ViewVC Help
View File | Revision Log | Show Annotations | View Changeset | Root Listing
(Generate patch)
# Line 4 | Line 4
4   #include "GList.hh"
5   #include <ctype.h>
6   #include "GAlnExtend.h"
7 + #include <inttypes.h>
9   #define USAGE "Usage:\n\
10 < fqtrim [{-5 <5adapter> -3 <3adapter>|-f <adapters_file>}] [-a <min_matchlen>]\\\n\
11 <   [-q <minq> [-t <trim_max_len>]] [-p {64|33}] [-o <outsuffix>]\\\n\
10 > fqtrim [{-5 <5adaptor> -3 <3adaptor>|-f <adaptors_file>}] [-a <min_matchlen>]\\\n\
11 >   [-R] [-q <minq> [-t <trim_max_len>]] [-p {64|33}] [-o <outsuffix>]\\\n\
12     [-l <minlen>] [-C] [-D] [-Q] [-n <rename_prefix>] [-r <discarded.lst>]\\\n\
13      <input.fq>[,<input_mates.fq>\n\
14   \n\
15 < Trim low quality bases at the 3' end and can trim adapter sequence(s), filter\n\
15 > Trim low quality bases at the 3' end and can trim adaptor sequence(s), filter\n\
16   for low complexity and collapse duplicate reads.\n\
17   If read pairs should be trimmed and kept together (i.e. without discarding\n\
18   one read in a pair), the two file names should be given delimited by a comma\n\
# Line 25 | Line 26
26      file(s) named <input>.<outsuffix> which will be created in the \n\
27      current (working) directory; (writes to stdout if -o- is given);\n\
28      a suffix ending with .gz, .gzip or .bz2 will enforce compression\n\
29 < -f  file with adapter sequences to trim, each line having this format:\n\
30 <    <5'-adapter-sequence> <3'-adapter-sequence>\n\
31 < -5  trim the given adapter or primer sequence at the 5' end of each read\n\
29 > -f  file with adaptor sequences to trim, each line having this format:\n\
30 >    <5'-adaptor-sequence> <3'-adaptor-sequence>\n\
31 > -5  trim the given adaptor or primer sequence at the 5' end of each read\n\
33 < -3  trim the given adapter sequence at the 3' end of each read\n\
33 > -3  trim the given adaptor sequence at the 3' end of each read\n\
34      (e.g. -3 TCGTATGCCGTCTTCTGCTTG)\n\
35 < -A  disable polyA trimming (enabled by default)\n\
35 < -T  enable polyT trimming (disabled by default)\n\
35 > -A  disable polyA/T trimming (enabled by default)\n\
36   -y  minimum length of exact match to adaptor sequence at the proper end (6)\n\
37   -q  trim bases with quality value lower than <minq> (starting at the 3' end)\n\
38   -t  for -q option, maximum trimming at the 3' end is limited to <trim_max_len>\n\
# Line 42 | Line 42
42   -r  write a simple \"trash report\" file listing the discarded reads with a\n\
43      one letter code for the reason why they were trashed\n\
44   -D  apply a low-complexity (dust) filter and discard any read that has over\n\
45 <    50% of its length detected as low complexity\n\
45 >    50%% of its length detected as low complexity\n\
46   -C  collapse duplicate reads and add a prefix with their count to the read\n\
47      name (e.g. for microRNAs)\n\
48   -p  input is phred64/phred33 (use -p64 or -p33)\n\
49   -Q  convert quality values to the other Phred qv type\n\
50 < -V  verbose processing\n\
50 > -V  be verbose when done (print summary counts)\n\
51   "
52 <
52 >
53   //-z  for -o option, the output stream(s) will be first piped into the given\n
54   //   <zcmd> command, which must output to stdout (e.g. -z 'bzip2 -9 -c')\n
56 <
57 < // example 3' adapter for miRNAs: TCGTATGCCGTCTTCTGCTTG
56 >
57 > // example 3' adaptor for miRNAs: TCGTATGCCGTCTTCTGCTTG
59   //For paired reads sequencing:
# Line 63 | Line 63
63   //FILE* f_out2=NULL; //for paired reads
64   //FILE* f_in=NULL; //input fastq (stdin if not provided)
65   //FILE* f_in2=NULL; //for paired reads
66 +
67   FILE* freport=NULL;
69   bool debug=false;
70   bool verbose=false;
71   bool doCollapse=false;
72   bool doDust=false;
73 + bool doPolyTrim=true;
74   bool fastaOutput=false;
75   bool trashReport=false;
76 < //bool rawFormat=false;
76 > bool revCompl=false; //also reverse complement adaptor sequences
77   int min_read_len=16;
78   double max_perc_N=7.0;
79   int dust_cutoff=16;
80   bool isfasta=false;
81   bool convert_phred=false;
82 < GStr outsuffix; // -o
82 > GStr outsuffix; // -o
83   GStr prefix;
84   GStr zcmd;
85 < int num_trimmed5=0;
86 < int num_trimmed3=0;
87 < int num_trimmedN=0;
88 < int num_trimmedQ=0;
89 < int min_trimmed5=INT_MAX;
90 < int min_trimmed3=INT_MAX;
85 > char isACGT[256];
86 >
87 > uint num_trimN=0; //reads trimmed by N%
88 > uint num_trimQ=0; //reads trimmed by qv threshold
89 > uint num_trimV=0; //reads trimmed by adapter match
90 > uint num_trimA=0; //reads trimmed by polyA
91 > uint num_trimT=0; //reads trimmed by polyT
92 > uint num_trim5=0; //number of reads trimmed at 5' end
93 > uint num_trim3=0; //number of reads trimmed at 3' end
94 >
95 > uint64 b_totalIn=0; //total number of input bases
96 > uint64 b_totalN=0;  //total number of undetermined bases found in input bases
97 >
98 > uint64 b_trimN=0; //total number of bases trimmed due to N-trim
99 > uint64 b_trimQ=0; //number of bases trimmed due to qv threshold
100 > uint64 b_trimV=0; //total number of bases trimmed due to adaptor matches
101 > uint64 b_trimA=0; //number of bases trimmed due to poly-A tails
102 > uint64 b_trimT=0; //number of bases trimmed due to poly-T tails
103 > uint64 b_trim5=0; //total bases trimmed on the 5' side
104 > uint64 b_trim3=0; //total bases trimmed on the 3' side
105 > //int min_trimmed5=INT_MAX;
106 > //int min_trimmed3=INT_MAX;
108   int qvtrim_qmin=0;
109   int qvtrim_max=0;  //for -q, do not trim at 3'-end more than this number of bases
# Line 93 | Line 111
111   int qv_cvtadd=0; //could be -31 or +31
113   // adaptor matching metrics -- for X-drop ungapped extension
114 + //const int match_reward=2;
115 + //const int mismatch_penalty=3;
116 + const int match_reward=2;
117 + const int mismatch_penalty=4;
118 + const int Xdrop=10;
119 +
120   const int poly_m_score=2; //match score
121   const int poly_mis_score=-3; //mismatch
122   const int poly_dropoff_score=7;
# Line 101 | Line 125
125   const char *polyA_seed="AAAA";
126   const char *polyT_seed="TTTT";
128 < struct CAdapters {
129 <    GStr a5;
130 <    GStr a3;
131 <    CAdapters(const char* s5=NULL, const char* s3=NULL):a5(s5),a3(s3) {
132 <      }
128 > struct CASeqData {
129 >   //positional data for every possible hexamer in an adaptor
130 >   GVec<uint16>* pz[4096]; //0-based coordinates of all possible hexamers in the adaptor sequence
131 >   GVec<uint16>* pzr[4096]; //0-based coordinates of all possible hexamers for the reverse complement of the adaptor sequence
132 >   GStr seq; //actual adaptor sequence data
133 >   GStr seqr; //reverse complement sequence
134 >   int amlen; //fraction of adaptor length matching that's
135 >              //enough to consider the alignment
136 >   GAlnTrimType trim_type;
137 >   bool use_reverse;
138 >   CASeqData(bool rev=false):seq(),seqr(),
139 >             amlen(0), use_reverse(rev) {
140 >     trim_type=galn_None; //should be updated later!
