ViewVC Help
View File | Revision Log | Show Annotations | View Changeset | Root Listing
root/gclib/fqtrim/fqtrim.cpp
(Generate patch)
# Line 6 | Line 6
6   #include "GAlnExtend.h"
7  
8   #define USAGE "Usage:\n\
9 < fqtrim [{-5 <5adapter> -3 <3adapter>|-f <adapters_file>}] [-a <min_matchlen>]\\\n\
9 > fqtrim [{-5 <5adaptor> -3 <3adaptor>|-f <adaptors_file>}] [-a <min_matchlen>]\\\n\
10     [-R] [-q <minq> [-t <trim_max_len>]] [-p {64|33}] [-o <outsuffix>]\\\n\
11     [-l <minlen>] [-C] [-D] [-Q] [-n <rename_prefix>] [-r <discarded.lst>]\\\n\
12      <input.fq>[,<input_mates.fq>\n\
13   \n\
14 < Trim low quality bases at the 3' end and can trim adapter sequence(s), filter\n\
14 > Trim low quality bases at the 3' end and can trim adaptor sequence(s), filter\n\
15   for low complexity and collapse duplicate reads.\n\
16   If read pairs should be trimmed and kept together (i.e. without discarding\n\
17   one read in a pair), the two file names should be given delimited by a comma\n\
# Line 25 | Line 25
25      file(s) named <input>.<outsuffix> which will be created in the \n\
26      current (working) directory; (writes to stdout if -o- is given);\n\
27      a suffix ending with .gz, .gzip or .bz2 will enforce compression\n\
28 < -f  file with adapter sequences to trim, each line having this format:\n\
29 <    <5'-adapter-sequence> <3'-adapter-sequence>\n\
30 < -5  trim the given adapter or primer sequence at the 5' end of each read\n\
28 > -f  file with adaptor sequences to trim, each line having this format:\n\
29 >    <5'-adaptor-sequence> <3'-adaptor-sequence>\n\
30 > -5  trim the given adaptor or primer sequence at the 5' end of each read\n\
31      (e.g. -5 CGACAGGTTCAGAGTTCTACAGTCCGACGATC)\n\
32 < -3  trim the given adapter sequence at the 3' end of each read\n\
32 > -3  trim the given adaptor sequence at the 3' end of each read\n\
33      (e.g. -3 TCGTATGCCGTCTTCTGCTTG)\n\
34   -A  disable polyA/T trimming (enabled by default)\n\
35   -y  minimum length of exact match to adaptor sequence at the proper end (6)\n\
# Line 53 | Line 53
53   //   <zcmd> command, which must output to stdout (e.g. -z 'bzip2 -9 -c')\n
54  
55  
56 < // example 3' adapter for miRNAs: TCGTATGCCGTCTTCTGCTTG
56 > // example 3' adaptor for miRNAs: TCGTATGCCGTCTTCTGCTTG
57  
58   //For paired reads sequencing:
59   //3' : ACACTCTTTCCCTACACGACGCTCTTCCGATCT
# Line 94 | Line 94
94   int qv_cvtadd=0; //could be -31 or +31
95  
96   // adaptor matching metrics -- for X-drop ungapped extension
97 + //const int match_reward=2;
98 + //const int mismatch_penalty=3;
99   const int match_reward=2;
100 < const int mismatch_penalty=3;
101 < const int Xdrop=8;
100 > const int mismatch_penalty=4;
101 > const int Xdrop=10;
102  
103   const int poly_m_score=2; //match score
104   const int poly_mis_score=-3; //mismatch
# Line 107 | Line 109
109   const char *polyT_seed="TTTT";
110  
111   struct CASeqData {
112 <   //positional data for every possible hexamer in an adapter
113 <   GVec<uint16>* pz[4096]; //0-based coordinates of all possible hexamers in the adapter sequence
114 <   GVec<uint16>* pzr[4096]; //0-based coordinates of all possible hexamers for the reverse complement of the adapter sequence
115 <   GStr seq; //actual adapter sequence data
112 >   //positional data for every possible hexamer in an adaptor
113 >   GVec<uint16>* pz[4096]; //0-based coordinates of all possible hexamers in the adaptor sequence
114 >   GVec<uint16>* pzr[4096]; //0-based coordinates of all possible hexamers for the reverse complement of the adaptor sequence
115 >   GStr seq; //actual adaptor sequence data
116     GStr seqr; //reverse complement sequence
117 +   int amlen; //fraction of adaptor length matching that's
118 +              //enough to consider the alignment
119 +   GAlnTrimType trim_type;
120     bool use_reverse;
121 <   CASeqData(bool rev=false):seq(),seqr() {
122 <     use_reverse=rev;
121 >   CASeqData(bool rev=false):seq(),seqr(),
122 >             amlen(0), use_reverse(rev) {
123 >     trim_type=galn_None; //should be updated later!
