains
1303 < */
1304 < return false; //no adapter parts found
1275 > else {
1276 >   fprintf(freport, "%s\t%c\n",rname.chars(),trashcode);
1277 >   }
1278 > //tcounter++;
1279 > }
1280 >
1281 > GStr getFext(GStr& s, int* xpos=NULL) {
1282 > //s must be a filename without a path
1283 > GStr r("");
1284 > if (xpos!=NULL) *xpos=0;
1285 > if (s.is_empty() || s=="-") return r;
1286 > int p=s.rindex('.');
1287 > int d=s.rindex('/');
1288 > if (p<=0 || p>s.length()-2 || p<s.length()-7 || p<d) return r;
1289 > r=s.substr(p+1);
1290 > if (xpos!=NULL) *xpos=p+1;
1291 > r.lower();
1292 > return r;
1293   }
1294  
1295 < //convert qvs to/from phred64 from/to phread33
1296 < void convertPhred(GStr& q) {
1297 < for (int i=0;i<q.length();i++) q[i]+=qv_cvtadd;
1295 > void baseFileName(GStr& fname) {
1296 > //remove all known extensions, like .txt,fq,fastq,fasta,fa)(.gz .gzip .bz2 .bzip2) .
1297 > int xpos=0;
1298 > GStr fext=getFext(fname, &xpos);
1299 > if (xpos<=1) return;
1300 > bool extdel=false;
1301 > GStr f2;
1302 > if (fext=="z" || fext=="zip") {
1303 >   extdel=true;
1304 >   }
1305 >  else if (fext.length()>=2) {
1306 >   f2=fext.substr(0,2);
1307 >   extdel=(f2=="gz" || f2=="bz");
1308 >   }
1309 > if (extdel) {
1310 >   fname.cut(xpos-1);
1311 >   fext=getFext(fname, &xpos);
1312 >   if (xpos<=1) return;
1313 >   }
1314 > extdel=false;
1315 > if (fext=="f" || fext=="fq" || fext=="txt" || fext=="seq" || fext=="sequence") {
1316 >   extdel=true;
1317 >   }
1318 >  else if (fext.length()>=2) {
1319 >   extdel=(fext.substr(0,2)=="fa");
1320 >   }
1321 > if (extdel) fname.cut(xpos-1);
1322 > GStr fncp(fname);
1323 > fncp.lower();
1324 > fncp.chomp("seq");
1325 > fncp.chomp("sequence");
1326 > fncp.trimR("_.");
1327 > if (fncp.length()<fname.length()) fname.cut(fncp.length());
1328   }
1329  
1330 < void convertPhred(char* q, int len) {
1331 < for (int i=0;i<len;i++) q[i]+=qv_cvtadd;
1330 > FILE* prepOutFile(GStr& infname, GStr& pocmd) {
1331 >  FILE* f_out=NULL;
1332 >  GStr fname(getFileName(infname.chars()));
1333 >  //eliminate known extensions
1334 >  baseFileName(fname);
1335 >  if (outsuffix.is_empty() || outsuffix=="-") { return stdout; }
1336 >    else if (pocmd.is_empty()) {
1337 >               GStr oname(fname);
1338 >               oname.append('.');
1339 >               oname.append(outsuffix);
1340 >               f_out=fopen(oname.chars(),"w");
1341 >               if (f_out==NULL) GError("Error: cannot create '%s'\n",oname.chars());
1342 >               }
1343 >            else {
1344 >              GStr oname(">");
1345 >              oname.append(fname);
1346 >              oname.append('.');
1347 >              oname.append(outsuffix);
1348 >              pocmd.append(oname);
1349 >              f_out=popen(pocmd.chars(), "w");
1350 >              if (f_out==NULL) GError("Error: cannot popen '%s'\n",pocmd.chars());
1351 >              }
1352 > return f_out;
1353 > }
1354 >
1355 > void guess_unzip(GStr& fname, GStr& picmd) {
1356 > GStr fext=getFext(fname);
1357 > if (fext=="gz" || fext=="gzip" || fext=="z") {
1358 >    picmd="gzip -cd ";
1359 >    }
1360 >   else if (fext=="bz2" || fext=="bzip2" || fext=="bz" || fext=="bzip") {
1361 >    picmd="bzip2 -cd ";
1362 >    }
1363   }
1364  
1365 + void addAdaptor(GVec<CASeqData>& adaptors, GStr& seq, GAlnTrimType trim_type) {
1366 + //TODO: prepare CASeqData here, and collect hexamers as well
1367 +  if (seq.is_empty() || seq=="-" ||
1368 +          seq=="N/A" || seq==".") return;
1369 +
1370 + CASeqData adata(revCompl);
1371 + int idx=adaptors.Add(adata);
1372 + if (idx<0) GError("Error: failed to add adaptor!\n");
1373 + adaptors[idx].trim_type=trim_type;
1374 + adaptors[idx].update(seq.chars());
1375 + }
1376 +
1377 +
1378 + int loadAdaptors(const char* fname) {
1379 +  GLineReader lr(fname);