141 >     for (int i=0;i<4096;i++) {
142 >        pz[i]=NULL;
143 >        pzr[i]=NULL;
144 >        }
145 >     }
146 >
147 >   void update(const char* s) {
148 >         seq=s;
149 >         table6mers(seq.chars(), seq.length(), pz);
150 >         amlen=iround(double(seq.length())*0.8);
151 >         if (amlen<12)
152 >                amlen=12;
153 >         if (!use_reverse) return;
154 >         //reverse complement
155 >         seqr=s;
156 >         int slen=seq.length();
157 >         for (int i=0;i<slen;i++)
158 >           seqr[i]=ntComplement(seq[slen-i-1]);
159 >         table6mers(seqr.chars(), seqr.length(), pzr);
160 >   }
161 >
162 >   ~CASeqData() {
163 >     for (int i=0;i<4096;i++) {
164 >       delete pz[i];
165 >       delete pzr[i];
166 >     }
167 >   }
168   };
170 < GPVec<CAdapters> adapters;
170 > GVec<CASeqData> adaptors5;
171 > GVec<CASeqData> adaptors3;
172 >
173 > CGreedyAlignData* gxmem_l=NULL;
174 > CGreedyAlignData* gxmem_r=NULL;
176   // element in dhash:
177   class FqDupRec {
# Line 158 | Line 221
222   GHash<FqDupRec> dhash; //hash to keep track of duplicates
224 < int loadAdapters(const char* fname);
224 > void addAdaptor(GVec<CASeqData>& adaptors, GStr& seq, GAlnTrimType trim_type);
225 > int loadAdaptors(const char* fname);
227 < void setupFiles(FILE*& f_in, FILE*& f_in2, FILE*& f_out, FILE*& f_out2,
228 <                       GStr& s, GStr& infname, GStr& infname2);
227 > void setupFiles(FILE*& f_in, FILE*& f_in2, FILE*& f_out, FILE*& f_out2,
228 >                       GStr& s, GStr& infname, GStr& infname2);
229   // uses outsuffix to generate output file names and open file handles as needed
230 <
230 >
231   void writeRead(FILE* f_out, GStr& rname, GStr& rinfo, GStr& rseq, GStr& rqv, int& outcounter);
232   void trash_report(char trashcode, GStr& rname, FILE* freport);
234 < bool getFastxRec(GLineReader& fq, GStr& rseq, GStr& rqv,
234 > bool getFastxRec(GLineReader& fq, GStr& rseq, GStr& rqv,
235            GStr& rname, GStr& rinfo, GStr& infname);
237 < char process_read(GStr& rname, GStr& rseq, GStr& rqv, int &l5, int &l3);
237 > char process_read(GStr& rname, GStr& rseq, GStr& rqv, int &l5, int &l3);
238   //returns 0 if the read was untouched, 1 if it was trimmed and a trash code if it was trashed
240   bool ntrim(GStr& rseq, int &l5, int &l3); //returns true if any trimming occured
# Line 178 | Line 242
242   int dust(GStr& seq);
243   bool trim_poly5(GStr &seq, int &l5, int &l3, const char* poly_seed); //returns true if any trimming occured
244   bool trim_poly3(GStr &seq, int &l5, int &l3, const char* poly_seed);
245 < bool trim_adapter5(GStr& seq, int &l5, int &l3); //returns true if any trimming occured
246 < bool trim_adapter3(GStr& seq, int &l5, int &l3);
245 > bool trim_adaptor5(GStr& seq, int &l5, int &l3); //returns true if any trimming occured
246 > bool trim_adaptor3(GStr& seq, int &l5, int &l3);
248   void convertPhred(char* q, int len);
249   void convertPhred(GStr& q);
251   int main(int argc, char * const argv[]) {
252 <  GArgs args(argc, argv, "YQDCVl:d:3:5:m:n:r:p:q:f:t:o:z:a:");
252 >  GArgs args(argc, argv, "YQDCRVAl:d:3:5:m:n:r:p:q:f:t:o:z:a:");
253    int e;
254    if ((e=args.isError())>0) {
255        GMessage("%s\nInvalid argument: %s\n", USAGE, argv[e]);
# Line 196 | Line 260
260    convert_phred=(args.getOpt('Q')!=NULL);
261    doCollapse=(args.getOpt('C')!=NULL);
262    doDust=(args.getOpt('D')!=NULL);
263 +  revCompl=(args.getOpt('R')!=NULL);
264 +  if (args.getOpt('A')) doPolyTrim=false;
265    /*
266    rawFormat=(args.getOpt('R')!=NULL);
267    if (rawFormat) {
# Line 204 | Line 270
270    */
271    prefix=args.getOpt('n');
272    GStr s=args.getOpt('l');
273 <  if (!s.is_empty())
273 >  if (!s.is_empty())
274       min_read_len=s.asInt();
275    s=args.getOpt('m');
276 <  if (!s.is_empty())
276 >  if (!s.is_empty())
277       max_perc_N=s.asDouble();
278    s=args.getOpt('d');
279    if (!s.is_empty()) {
# Line 233 | Line 299
299          qv_phredtype=64;
300          qv_cvtadd=-31;
301          }
302 <       else
302 >       else
303           GMessage("%s\nInvalid value for -p option (can only be 64 or 33)!\n",USAGE);
304       }
305 +  memset((void*)isACGT, 0, 256);
306 +  isACGT['A']=isACGT['a']=isACGT['C']=isACGT['c']=1;
307 +  isACGT['G']=isACGT['g']=isACGT['T']=isACGT['t']=1;
308    s=args.getOpt('f');
309    if (!s.is_empty()) {
310 <   loadAdapters(s.chars());
310 >   loadAdaptors(s.chars());
311     }
312 <  bool fileAdapters=adapters.Count();
312 >  bool fileAdaptors=adaptors5.Count()+adaptors3.Count();
313    s=args.getOpt('5');
314    if (!s.is_empty()) {
315 <    if (fileAdapters)
315 >    if (fileAdaptors)
316        GError("Error: options -5 and -f cannot be used together!\n");
317      s.upper();
318 <    adapters.Add(new CAdapters(s.chars()));
318 >    addAdaptor(adaptors5, s, galn_TrimLeft);
319      }
320    s=args.getOpt('3');
321    if (!s.is_empty()) {
322 <    if (fileAdapters)
322 >    if (fileAdaptors)
323        GError("Error: options -3 and -f cannot be used together!\n");
324 <    s.upper();
325 <    if (adapters.Count()>0)
257 <          adapters[0]->a3=s.chars();
258 <     else adapters.Add(NULL, new CAdapters(s.chars()));
324 >      s.upper();
325 >      addAdaptor(adaptors3, s, galn_TrimRight);
326      }
327    s=args.getOpt('y');
328    if (!s.is_empty()) {
329       int minmatch=s.asInt();
330       poly_minScore=minmatch*poly_m_score;
331       }
332 <  
332 >
333    if (args.getOpt('o')!=NULL) outsuffix=args.getOpt('o');
334                           else outsuffix="-";
335    trashReport=  (args.getOpt('r')!=NULL);
# Line 279 | Line 346
346    if (trashReport)
347      openfw(freport, args, 'r');
348    char* infile=NULL;
349 +
350 +  if (adaptors5.Count()>0)
351 +    //gxmem_l=new CGreedyAlignData(match_reward, mismatch_penalty, Xdrop-2);
352 +        gxmem_l=new CGreedyAlignData(match_reward, mismatch_penalty, Xdrop);
353 +  if (adaptors3.Count()>0)
354 +    gxmem_r=new CGreedyAlignData(match_reward, mismatch_penalty, Xdrop);
355 +
356    while ((infile=args.nextNonOpt())!=NULL) {
357 +    //for each input file
358      int incounter=0; //counter for input reads
359      int outcounter=0; //counter for output reads
360      int trash_s=0; //too short from the get go
361      int trash_Q=0;
362      int trash_N=0;
363      int trash_D=0;
364 <    int trash_A3=0;
365 <    int trash_A5=0;
364 >    int trash_poly=0;
365 >    int trash_V=0;
366 >    num_trimN=0;
367 >    num_trimQ=0;
368 >    num_trimV=0;
369 >    num_trimA=0;
370 >    num_trimT=0;
371 >    num_trim5=0;
372 >    num_trim3=0;
373 >
374 >    b_totalIn=0;
375 >    b_totalN=0;
376 >    b_trimN=0;
377 >    b_trimQ=0;
378 >    b_trimV=0;
379 >    b_trimA=0;