124       for (int i=0;i<4096;i++) {
125          pz[i]=NULL;
126          pzr[i]=NULL;
# Line 122 | Line 128
128       }
129  
130     void update(const char* s) {
131 <   seq=s;
132 <   table6mers(seq.chars(), seq.length(), pz);
133 <   if (!use_reverse) return;
134 <   //reverse complement
135 <   seqr=s;
136 <   int slen=seq.length();
137 <   for (int i=0;i<slen;i++)
138 <     seqr[i]=ntComplement(seq[slen-i-1]);
139 <   table6mers(seqr.chars(), seqr.length(), pzr);
131 >         seq=s;
132 >         table6mers(seq.chars(), seq.length(), pz);
133 >         amlen=iround(double(seq.length())*0.8);
134 >         if (amlen<12)
135 >                amlen=12;
136 >         if (!use_reverse) return;
137 >         //reverse complement
138 >         seqr=s;
139 >         int slen=seq.length();
140 >         for (int i=0;i<slen;i++)
141 >           seqr[i]=ntComplement(seq[slen-i-1]);
142 >         table6mers(seqr.chars(), seqr.length(), pzr);
143     }
144  
145     ~CASeqData() {
# Line 141 | Line 150
150     }
151   };
152  
153 < GVec<CASeqData> adapters5;
154 < GVec<CASeqData> adapters3;
153 > GVec<CASeqData> adaptors5;
154 > GVec<CASeqData> adaptors3;
155  
156   CGreedyAlignData* gxmem_l=NULL;
157   CGreedyAlignData* gxmem_r=NULL;
# Line 195 | Line 204
204  
205   GHash<FqDupRec> dhash; //hash to keep track of duplicates
206  
207 < void addAdapter(GVec<CASeqData>& adapters, GStr& seq);
208 < int loadAdapters(const char* fname);
207 > void addAdaptor(GVec<CASeqData>& adaptors, GStr& seq, GAlnTrimType trim_type);
208 > int loadAdaptors(const char* fname);
209  
210   void setupFiles(FILE*& f_in, FILE*& f_in2, FILE*& f_out, FILE*& f_out2,
211                         GStr& s, GStr& infname, GStr& infname2);
# Line 216 | Line 225
225   int dust(GStr& seq);
226   bool trim_poly5(GStr &seq, int &l5, int &l3, const char* poly_seed); //returns true if any trimming occured
227   bool trim_poly3(GStr &seq, int &l5, int &l3, const char* poly_seed);
228 < bool trim_adapter5(GStr& seq, int &l5, int &l3); //returns true if any trimming occured
229 < bool trim_adapter3(GStr& seq, int &l5, int &l3);
228 > bool trim_adaptor5(GStr& seq, int &l5, int &l3); //returns true if any trimming occured
229 > bool trim_adaptor3(GStr& seq, int &l5, int &l3);
230  
231   void convertPhred(char* q, int len);
232   void convertPhred(GStr& q);
# Line 278 | Line 287
287       }
288    s=args.getOpt('f');
289    if (!s.is_empty()) {
290 <   loadAdapters(s.chars());
290 >   loadAdaptors(s.chars());
291     }
292 <  bool fileAdapters=adapters5.Count()+adapters3.Count();
292 >  bool fileAdaptors=adaptors5.Count()+adaptors3.Count();
293    s=args.getOpt('5');
294    if (!s.is_empty()) {
295 <    if (fileAdapters)
295 >    if (fileAdaptors)
296        GError("Error: options -5 and -f cannot be used together!\n");
297      s.upper();
298 <    addAdapter(adapters5, s);
298 >    addAdaptor(adaptors5, s, galn_TrimLeft);
299      }
300    s=args.getOpt('3');
301    if (!s.is_empty()) {
302 <    if (fileAdapters)
302 >    if (fileAdaptors)
303        GError("Error: options -3 and -f cannot be used together!\n");