1380 +  char* l;
1381 +  while ((l=lr.nextLine())!=NULL) {
1382 +   if (lr.length()<=3 || l[0]=='#') continue;
1383 +   if ( l[0]==' ' || l[0]=='\t' || l[0]==',' ||
1384 +        l[0]==';'|| l[0]==':' ) {
1385 +      int i=1;
1386 +      while (l[i]!=0 && isspace(l[i])) {
1387 +        i++;
1388 +        }
1389 +      if (l[i]!=0) {
1390 +        GStr s(&(l[i]));
1391 +      #ifdef GDEBUG
1392 +          //s.reverse();
1393 +      #endif
1394 +        addAdaptor(adaptors3, s, galn_TrimRight);
1395 +        continue;
1396 +        }
1397 +      }
1398 +    else {
1399 +      GStr s(l);
1400 +      s.startTokenize("\t ;,:");
1401 +      GStr a5,a3;
1402 +      if (s.nextToken(a5))
1403 +            s.nextToken(a3);
1404 +        else continue; //no tokens on this line
1405 +      GAlnTrimType ttype5=galn_TrimLeft;
1406 +      a5.upper();
1407 +      a3.upper();
1408 +      if (a3.is_empty() || a3==a5 || a3=="=") {
1409 +         a3.clear();
1410 +         ttype5=galn_TrimEither;
1411 +         }
1412 +     #ifdef GDEBUG
1413 +     //   a5.reverse();
1414 +     //   a3.reverse();
1415 +     #endif
1416 +      addAdaptor(adaptors5, a5, ttype5);
1417 +      addAdaptor(adaptors3, a3, galn_TrimRight);
1418 +      }
1419 +   }
1420 +   return adaptors5.Count()+adaptors3.Count();
1421 + }
1422 +
1423 + void setupFiles(FILE*& f_in, FILE*& f_in2, FILE*& f_out, FILE*& f_out2,
1424 +                       GStr& s, GStr& infname, GStr& infname2) {
1425 + // uses outsuffix to generate output file names and open file handles as needed
1426 + infname="";
1427 + infname2="";
1428 + f_in=NULL;
1429 + f_in2=NULL;
1430 + f_out=NULL;
1431 + f_out2=NULL;
1432 + //analyze outsuffix intent
1433 + GStr pocmd;
1434 + if (outsuffix=="-") {
1435 +    f_out=stdout;
1436 +    }
1437 +   else {
1438 +    GStr ox=getFext(outsuffix);
1439 +    if (ox.length()>2) ox=ox.substr(0,2);
1440 +    if (ox=="gz") pocmd="gzip -9 -c ";
1441 +        else if (ox=="bz") pocmd="bzip2 -9 -c ";
1442 +    }
1443 + if (s=="-") {
1444 +    f_in=stdin;
1445 +    infname="stdin";
1446 +    f_out=prepOutFile(infname, pocmd);
1447 +    return;
1448 +    } // streaming from stdin
1449 + s.startTokenize(",:");
1450 + s.nextToken(infname);
1451 + bool paired=s.nextToken(infname2);
1452 + if (fileExists(infname.chars())==0)
1453 +    GError("Error: cannot find file %s!\n",infname.chars());
1454 + GStr fname(getFileName(infname.chars()));
1455 + GStr picmd;
1456 + guess_unzip(fname, picmd);
1457 + if (picmd.is_empty()) {
1458 +   f_in=fopen(infname.chars(), "r");
1459 +   if (f_in==NULL) GError("Error opening file '%s'!\n",infname.chars());
1460 +   }
1461 +  else {
1462 +   picmd.append(infname);
1463 +   f_in=popen(picmd.chars(), "r");
1464 +   if (f_in==NULL) GError("Error at popen %s!\n", picmd.chars());
1465 +   }
1466 + if (f_out==stdout) {
1467 +   if (paired) GError("Error: output suffix required for paired reads\n");
1468 +   return;
1469 +   }
1470 + f_out=prepOutFile(infname, pocmd);
1471 + if (!paired) return;
1472 + if (doCollapse) GError("Error: sorry, -C option cannot be used with paired reads!\n");
1473 + // ---- paired reads:-------------
1474 + if (fileExists(infname2.chars())==0)
1475 +     GError("Error: cannot find file %s!\n",infname2.chars());
1476 + picmd="";
1477 + GStr fname2(getFileName(infname2.chars()));
1478 + guess_unzip(fname2, picmd);
1479 + if (picmd.is_empty()) {
1480 +   f_in2=fopen(infname2.chars(), "r");
1481 +   if (f_in2==NULL) GError("Error opening file '%s'!\n",infname2.chars());
1482 +   }
1483 +  else {
1484 +   picmd.append(infname2);
1485 +   f_in2=popen(picmd.chars(), "r");
1486 +   if (f_in2==NULL) GError("Error at popen %s!\n", picmd.chars());
1487 +   }
1488 + f_out2=prepOutFile(infname2, pocmd);
1489 + }

Diff Legend

Removed lines
+ Added lines
< Changed lines
> Changed lines