380 >    b_trimT=0;
381 >    b_trim5=0;
382 >    b_trim3=0;
383 >
384      s=infile;
385      GStr infname;
386      GStr infname2;
# Line 310 | Line 403
403         int a5=0, a3=0, b5=0, b3=0;
404         char tcode=0, tcode2=0;
405         tcode=process_read(seqid, rseq, rqv, a5, a3);
406 <       //if (!doCollapse) {
407 <         if (fq2!=NULL) {
406 >       if (a5>0) {
407 >          b_trim5+=a5;
408 >          num_trim5++;
409 >          }
410 >       if (a3<rseq.length()-1) {
411 >          b_trim3+=rseq.length()-a3-1;
412 >          num_trim3++;
413 >          }
414 >       if (fq2!=NULL) {
415              getFastxRec(*fq2, rseq2, rqv2, seqid2, seqinfo2, infname2);
416              if (seqid.substr(0,seqid.length()-1)!=seqid2.substr(0,seqid2.length()-1)) {
417                 GError("Error: no paired match for read %s vs %s (%s,%s)\n",
418                    seqid.chars(), seqid2.chars(), infname.chars(), infname2.chars());
419                 }
420              tcode2=process_read(seqid2, rseq2, rqv2, b5, b3);
421 +            if (b5>0) {
422 +               b_trim5+=b5;
423 +               num_trim5++;
424 +               }
425 +            if (b3<rseq2.length()-1) {
426 +               b_trim3+=rseq2.length()-b3-1;
427 +               num_trim3++;
428 +               }
429              //decide what to do with this pair and print rseq2 if the pair makes it
430              if (tcode>1 && tcode2<=1) {
431                 //"untrash" rseq
# Line 343 | Line 451
451                 int nocounter=0;
452                 writeRead(f_out2, seqid2, seqinfo2, rseq2, rqv2, nocounter);
453                 }
454 <            } //paired read
347 <       // }
454 >            } //pair read
455         if (tcode>1) { //trashed
456 +         #ifdef GDEBUG
457 +         GMessage(" !!!!TRASH code = %c\n",tcode);
458 +         #endif
459            if (tcode=='s') trash_s++;
460 +          else if (tcode=='A' || tcode=='T') trash_poly++;
461              else if (tcode=='Q') trash_Q++;
462                else if (tcode=='N') trash_N++;
463                 else if (tcode=='D') trash_D++;
464 <                else if (tcode=='3') trash_A3++;
465 <                 else if (tcode=='5') trash_A5++;
464 >                else if (tcode=='V') trash_V++;
465 >                 //else if (tcode=='5') trash_A5++;
466            if (trashReport) trash_report(tcode, seqid, freport);
467            }
468           else if (!doCollapse) { //write it
# Line 359 | Line 470
470              rseq=rseq.substr(a5,a3-a5+1);
471              if (!rqv.is_empty()) rqv=rqv.substr(a5,a3-a5+1);
472              }
473 +         #ifdef GDEBUG
474 +            GMessage("  After trimming:\n");
475 +            GMessage("%s\n",rseq.chars());
476 +         #endif
477            writeRead(f_out, seqid, seqinfo, rseq, rqv, outcounter);
478            }
479         } //for each fastq record
# Line 386 | Line 501
501                 }
502              }
503           outcounter++;
504 <         if (qd->count>maxdup_count) {
504 >         if (qd->count>maxdup_count) {
505              maxdup_count=qd->count;
506              maxdup_seq=seq;
507              }
508           if (isfasta) {
509             if (prefix.is_empty()) {
510 <             fprintf(f_out, ">%s_x%d\n%s\n", qd->firstname, qd->count,
510 >             fprintf(f_out, ">%s_x%d\n%s\n", qd->firstname, qd->count,
511                             rseq.chars());
512               }
513             else { //use custom read name
# Line 403 | Line 518
518           else { //fastq format
519            if (convert_phred) convertPhred(qd->qv, qd->len);
520            if (prefix.is_empty()) {
521 <            fprintf(f_out, "@%s_x%d\n%s\n+\n%s\n", qd->firstname, qd->count,
521 >            fprintf(f_out, "@%s_x%d\n%s\n+\n%s\n", qd->firstname, qd->count,
522                             rseq.chars(), qd->qv);
523              }
524            else { //use custom read name
# Line 419 | Line 534
534      if (verbose) {
535         if (paired_reads) {
536             GMessage(">Input files : %s , %s\n", infname.chars(), infname2.chars());
537 <           GMessage("Number of input pairs :%9d\n", incounter);
538 <           GMessage("         Output pairs :%9d\n", outcounter);
537 >           GMessage("Number of input pairs :%9u\n", incounter);
538 >           GMessage("         Output pairs :%9u\t(%u trashed)\n", outcounter, incounter-outcounter);
539             }
540           else {
541             GMessage(">Input file : %s\n", infname.chars());
542             GMessage("Number of input reads :%9d\n", incounter);
543 <           GMessage("         Output reads :%9d\n", outcounter);
543 >           GMessage("         Output reads :%9d  (%u trashed)\n", outcounter, incounter-outcounter);
544             }
545 <       GMessage("------------------------------------\n");
546 <       if (num_trimmed5)
547 <          GMessage("           5' trimmed :%9d  (min. trim: %d)\n", num_trimmed5, min_trimmed5);
548 <       if (num_trimmed3)
549 <          GMessage("           3' trimmed :%9d  (min. trim: %d)\n", num_trimmed3, min_trimmed3);
545 >       GMessage("--------------- Read trimming: ------------------\n");
546 >       if (num_trim5)
547 >          GMessage("           5' trimmed :%9u\n", num_trim5);
548 >       if (num_trim3)
549 >          GMessage("           3' trimmed :%9u\n", num_trim3);
550 >       if (num_trimQ)
551 >          GMessage("         q.v. trimmed :%9u\n", num_trimQ);
552 >       if (num_trimN)
553 >          GMessage("            N trimmed :%9u\n", num_trimN);
554 >       if (num_trimT)
555 >          GMessage("       poly-T trimmed :%9u\n", num_trimT);
556 >       if (num_trimA)
557 >          GMessage("       poly-A trimmed :%9u\n", num_trimA);
558 >       if (num_trimV)
559 >          GMessage("      Adapter trimmed :%9u\n", num_trimV);
560         GMessage("------------------------------------\n");
561         if (trash_s>0)
562 <         GMessage("     Trashed by length:%9d\n", trash_s);
562 >         GMessage("Trashed by initial len:%9d\n", trash_s);
563         if (trash_N>0)
564           GMessage("         Trashed by N%%:%9d\n", trash_N);
565         if (trash_Q>0)
566           GMessage("Trashed by low quality:%9d\n", trash_Q);
567 <       if (trash_A5>0)
568 <         GMessage(" Trashed by 5' adapter:%9d\n", trash_A5);
569 <       if (trash_A3>0)
570 <         GMessage(" Trashed by 3' adapter:%9d\n", trash_A3);
567 >       if (trash_poly>0)
568 >         GMessage("   Trashed by poly-A/T:%9d\n", trash_poly);
569 >       if (trash_V>0)
570 >         GMessage("    Trashed by adaptor:%9d\n", trash_V);
571 >       GMessage("\n--------------- Base counts  --------------------\n");