304        s.upper();
305 <      addAdapter(adapters3, s);
305 >      addAdaptor(adaptors3, s, galn_TrimRight);
306      }
307    s=args.getOpt('y');
308    if (!s.is_empty()) {
# Line 318 | Line 327
327      openfw(freport, args, 'r');
328    char* infile=NULL;
329  
330 <  if (adapters5.Count()>0)
331 <    gxmem_l=new CGreedyAlignData(match_reward, mismatch_penalty, Xdrop-2);
332 <  if (adapters3.Count()>0)
330 >  if (adaptors5.Count()>0)
331 >    //gxmem_l=new CGreedyAlignData(match_reward, mismatch_penalty, Xdrop-2);
332 >        gxmem_l=new CGreedyAlignData(match_reward, mismatch_penalty, Xdrop);
333 >  if (adaptors3.Count()>0)
334      gxmem_r=new CGreedyAlignData(match_reward, mismatch_penalty, Xdrop);
335  
336    while ((infile=args.nextNonOpt())!=NULL) {
# Line 391 | Line 401
401              } //pair read
402         if (tcode>1) { //trashed
403           #ifdef GDEBUG
404 <         GMessage(" !!!!TRASH => 'N'\n");
404 >         GMessage(" !!!!TRASH code = %c\n",tcode);
405           #endif
406            if (tcode=='s') trash_s++;
407            else if (tcode=='A' || tcode=='T') trash_poly++;
# Line 494 | Line 504
504         if (trash_poly>0)
505           GMessage("   Trashed by poly-A/T:%9d\n", trash_poly);
506         if (trash_A5>0)
507 <         GMessage(" Trashed by 5' adapter:%9d\n", trash_A5);
507 >         GMessage(" Trashed by 5' adaptor:%9d\n", trash_A5);
508         if (trash_A3>0)
509 <         GMessage(" Trashed by 3' adapter:%9d\n", trash_A3);
509 >         GMessage(" Trashed by 3' adaptor:%9d\n", trash_A3);
510         }
511      if (trashReport) {
512            FWCLOSE(freport);
# Line 937 | Line 947
947   return false;
948   }
949  
950 < bool trim_adapter3(GStr& seq, int&l5, int &l3) {
951 < if (adapters3.Count()==0) return false;
950 > bool trim_adaptor3(GStr& seq, int&l5, int &l3) {
951 > if (adaptors3.Count()==0) return false;
952   int rlen=seq.length();
953   l5=0;
954   l3=rlen-1;
955   bool trimmed=false;
956 < GStr wseq(seq.chars());
956 > GStr wseq(seq);
957   int wlen=rlen;
958 < for (int ai=0;ai<adapters3.Count();ai++) {
959 <  //if (adapters3[ai].is_empty()) continue;
960 <  int alen=adapters3[ai].seq.length();
961 <  GStr& aseq=adapters3[ai].seq;
962 <  GXAlnInfo* r_bestaln=match_RightEnd(aseq.chars(), alen, adapters3[ai].pz,
963 <                            wseq.chars(), wlen, gxmem_r, 74);
964 <  if (r_bestaln) {
958 > GXSeqData seqdata;
959 > int numruns=revCompl ? 2 : 1;
960 >
961 > for (int ai=0;ai<adaptors3.Count();ai++) {
962 >   for (int r=0;r<numruns;r++) {
963 >     if (r) {
964 >          seqdata.update(adaptors3[ai].seqr.chars(), adaptors3[ai].seqr.length(),
965 >                 adaptors3[ai].pzr, wseq.chars(), wlen, adaptors3[ai].amlen);
966 >        }
967 >     else {
968 >            seqdata.update(adaptors3[ai].seq.chars(), adaptors3[ai].seq.length(),
969 >                 adaptors3[ai].pz, wseq.chars(), wlen, adaptors3[ai].amlen);
970 >        }
971 >
972 >  GXAlnInfo* aln=match_adaptor(seqdata, adaptors3[ai].trim_type, gxmem_r, 86);
973 >  if (aln) {