572 >       GMessage("    Input bases   :%12llu\n", b_totalIn);
573 >       double percN=100.0* ((double)b_totalN/(double)b_totalIn);
574 >       GMessage("          N bases :%12llu (%4.2f%%)\n", b_totalN, percN);
575 >       GMessage("   trimmed from 5':%12llu\n", b_trim5);
576 >       GMessage("   trimmed from 3':%12llu\n", b_trim3);
577 >       GMessage("\n");
578 >       if (b_trimQ)
579 >       GMessage("     q.v. trimmed :%12llu\n", b_trimQ);
580 >       if (b_trimN)
581 >       GMessage("        N trimmed :%12llu\n", b_trimN);
582 >       if (b_trimT)
583 >       GMessage("   poly-T trimmed :%12llu\n", b_trimT);
584 >       if (b_trimA)
585 >       GMessage("   poly-A trimmed :%12llu\n", b_trimA);
586 >       if (b_trimV)
587 >       GMessage("  Adapter trimmed :%12llu\n", b_trimV);
588 >
589         }
590      if (trashReport) {
591            FWCLOSE(freport);
# Line 450 | Line 593
593      FWCLOSE(f_out);
594      FWCLOSE(f_out2);
595     } //while each input file
596 <
596 > delete gxmem_l;
597 > delete gxmem_r;
598   //getc(stdin);
599   }
# Line 465 | Line 609
609     const char* seq;
610     bool valid;
611     NData() {
612 +    seqlen=0;
613      NCount=0;
614      end5=0;
615      end3=0;
# Line 495 | Line 640
640       perc_N=(n*100.0)/(end5-end3+1);
641       }
642   };
643 <
643 >
644   static NData feat;
645   int perc_lenN=12; // incremental distance from ends, in percentage of
646            // sequence length, where N-trimming is done (default:12 %) (autolimited to 20)
647 <          
647 >
648   void N_analyze(int l5, int l3, int p5, int p3) {
649   /* assumes feat was filled properly */
650   int old_dif, t5,t3,v;
651   if (l3<l5+2 || p5>p3 ) {
652     feat.end5=l5+1;
653     feat.end3=l3+1;
654 <   return;
654 >   return;
655     }
657   t5=feat.NPos[p5]-l5;
658   t3=l3-feat.NPos[p3];
659   old_dif=p3-p5;
660   v=(int)((((double)(l3-l5))*perc_lenN)/100);
661 < if (v>20) v=20; /* enforce N-search limit for very long reads */
661 > if (v>20) v=20; /* enforce N-search limit for very long reads */
662   if (t5 < v ) {
663     l5=feat.NPos[p5]+1;
664     p5++;
# Line 530 | Line 675
675             feat.end3=l3+1;
676             return;
677             }
678 <    else
678 >    else
679        N_analyze(l5,l3, p5,p3);
680   }
# Line 571 | Line 716
716   feat.init(rseq);
717   l5=feat.end5-1;
718   l3=feat.end3-1;
719 < N_analyze(feat.end5-1, feat.end3-1, 0, feat.NCount-1);
719 > N_analyze(feat.end5-1, feat.end3-1, 0, feat.NCount-1);
720   if (l5==feat.end5-1 && l3==feat.end3-1) {
721      if (feat.perc_N>max_perc_N) {
722             feat.valid=false;
# Line 589 | Line 734
734     return true;
735     }
736   feat.N_calc();
737 <
737 >
738   if (feat.perc_N>max_perc_N) {
739        feat.valid=false;
740        l3=l5+1;
# Line 601 | Line 746
746   //--------------- dust functions ----------------
747   class DNADuster {
748   public:
749 <  int dustword;
750 <  int dustwindow;
751 <  int dustwindow2;
749 >  int dustword;
750 >  int dustwindow;
751 >  int dustwindow2;
752    int dustcutoff;
753    int mv, iv, jv;
754    int counts[32*32*32];
# Line 698 | Line 843
843                      }
844             }
845           }
846 < //return first;
846 > //return first;
847   }
848   };
# Line 716 | Line 861
861   return ncount;
862   }
719 int get3mer_value(const char* s) {
720 return (s[0]<<16)+(s[1]<<8)+s[2];
721 }
723 int w3_match(int qv, const char* str, int slen, int start_index=0) {
724 if (start_index>=slen || start_index<0) return -1;
725 for (int i=start_index;i<slen-3;i++) {
726   int rv=get3mer_value(str+i);
727   if (rv==qv) return i;
728   }
729 return -1;
730 }
732 int w3_rmatch(int qv, const char* str, int slen, int end_index=-1) {
733 if (end_index>=slen) return -1;
734 if (end_index<0) end_index=slen-1;
735 for (int i=end_index-2;i>=0;i--) {
736   int rv=get3mer_value(str+i);
737   if (rv==qv) return i;
738   }
739 return -1;
740 }
864   struct SLocScore {
865    int pos;
866    int score;
# Line 757 | Line 879
879   };
881   bool trim_poly3(GStr &seq, int &l5, int &l3, const char* poly_seed) {
882 + if (!doPolyTrim) return false;
883   int rlen=seq.length();
884   l5=0;
885   l3=rlen-1;
# Line 765 | Line 888
888   //assumes N trimming was already done
889   //so a poly match should be very close to the end of the read
890   // -- find the initial match (seed)
891 < int lmin=GMAX((rlen-12), 0);
891 > int lmin=GMAX((rlen-16), 0);
892   int li;
893   for (li=rlen-4;li>lmin;li--) {
894     if (seedVal==*(int*)&(seq[li])) {
# Line 779 | Line 902
902   SLocScore loc(ri, poly_m_score<<2);
903   SLocScore maxloc(loc);
904   //extend right
905 < while (ri<rlen-2) {
905 > while (ri<rlen-1) {
906     ri++;
907     if (seq[ri]==polyChar) {
908                  loc.add(ri,poly_m_score);
# Line 796 | Line 919
919        }
920     }
921   ri=maxloc.pos;
922 < if (ri<rlen-3) return false; //no trimming wanted, too far from 3' end
922 > if (ri<rlen-6) return false; //no trimming wanted, too far from 3' end
923   //ri = right boundary for the poly match
924   //extend left
925   loc.set(li, maxloc.score);
# Line 817 | Line 940
940         maxloc=loc;
941         }
942      }
943 < if (maxloc.score>poly_minScore && ri>=rlen-3) {
944 <    l5=li;
945 <    l3=ri;
943 > li=maxloc.pos;
944 > if ((maxloc.score==poly_minScore && ri==rlen-1) ||
945 >    (maxloc.score>poly_minScore && ri>=rlen-3) ||
946 >    (maxloc.score>(poly_minScore*3) && ri>=rlen-8)) {
947 >  //trimming this li-ri match at 3' end
948 >    l3=li-1;
949 >    if (l3<0) l3=0;
950      return true;
951      }
952   return false;
953   }
955   bool trim_poly5(GStr &seq, int &l5, int &l3, const char* poly_seed) {
956 + if (!doPolyTrim) return false;
957   int rlen=seq.length();
958   l5=0;
959   l3=rlen-1;
# Line 835 | Line 962
962   //assumes N trimming was already done
963   //so a poly match should be very close to the end of the read
964   // -- find the initial match (seed)
965 < int lmax=GMIN(8, rlen-4);//how far from 5' end to look for 4-mer seeds
965 > int lmax=GMIN(12, rlen-4);//how far from 5' end to look for 4-mer seeds
966   int li;
967   for (li=0;li<=lmax;li++) {
968     if (seedVal==*(int*)&(seq[li])) {
# Line 865 | Line 992
992         }
993      }
994   li=maxloc.pos;
995 < if (li>3) return false; //no trimming wanted, too far from 5' end
995 > if (li>5) return false; //no trimming wanted, too far from 5' end
996   //li = right boundary for the poly match
998   //extend right
999   loc.set(ri, maxloc.score);
1000   maxloc.pos=ri;
1001 < while (ri<rlen-2) {
1001 > while (ri<rlen-1) {
1002     ri++;
1003     if (seq[ri]==polyChar) {
1004                  loc.add(ri,poly_m_score);
# Line 887 | Line 1014
1014        maxloc=loc;
1015        }
1016     }
1017 <
1018 < if (maxloc.score>poly_minScore && li<=3) {
1019 <    l5=li;
1020 <    l3=ri;
1017 > ri=maxloc.pos;
1018 > if ((maxloc.score==poly_minScore && li==0) ||
1019 >     (maxloc.score>poly_minScore && li<2)
1020 >     || (maxloc.score>(poly_minScore*3) && li<8)) {
1021 >    //adjust l5 to reflect this trimming of 5' end
1022 >    l5=ri+1;
1023 >    if (l5>rlen-1) l5=rlen-1;
1024      return true;
1025      }
1026   return false;
1027   }
1029 < bool trim_adapter3(GStr& seq, int&l5, int &l3) {
1029 > bool trim_adaptor3(GStr& seq, int&l5, int &l3) {
1030 > if (adaptors3.Count()==0) return false;
1031   int rlen=seq.length();
1032   l5=0;
1033   l3=rlen-1;
1034 < //first try a full match, we might get lucky
1035 < int fi=-1;
1036 < if ((fi=seq.index(adapter3))>=0) {
1037 <   if (fi<rlen-fi-a3len) {//match is closer to the right end
1038 <      l5=fi+a3len;
1039 <      l3=rlen-1;
1040 <      }
1041 <    else {
1042 <      l5=0;
1043 <      l3=fi-1;
1044 <      }
914 <   return true;
915 <   }
916 < #ifdef DEBUG
917 < if (debug) GMessage(">TRIM3 >>   Read: %s\n",seq.chars());
918 < #endif
919 <
920 < //also, for fast detection of other adapter-only reads that start past
921 < // the beginning of the adapter sequence, try to see if the first a3len-4
922 < // bases of the read are a substring of the adapter
923 < if (rlen>a3len-3) {
924 <   GStr rstart=seq.substr(1,a3len-4);
925 <   if ((fi=adapter3.index(rstart))>=0) {
926 <     l3=rlen-1;
927 <     l5=a3len-4;
928 <     while (fi+l5<a3len && l5<l3 && adapter3[fi+l5]==seq[l5]) l5++;
929 <     return true;
930 <     }
931 <  }
932 < CSegChain a3segs; //no chains here, just an ordered collection of segment pairs
933 <  //check the easy cases - 11 bases exact match at the end
934 < int fdlen=11;
935 <  if (a3len<16) {
936 <   fdlen=a3len>>1;
937 <   }
938 < if (fdlen>4) {
939 <     //check if we're lucky enough to have the last 11 bases of the read a part of the adapter
940 <     GStr rstart=seq.substr(-fdlen-3,fdlen);
941 <     if ((fi=adapter3.index(rstart))>=0) {
942 < #ifdef DEBUG
943 <       if (debug) GMessage("  W11match found: %*s\n", rlen-3, (adapter3.substr(fi,fdlen)).chars());
944 < #endif
945 <       if (extendMatch(seq.chars(), rlen, rlen-fdlen-3,
946 <                     adapter3.chars(), a3len, fi,  fdlen, l5,l3, a3segs))
947 <            return true;
948 <       }
949 <     //another easy case: first 11 characters of the adaptor found as a substring of the read
950 <     GStr bstr=adapter3.substr(0, fdlen);
951 <     if ((fi=seq.rindex(bstr))>=0) {
952 < #ifdef DEBUG
953 <       if (debug) GMessage("  A11match found: %*s\n", fi+fdlen, bstr.chars());
954 < #endif
955 <       if (extendMatch(seq.chars(), rlen, fi,
956 <                     adapter3.chars(), a3len, 0,  fdlen, l5,l3, a3segs))
957 <            return true;
958 <       }
959 <     } //tried to match 11 bases first
960 <    
961 < //no easy cases, so let's do the wmer hashing for the first 12 bases of the adaptor
962 < //-- only extend if the match is in the 3' (ending) region of the read
963 < int wordSize=3;
964 < int hlen=12;
965 < if (hlen>a3len-wordSize) hlen=a3len-wordSize;
966 < int imin=rlen>>1; //last half of the read, left boundary for the wmer match
967 < if (imin<a3len) { imin=GMIN(a3len, rlen-wordSize); }
968 < imin=rlen-imin;
969 < for (int iw=0;iw<hlen;iw++) {
970 <   //int32* qv=(int32*)(adapter3.chars()+iw);
971 <   int qv=get3mer_value(adapter3.chars()+iw);
972 <   fi=-1;
973 <   //while ((fi=fast4rmatch(*qv, seq.chars(), rlen, fi))>=0 && fi>=imin) {
974 <   while ((fi=w3_rmatch(qv, seq.chars(), rlen, fi))>=0 && fi>=imin) {
975 <     //GMessage(" ... fi=%d after w3_rmatch() (imin=%d)\n", fi, imin);
976 <
977 < #ifdef DEBUG
978 <     if (debug) GMessage("    Wmatch found: %*s\n", fi+wordSize, (adapter3.substr(iw,wordSize)).chars());
979 < #endif
980 <     if (extendMatch(seq.chars(), rlen, fi, adapter3.chars(),
981 <                   a3len, iw, wordSize, l5,l3, a3segs)) return true;
982 <     fi--;
983 <     if (fi<imin) break;
984 <     }
985 <   } //for each wmer in the first hlen bases of the adaptor
986 < /*
987 < //couldn't find a good trimming extension, hash 12 more bases of the adapter to collect more segment pairs there
988 < //but only do this if we already have segment pairs collected in the last 12 bases of the adapter
989 < if (a3segs.bstart>3 || a3segs.bend<(uint)(hlen-wordSize)) return false;
990 < int hlen2=a3len-wordSize;
991 < //if (hlen2>a3len-4) hlen2=a3len-4;
992 < if (hlen2>hlen) {
993 < #ifdef DEBUG
994 <     if (debug && a3segs.Count()>0) {
995 <        GMessage("  >>>>>2nd. hash: %s\n",seq.chars());
1034 > bool trimmed=false;
1035 > GStr wseq(seq);
1036 > int wlen=rlen;
1037 > GXSeqData seqdata;
1038 > int numruns=revCompl ? 2 : 1;
1039 > GList<GXAlnInfo> bestalns(true, true, false);
1040 > for (int ai=0;ai<adaptors3.Count();ai++) {
1041 >   for (int r=0;r<numruns;r++) {
1042 >     if (r) {
1043 >          seqdata.update(adaptors3[ai].seqr.chars(), adaptors3[ai].seqr.length(),
1044 >                 adaptors3[ai].pzr, wseq.chars(), wlen, adaptors3[ai].amlen);
1045          }
1046 < #endif
1047 <     for (int iw=hlen;iw<hlen2;iw++) {
1048 <         //int* qv=(int32 *)(adapter3.chars()+iw);
1049 <         int qv=get3mer_value(adapter3.chars()+iw);
1050 <         fi=-1;
1051 <         //while ((fi=fast4rmatch(*qv, seq.chars(), rlen, fi))>=0 && fi>=imin) {
1052 <         while ((fi=w3_rmatch(qv, seq.chars(), rlen, fi))>=0 && fi>=imin) {
1053 <           extendMatch(seq.chars(), rlen, fi, adapter3.chars(),
1054 <                         a3len, iw, wordSize, l5,l3, a3segs);
1055 <           fi--;
1056 <           if (fi<imin) break;
1057 <           }
1058 <         } //for each wmer between hlen2 and hlen bases of the adaptor
1046 >     else {
1047 >            seqdata.update(adaptors3[ai].seq.chars(), adaptors3[ai].seq.length(),
1048 >                 adaptors3[ai].pz, wseq.chars(), wlen, adaptors3[ai].amlen);
1049 >        }
1050 >     GXAlnInfo* aln=match_adaptor(seqdata, adaptors3[ai].trim_type, gxmem_r, 86);
1051 >         if (aln) {
1052 >           if (aln->strong) {
1053 >                   trimmed=true;
1054 >                   bestalns.Add(aln);
1055 >                   break; //will check the rest next time
1056 >                   }
1057 >            else bestalns.Add(aln);
1058 >           }
1059 >   }//forward and reverse adaptors
1060 >   if (trimmed) break; //will check the rest in the next cycle
1061 >  }//for each 3' adaptor
1062 > if (bestalns.Count()>0) {
1063 >           GXAlnInfo* aln=bestalns[0];
1064 >           if (aln->sl-1 > wlen-aln->sr) {
1065 >                   //keep left side
1066 >                   l3-=(wlen-aln->sl+1);
1067 >                   if (l3<0) l3=0;