974       trimmed=true;
975 <     //keep unmatched region on the left, if any
976 <     l3-=(wlen-r_bestaln->sl+1);
977 <     delete r_bestaln;
978 <     if (l3<0) l3=0;
975 >     //keep unmatched region on the left OR right (the longer one)
976 >     if (aln->sl > wlen-aln->sr) {
977 >         //keep left side
978 >         l3-=(wlen-aln->sl+1);
979 >         if (l3<0) l3=0;
980 >         }
981 >     else { //keep right side
982 >         l5+=aln->sr;
983 >         if (l5>=rlen) l5=rlen-1;
984 >         }
985 >     delete aln;
986       if (l3-l5+1<min_read_len) return true;
987       wseq=seq.substr(l5,l3-l5+1);
988       wlen=wseq.length();
989       }
990 <  }//for each 5' adapter
990 >   }//forward and reverse adaptors
991 >  }//for each 3' adaptor
992    return trimmed;
993   }
994  
995 < bool trim_adapter5(GStr& seq, int&l5, int &l3) {
996 < if (adapters5.Count()==0) return false;
995 > bool trim_adaptor5(GStr& seq, int&l5, int &l3) {
996 > if (adaptors5.Count()==0) return false;
997   int rlen=seq.length();
998   l5=0;
999   l3=rlen-1;
1000   bool trimmed=false;
1001 < GStr wseq(seq.chars());
1001 > GStr wseq(seq);
1002   int wlen=rlen;
1003 < for (int ai=0;ai<adapters5.Count();ai++) {
1004 <  //if (adapters5[ai].is_empty()) continue;
1005 <  int alen=adapters5[ai].seq.length();
1006 <  GStr& aseq=adapters5[ai].seq;
1007 <  GXAlnInfo* l_bestaln=match_LeftEnd(aseq.chars(), alen, adapters5[ai].pz,
1008 <                 wseq.chars(), wlen, gxmem_l, 84);
1009 <  if (l_bestaln) {
1010 <     trimmed=true;
1011 <     l5+=l_bestaln->sr;
1012 <     delete l_bestaln;
1013 <     if (l5>=rlen) l5=rlen-1;
1014 <     if (l3-l5+1<min_read_len) return true;
1015 <     wseq=seq.substr(l5,l3-l5+1);
1016 <     wlen=wseq.length();
1017 <     }
1018 <  }//for each 5' adapter
1003 > GXSeqData seqdata;
1004 > int numruns=revCompl ? 2 : 1;
1005 > for (int ai=0;ai<adaptors5.Count();ai++) {
1006 >   for (int r=0;r<numruns;r++) {
1007 >     if (r) {
1008 >          seqdata.update(adaptors5[ai].seqr.chars(), adaptors5[ai].seqr.length(),
1009 >                 adaptors5[ai].pzr, wseq.chars(), wlen, adaptors5[ai].amlen);
1010 >        }
1011 >     else {
1012 >            seqdata.update(adaptors5[ai].seq.chars(), adaptors5[ai].seq.length(),
1013 >                 adaptors5[ai].pz, wseq.chars(), wlen, adaptors5[ai].amlen);
1014 >        }
1015 >         GXAlnInfo* aln=match_adaptor(seqdata, adaptors5[ai].trim_type, gxmem_l, 90);
1016 >         if (aln) {
1017 >           trimmed=true;
1018 >           if (aln->sl-1 > wlen-aln->sr) {
1019 >                   //keep left side
1020 >                   l3-=(wlen-aln->sl+1);
1021 >                   if (l3<0) l3=0;
1022 >                   }
1023 >           else { //keep right side
1024 >                   l5+=aln->sr;
1025 >                   if (l5>=rlen) l5=rlen-1;
1026 >                   }
1027 >           delete aln;
1028 >           if (l3-l5+1<min_read_len) return true;
1029 >           wseq=seq.substr(l5,l3-l5+1);
1030 >           wlen=wseq.length();
1031 >           }
1032 >         } //forward and reverse?