1068 >                   }
1069 >           else { //keep right side
1070 >                   l5+=aln->sr;
1071 >                   if (l5>=rlen) l5=rlen-1;
1072 >                   }
1073 >           //delete aln;
1074 >           //if (l3-l5+1<min_read_len) return true;
1075 >           wseq=seq.substr(l5,l3-l5+1);
1076 >           wlen=wseq.length();
1077 >           return true; //break the loops here to report a good find
1078       }
1079 < //lastly, analyze collected a3segs for a possible gapped alignment:
1012 < GList<CSegChain> segchains(false,true,false);
1013 < #ifdef DEBUG
1014 < if (debug && a3segs.Count()>0) {
1015 <   GMessage(">>>>>>>>>   Read: %s\n",seq.chars());
1016 <   }
1017 < #endif
1018 < for (int i=0;i<a3segs.Count();i++) {
1019 <   if (a3segs[i]->chain==NULL) {
1020 <       if (a3segs[i]->b.start>3) continue; //don't start a hopeless chain
1021 <       CSegChain* newchain=new CSegChain();
1022 <       newchain->setFreeItem(false);
1023 <       newchain->addSegPair(a3segs[i]);
1024 <       a3segs[i]->chain=newchain;
1025 <       segchains.Add(newchain); //just to free them when done
1026 <       }
1027 <   for (int j=i+1;j<a3segs.Count();j++) {
1028 <      CSegChain* chain=a3segs[i]->chain;
1029 <      if (chain->extendChain(a3segs[j])) {
1030 <          a3segs[j]->chain=chain;
1031 < #ifdef DEBUG
1032 <          if (debug) dbgPrintChain(*chain, adapter3.chars());
1033 < #endif      
1034 <          //save time by checking here if the extended chain is already acceptable for trimming
1035 <          if (chain->aend>(uint)(rlen-4) && chain->bstart<4 && chain->score>a_min_chain_score) {
1036 <            l5=0;
1037 <            l3=chain->astart-2;
1038 < #ifdef DEBUG
1039 <          if (debug && a3segs.Count()>0) {
1040 <            GMessage(">>> >> trimmed-3: %*s\n",l3-l5+1,seq.substr(l5,l3-l5+1).chars());
1041 <            }
1042 < #endif
1043 <            return true;
1044 <            }
1045 <          } //chain can be extended
1046 <      }
1047 <   } //collect segment alignments into chains
1048 < */  
1049 < return false; //no adapter parts found
1079 >  return false;
1080   }
1082 < bool trim_adapter5(GStr& seq, int&l5, int &l3) {
1083 < //if (debug) GMessage("trim_adapter5 on: %s\n", seq.chars());
1082 > bool trim_adaptor5(GStr& seq, int&l5, int &l3) {
1083 > if (adaptors5.Count()==0) return false;
1084   int rlen=seq.length();
1085   l5=0;
1086   l3=rlen-1;
1087 < //try to see if adapter is fully included in the read
1088 < int fi=-1;
1089 < for (int ai=0;ai<adapters.Count();ai++) {
1090 <  if (adapters[ai]->a5.is_empty()) continue;
1091 <  int a5len=adapters[ai]->a5.length();
1092 <  GStr& adapter5=adapters[ai]->a5;
1093 <  if ((fi=seq.index(adapter5))>=0) {
1094 <    if (fi<rlen-fi-a5len) {//match is closer to the right end
1095 <       l5=fi+a5len;
1096 <       l3=rlen-1;
1097 <       }
1068 <     else {
1069 <       l5=0;
1070 <       l3=fi-1;
1071 <       }
1072 <    return true;
1073 <    }
1074 < #ifdef DEBUG
1075 <  if (debug) GMessage(">TRIM5 >>   Read: %s\n",seq.chars());
1076 < #endif
1077 <
1078 <  //try the easy way out first - look for an exact match of 11 bases
1079 <  int fdlen=11;
1080 <   if (a5len<16) {
1081 <    fdlen=a5len>>1;
1082 <    }
1083 <  if (fdlen>4) {
1084 <      GStr rstart=seq.substr(1,fdlen); //skip the first base as it's sometimes bogus
1085 <      if ((fi=adapter5.index(rstart))>=0) {
1086 < #ifdef DEBUG
1087 <        if (debug) GMessage("  W11match found: %*s\n", 1+fdlen, (adapter3.substr(fi,fdlen)).chars());
1088 < #endif
1089 <        if (extendMatch(seq.chars(), rlen, 1,
1090 <                      adapter5.chars(), a5len, fi,  fdlen, l5,l3, a5segs, true))
1091 <            return true;
1087 > bool trimmed=false;
1088 > GStr wseq(seq);
1089 > int wlen=rlen;
1090 > GXSeqData seqdata;
1091 > int numruns=revCompl ? 2 : 1;
1092 > GList<GXAlnInfo> bestalns(true, true, false);
1093 > for (int ai=0;ai<adaptors5.Count();ai++) {
1094 >   for (int r=0;r<numruns;r++) {
1095 >     if (r) {
1096 >          seqdata.update(adaptors5[ai].seqr.chars(), adaptors5[ai].seqr.length(),
1097 >                 adaptors5[ai].pzr, wseq.chars(), wlen, adaptors5[ai].amlen);
1098          }
1099 <      //another easy case: last 11 characters of the adaptor found as a substring of the read
1100 <      GStr bstr=adapter5.substr(-fdlen);
1101 <      if ((fi=seq.index(bstr))>=0) {
1096 < #ifdef DEBUG
1097 <        if (debug) GMessage("  A11match found: %*s\n", fi+fdlen, bstr.chars());
1098 < #endif
1099 <        if (extendMatch(seq.chars(), rlen, fi,
1100 <                      adapter5.chars(), a5len, a5len-fdlen,  fdlen, l5,l3,a5segs,true))
1101 <           return true;
1099 >     else {
1100 >            seqdata.update(adaptors5[ai].seq.chars(), adaptors5[ai].seq.length(),
1101 >                 adaptors5[ai].pz, wseq.chars(), wlen, adaptors5[ai].amlen);
1102          }
1103 <      } //tried to matching at most 11 bases first
1104 <
1105 <  //-- no easy cases, do the wmer hashing for the last 12 bases of the adaptor
1106 <  //-- only extend a wmer if it matches in the 5' (beginning) region of the read
1107 <  int wordSize=3;
1108 <  int hlen=12;
1109 <  if (hlen>a5len-wordSize) hlen=a5len-wordSize;
1110 <  int imax=rlen>>1; //first half of the read, right boundary for the wmer match
1111 <  if (imax<a5len) { imax=GMIN(a5len, rlen-wordSize); }
1112 <  for (int iw=0;iw<=hlen;iw++) {
1113 <    int apstart=a5len-iw-wordSize;
1114 <    fi=0;
1115 <    //int* qv=(int32 *)(adapter5.chars()+apstart);
1116 <    int qv=get3mer_value(adapter5.chars()+apstart);
1117 <    //while ((fi=fast4match(*qv, seq.chars(), rlen, fi))>=0 && fi<=imax) {
1118 <    while ((fi=w3_match(qv, seq.chars(), rlen, fi))>=0 && fi<=imax) {
1119 < #ifdef DEBUG
1120 <      if (debug) GMessage("    Wmatch found: %*s\n", fi+wordSize, (adapter5.substr(apstart,wordSize)).chars());
1121 < #endif
1122 <      if (extendMatch(seq.chars(), rlen, fi, adapter5.chars(),
1123 <                 a5len, apstart, wordSize, l5,l3, a5segs, true)) return true;
1124 <      fi++;
1125 <      if (fi>imax) break;
1126 <      }
1127 <    } //for each wmer in the last hlen bases of the adaptor
1128 < //if we're here we couldn't find a good extension
1129 <  return false; //no adapter parts found
1130 < }//for each 5' adapter
1103 >         GXAlnInfo* aln=match_adaptor(seqdata, adaptors5[ai].trim_type, gxmem_l, 90);
1104 >         if (aln) {
1105 >           if (aln->strong) {
1106 >                   trimmed=true;
1107 >                   bestalns.Add(aln);
1108 >                   break; //will check the rest next time
1109 >                   }
1110 >            else bestalns.Add(aln);
1111 >           }
1112 >         } //forward and reverse?
1113 >   if (trimmed) break; //will check the rest in the next cycle
1114 >  }//for each 5' adaptor
1115 >  if (bestalns.Count()>0) {
1116 >           GXAlnInfo* aln=bestalns[0];
1117 >           if (aln->sl-1 > wlen-aln->sr) {
1118 >                   //keep left side
1119 >                   l3-=(wlen-aln->sl+1);
1120 >                   if (l3<0) l3=0;
1121 >                   }
1122 >           else { //keep right side
1123 >                   l5+=aln->sr;
1124 >                   if (l5>=rlen) l5=rlen-1;
1125 >                   }
1126 >           //delete aln;
1127 >           //if (l3-l5+1<min_read_len) return true;
1128 >           wseq=seq.substr(l5,l3-l5+1);
1129 >           wlen=wseq.length();
1130 >           return true; //break the loops here to report a good find
1131 >     }
1132 >  return false;
1133   }
1135 < //convert qvs to/from phred64 from/to phread33
1135 > //convert qvs to/from phred64 from/to phread33
1136   void convertPhred(GStr& q) {
1137   for (int i=0;i<q.length();i++) q[i]+=qv_cvtadd;
1138   }
# Line 1139 | Line 1141
1141   for (int i=0;i<len;i++) q[i]+=qv_cvtadd;
1142   }
1144 < bool getFastxRec(GLineReader& fq, GStr& rseq, GStr& rqv,
1144 > bool getFastxRec(GLineReader& fq, GStr& rseq, GStr& rqv,
1145            GStr& rname, GStr& rinfo, GStr& infname) {
1146   rseq="";
1147   rqv="";
# Line 1155 | Line 1157
1157        } //raw qseq format
1158   else { // FASTQ or FASTA */
1159   isfasta=(l[0]=='>');
1160 < if (!isfasta && l[0]!='@') GError("Error: fasta/fastq record marker not found(%s)\n%s\n",
1160 > if (!isfasta && l[0]!='@') GError("Error: fasta/fastq record marker not found(%s)\n%s\n",
1161        infname.chars(), l);
1162   GStr s(l);
1163   rname=&(l[1]);
1164   for (int i=0;i<rname.length();i++)
1165 <    if (rname[i]<=' ') {
1166 <       if (i<rname.length()-2) rinfo=rname.substr(i+1);
1167 <       rname.cut(i);
1168 <       break;
1165 >    if (rname[i]<=' ') {
1166 >       if (i<rname.length()-2) rinfo=rname.substr(i+1);
1167 >       rname.cut(i);
1168 >       break;
1169         }
1170    //now get the sequence
1171 < if ((l=fq.getLine())==NULL)
1171 > if ((l=fq.getLine())==NULL)
1172        GError("Error: unexpected EOF after header for read %s (%s)\n",
1173                     rname.chars(), infname.chars());
1174   rseq=l; //this must be the DNA line
1175   while ((l=fq.getLine())!=NULL) {
1176        //seq can span multiple lines
1177        if (l[0]=='>' || l[0]=='+') {
1178 <           fq.pushBack();
1178 >           fq.pushBack();
1179             break; //
1180             }
1181        rseq+=l;
1182 <      } //check for multi-line seq
1182 >      } //check for multi-line seq
1183   if (!isfasta) { //reading fastq quality values, which can also be multi-line
1184      if ((l=fq.getLine())==NULL)
1185          GError("Error: unexpected EOF after sequence for %s\n", rname.chars());
1186      if (l[0]!='+') GError("Error: fastq qv header marker not detected!\n");
1187 <    if ((l=fq.getLine())==NULL)
1187 >    if ((l=fq.getLine())==NULL)
1188          GError("Error: unexpected EOF after qv header for %s\n", rname.chars());
1189      rqv=l;
1190 <    //if (rqv.length()!=rseq.length())
1190 >    //if (rqv.length()!=rseq.length())
1191      //  GError("Error: qv len != seq len for %s\n", rname.chars());
1192      while (rqv.length()<rseq.length() && ((l=fq.getLine())!=NULL)) {
1193        rqv+=l; //append to qv string
# Line 1196 | Line 1198
1198   return true;
1199   }
1201 + #ifdef GDEBUG
1202 + void showTrim(GStr& s, int l5, int l3) {
1203 +  if (l5>0 || l3==0) {
1204 +    color_bg(c_red);
1205 +    }
1206 +  for (int i=0;i<s.length()-1;i++) {
1207 +    if (i && i==l5) color_resetbg();
1208 +    fprintf(stderr, "%c", s[i]);
1209 +    if (i && i==l3) color_bg(c_red);
1210 +   }
1211 +  fprintf(stderr, "%c", s[s.length()-1]);
1212 +  color_reset();
1213 +  fprintf(stderr, "\n");
1214 + }
1215 + #endif
1216 +
1217   char process_read(GStr& rname, GStr& rseq, GStr& rqv, int &l5, int &l3) {
1218 < //returns 0 if the read was untouched, 1 if it was just trimmed
1218 > //returns 0 if the read was untouched, 1 if it was just trimmed
1219   // and a trash code if it was trashed
1220   l5=0;
1221   l3=rseq.length()-1;
1222 + #ifdef GDEBUG
1223 +   //rseq.reverse();
1224 +   GMessage(">%s\n", rname.chars());
1225 +   GMessage("%s\n",rseq.chars());
1226 + #endif
1227   if (l3-l5+1<min_read_len) {
1228     return 's';
1229     }
# Line 1208 | Line 1231
1231   GStr wqv(rqv.chars());
1232   int w5=l5;
1233   int w3=l3;
1234 + //count Ns
1235 + b_totalIn+=rseq.length();
1236 + for (int i=0;i<rseq.length();i++) {
1237 + if (isACGT[(int)rseq[i]]==0) b_totalN++;
1238 + }
1239 +
1240   //first do the q-based trimming
1241   if (qvtrim_qmin!=0 && !wqv.is_empty() && qtrim(wqv, w5, w3)) { // qv-threshold trimming
1242 +   b_trimQ+=(w5-l5)+(l3-w3);
1243 +   num_trimQ++;
1244     if (w3-w5+1<min_read_len) {
1245       return 'Q'; //invalid read
1246       }
# Line 1222 | Line 1253
1253     } //qv trimming
1254   // N-trimming on the remaining read seq
1255   if (ntrim(wseq, w5, w3)) {
1256 +   //Note: ntrim resets w5 and w3
1257     //GMessage("before: %s\n",wseq.chars());
1258     //GMessage("after : %s (%d)\n",wseq.substr(w5,w3-w5+1).chars(),w3-w5+1);
1259 +   int trim3=(wseq.length()-1-w3);
1260 +   b_trimN+=w5+trim3;
1261 +   num_trimN++;
1262     l5+=w5;
1263 <   l3-=(wseq.length()-1-w3);
1263 >   l3-=trim3;
1264     if (w3-w5+1<min_read_len) {
1265       return 'N'; //to be trashed
1266       }
# Line 1236 | Line 1271
1271     w5=0;
1272     w3=wseq.length()-1;
1273     }
1274 < if (a3len>0) {
1275 <  if (trim_adapter3(wseq, w5, w3)) {
1276 <     int trimlen=wseq.length()-(w3-w5+1);
1277 <     num_trimmed3++;
1278 <     if (trimlen<min_trimmed3)
1279 <         min_trimmed3=trimlen;
1280 <     l5+=w5;
1281 <     l3-=(wseq.length()-1-w3);
1282 <     if (w3-w5+1<min_read_len) {
1283 <         return '3';
1284 <         }
1285 <      //-- keep only the w5..w3 range
1286 <      wseq=wseq.substr(w5, w3-w5+1);
1287 <      if (!wqv.is_empty())
1288 <         wqv=wqv.substr(w5, w3-w5+1);
1289 <      }//some adapter was trimmed
1290 <   } //adapter trimming