1033 >  }//for each 5' adaptor
1034    return trimmed;
1035   }
1036  
# Line 1060 | Line 1102
1102  
1103   #ifdef GDEBUG
1104   void showTrim(GStr& s, int l5, int l3) {
1105 <  if (l5>0) {
1105 >  if (l5>0 || l3==0) {
1106      color_bg(c_red);
1107      }
1108    for (int i=0;i<s.length()-1;i++) {
1109      if (i && i==l5) color_resetbg();
1110      fprintf(stderr, "%c", s[i]);
1111 <    if (i==l3) color_bg(c_red);
1111 >    if (i && i==l3) color_bg(c_red);
1112     }
1113    fprintf(stderr, "%c", s[s.length()-1]);
1114    color_reset();
# Line 1120 | Line 1162
1162     w3=wseq.length()-1;
1163     }
1164   char trim_code;
1165 + //clean the more dirty end first - 3'
1166 + int prev_w5=0;
1167 + int prev_w3=0;
1168 + bool w3upd=true;
1169 + bool w5upd=true;
1170   do {
1171    trim_code=0;
1172 <  if (trim_poly5(wseq, w5, w3, polyA_seed)) {
1172 >  if (w3upd && trim_poly3(wseq, w5, w3, polyA_seed)) {
1173        trim_code='A';
1174        }
1175 <  else if (trim_poly5(wseq, w5, w3, polyT_seed)) {
1175 >  else if (w3upd && trim_poly3(wseq, w5, w3, polyT_seed)) {
1176        trim_code='T';
1177        }
1178 <  else if (trim_adapter5(wseq, w5, w3)) {
1132 <      trim_code='5';
1133 <      }
1134 <  if (trim_code) {
1135 <     #ifdef GDEBUG
1136 <      GMessage("#### TRIM by '%c' code ( w5-w3 = %d-%d ):\n",trim_code, w5,w3);
1137 <      showTrim(wseq, w5, w3);
1138 <     #endif
1139 <     int trimlen=wseq.length()-(w3-w5+1);
1140 <     num_trimmed5++;
1141 <     if (trimlen<min_trimmed5)
1142 <         min_trimmed5=trimlen;
1143 <     l5+=w5;
1144 <     l3-=(wseq.length()-1-w3);
1145 <     if (w3-w5+1<min_read_len) {
1146 <         return trim_code;
1147 <         }
1148 <      //-- keep only the w5..w3 range
1149 <      wseq=wseq.substr(w5, w3-w5+1);
1150 <      if (!wqv.is_empty())
1151 <         wqv=wqv.substr(w5, w3-w5+1);
1152 <      }// trimmed at 5' end
1153 < } while (trim_code);
1154 <
1155 < do {
1156 <  trim_code=0;
1157 <  if (trim_poly3(wseq, w5, w3, polyA_seed)) {
1178 >  else if (w5upd && trim_poly5(wseq, w5, w3, polyA_seed)) {
1179        trim_code='A';
1180        }
1181 <  else if (trim_poly3(wseq, w5, w3, polyT_seed)) {
1181 >  else if (w5upd && trim_poly5(wseq, w5, w3, polyT_seed)) {
1182        trim_code='T';
1183        }
1184 <  else if (trim_adapter3(wseq, w5, w3)) {
1184 >  else if (trim_adaptor5(wseq, w5, w3)) {
1185 >      trim_code='5';
1186 >      }
1187 >  else if (trim_adaptor3(wseq, w5, w3)) {
1188        trim_code='3';
1189        }
1190    if (trim_code) {
1191 <     #ifdef GDEBUG
1191 >     w3upd=(w3!=prev_w3);
1192 >         w5upd=(w5!=prev_w5);
1193 >         if (w3upd) prev_w3=w3;
1194 >         if (w5upd) prev_w5=w5;
1195 >   #ifdef GDEBUG
1196       GMessage("#### TRIM by '%c' code ( w5-w3 = %d-%d ):\n",trim_code, w5,w3);
1197       showTrim(wseq, w5, w3);
1198 <     #endif
1198 >   #endif
1199       int trimlen=wseq.length()-(w3-w5+1);
1200       num_trimmed3++;
1201       if (trimlen<min_trimmed3)
# Line 1184 | Line 1212
1212        }//trimming at 3' end
1213   } while (trim_code);
1214  
1187
1215   if (doCollapse) {
1216     //keep read for later
1217     FqDupRec* dr=dhash.Find(wseq.chars());
# Line 1335 | Line 1362
1362      }
1363   }
1364  
1365 < void addAdapter(GVec<CASeqData>& adapters, GStr& seq) {
1365 > void addAdaptor(GVec<CASeqData>& adaptors, GStr& seq, GAlnTrimType trim_type) {
1366   //TODO: prepare CASeqData here, and collect hexamers as well
1367 +  if (seq.is_empty() || seq=="-" ||
1368 +          seq=="N/A" || seq==".") return;
1369 +
1370   CASeqData adata(revCompl);
1371 < int idx=adapters.Add(adata);
1371 > int idx=adaptors.Add(adata);
1372   if (idx<0) GError("Error: failed to add adaptor!\n");
1373 < adapters[idx].update(seq.chars());
1373 > adaptors[idx].trim_type=trim_type;
1374 > adaptors[idx].update(seq.chars());
1375   }
1376  
1377  
1378 < int loadAdapters(const char* fname) {
1378 > int loadAdaptors(const char* fname) {
1379    GLineReader lr(fname);
1380    char* l;
1381    while ((l=lr.nextLine())!=NULL) {
# Line 1360 | Line 1391
1391        #ifdef GDEBUG
1392            //s.reverse();
1393        #endif
1394 <        addAdapter(adapters3, s);
1394 >        addAdaptor(adaptors3, s, galn_TrimRight);
1395          continue;
1396          }
1397        }
# Line 1369 | Line 1400
1400        s.startTokenize("\t ;,:");
1401        GStr a5,a3;
1402        if (s.nextToken(a5))
1403 <         s.nextToken(a3);
1403 >            s.nextToken(a3);
1404 >        else continue; //no tokens on this line
1405 >      GAlnTrimType ttype5=galn_TrimLeft;
1406        a5.upper();
1407        a3.upper();
1408 +      if (a3.is_empty() || a3==a5 || a3=="=") {
1409 +         a3.clear();
1410 +         ttype5=galn_TrimEither;
1411 +         }
1412       #ifdef GDEBUG
1413       //   a5.reverse();
1414       //   a3.reverse();
1415       #endif
1416 <      addAdapter(adapters5, a5);
1417 <      addAdapter(adapters3, a3);
1416 >      addAdaptor(adaptors5, a5, ttype5);
1417 >      addAdaptor(adaptors3, a3, galn_TrimRight);
1418        }
1419     }
1420 <   return adapters5.Count()+adapters3.Count();
1420 >   return adaptors5.Count()+adaptors3.Count();
1421   }
1422  
1423   void setupFiles(FILE*& f_in, FILE*& f_in2, FILE*& f_out, FILE*& f_out2,

Diff Legend

Removed lines
+ Added lines
< Changed lines
> Changed lines