1291 < if (a5len>0) {
1292 <  if (trim_adapter5(wseq, w5, w3)) {
1293 <     int trimlen=wseq.length()-(w3-w5+1);
1294 <     num_trimmed5++;
1295 <     if (trimlen<min_trimmed5)
1296 <         min_trimmed5=trimlen;
1274 > char trim_code;
1275 > //clean the more dirty end first - 3'
1276 > bool trimmedA=false;
1277 > bool trimmedT=false;
1278 > bool trimmedV=false;
1279 >
1280 > int prev_w5=0;
1281 > int prev_w3=0;
1282 > bool w3upd=true;
1283 > bool w5upd=true;
1284 > do {
1285 >  trim_code=0;
1286 >  if (w3upd && trim_poly3(wseq, w5, w3, polyA_seed)) {
1287 >      trim_code='A';
1288 >      b_trimA+=(w5+(wseq.length()-1-w3));
1289 >      if (!trimmedA) { num_trimA++; trimmedA=true; }
1290 >      }
1291 >  else if (w3upd && trim_poly3(wseq, w5, w3, polyT_seed)) {
1292 >      trim_code='T';
1293 >      b_trimT+=(w5+(wseq.length()-1-w3));
1294 >      if (!trimmedT) { num_trimT++; trimmedT=true; }
1295 >      }
1296 >  else if (w5upd && trim_poly5(wseq, w5, w3, polyA_seed)) {
1297 >      trim_code='A';
1298 >      b_trimA+=(w5+(wseq.length()-1-w3));
1299 >      if (!trimmedA) { num_trimA++; trimmedA=true; }
1300 >      }
1301 >  else if (w5upd && trim_poly5(wseq, w5, w3, polyT_seed)) {
1302 >      trim_code='T';
1303 >      b_trimT+=(w5+(wseq.length()-1-w3));
1304 >      if (!trimmedT) { num_trimT++; trimmedT=true; }
1305 >      }
1306 >  else if (trim_adaptor5(wseq, w5, w3)) {
1307 >      trim_code='V';
1308 >      b_trimV+=(w5+(wseq.length()-1-w3));
1309 >      if (!trimmedV) { num_trimV++; trimmedV=true; }
1310 >      }
1311 >  else if (trim_adaptor3(wseq, w5, w3)) {
1312 >      trim_code='V';
1313 >      b_trimV+=(w5+(wseq.length()-1-w3));
1314 >      if (!trimmedV) { num_trimV++; trimmedV=true; }
1315 >      }
1316 >  if (trim_code) {
1317 >     w3upd=(w3!=prev_w3);
1318 >         w5upd=(w5!=prev_w5);
1319 >         if (w3upd) prev_w3=w3;
1320 >         if (w5upd) prev_w5=w5;
1321 >   #ifdef GDEBUG
1322 >     GMessage("#### TRIM by '%c' code ( w5-w3 = %d-%d ):\n",trim_code, w5,w3);
1323 >     showTrim(wseq, w5, w3);
1324 >   #endif
1325 >     //int trimlen=wseq.length()-(w3-w5+1);
1326       l5+=w5;
1327       l3-=(wseq.length()-1-w3);
1328       if (w3-w5+1<min_read_len) {
1329 <         return '5';
1329 >         return trim_code;
1330           }
1331        //-- keep only the w5..w3 range
1332        wseq=wseq.substr(w5, w3-w5+1);
1333        if (!wqv.is_empty())
1334           wqv=wqv.substr(w5, w3-w5+1);
1335 <      }//some adapter was trimmed
1336 <   } //adapter trimming
1335 >      }//trimming at 3' end
1336 > } while (trim_code);
1337   if (doCollapse) {
1338     //keep read for later
1339     FqDupRec* dr=dhash.Find(wseq.chars());
1340     if (dr==NULL) { //new entry
1341 <          //if (prefix.is_empty())
1342 <             dhash.Add(wseq.chars(),
1341 >          //if (prefix.is_empty())
1342 >             dhash.Add(wseq.chars(),
1343                    new FqDupRec(&wqv, rname.chars()));
1344            //else dhash.Add(wseq.chars(), new FqDupRec(wqv.chars(),wqv.length()));
1345           }
# Line 1309 | Line 1373
1373         fprintf(f_out, "%s\n", rseq.chars()); //plain one-line fasta for now
1374         }
1375        else {
1376 <       fprintf(f_out, ">%s%08d\n%s\n", prefix.chars(), outcounter,
1376 >       fprintf(f_out, ">%s%08d\n%s\n", prefix.chars(), outcounter,
1377                            rseq.chars());
1378         }
1379       }
# Line 1320 | Line 1384
1384         fprintf(f_out, "%s\n+\n%s\n", rseq.chars(), rqv.chars());
1385         }
1386        else
1387 <       fprintf(f_out, "@%s_%08d\n%s\n+\n%s\n", prefix.chars(), outcounter,
1387 >       fprintf(f_out, "@%s_%08d\n%s\n+\n%s\n", prefix.chars(), outcounter,
1388                            rseq.chars(),rqv.chars() );
1389       }
1390   }
# Line 1328 | Line 1392
1392   void trash_report(char trashcode, GStr& rname, FILE* freport) {
1393   if (freport==NULL || trashcode<=' ') return;
1394   if (trashcode=='3' || trashcode=='5') {
1395 <   fprintf(freport, "%s\tA%c\n",rname.chars(),trashcode);
1395 >   fprintf(freport, "%s\ta%c\n",rname.chars(),trashcode);
1396     }
1397   else {
1398     fprintf(freport, "%s\t%c\n",rname.chars(),trashcode);
# Line 1420 | Line 1484
1484      }
1485   }
1487 + void addAdaptor(GVec<CASeqData>& adaptors, GStr& seq, GAlnTrimType trim_type) {
1488 + //TODO: prepare CASeqData here, and collect hexamers as well
1489 +  if (seq.is_empty() || seq=="-" ||
1490 +          seq=="N/A" || seq==".") return;
1491 +
1492 + CASeqData adata(revCompl);
1493 + int idx=adaptors.Add(adata);
1494 + if (idx<0) GError("Error: failed to add adaptor!\n");
1495 + adaptors[idx].trim_type=trim_type;
1496 + adaptors[idx].update(seq.chars());
1497 + }
1498 +
1500 < int loadAdapters(const char* fname) {
1500 > int loadAdaptors(const char* fname) {
1501    GLineReader lr(fname);
1502    char* l;
1503    while ((l=lr.nextLine())!=NULL) {
# Line 1433 | Line 1509
1509          i++;
1510          }
1511        if (l[i]!=0) {
1512 <        adapters.Add(new CAdapters(NULL, &(l[i])));
1512 >        GStr s(&(l[i]));
1513 >      #ifdef GDEBUG
1514 >          //s.reverse();
1515 >      #endif
1516 >        addAdaptor(adaptors3, s, galn_TrimRight);
1517          continue;
1518          }
1519        }
# Line 1442 | Line 1522
1522        s.startTokenize("\t ;,:");
1523        GStr a5,a3;
1524        if (s.nextToken(a5))
1525 <         s.nextToken(a3);
1526 <      adapters.Add(new CAdapters(a5.is_empty()?NULL:a5.chars(),
1527 <                                a3.is_empty()?NULL:a3.chars()));
1525 >            s.nextToken(a3);
1526 >        else continue; //no tokens on this line
1527 >      GAlnTrimType ttype5=galn_TrimLeft;
1528 >      a5.upper();
1529 >      a3.upper();
1530 >      if (a3.is_empty() || a3==a5 || a3=="=") {
1531 >         a3.clear();
1532 >         ttype5=galn_TrimEither;
1533 >         }
1534 >     #ifdef GDEBUG
1535 >     //   a5.reverse();
1536 >     //   a3.reverse();
1537 >     #endif
1538 >      addAdaptor(adaptors5, a5, ttype5);
1539 >      addAdaptor(adaptors3, a3, galn_TrimRight);
1540        }
1541     }
1542 <   return adapters.Count();
1542 >   return adaptors5.Count()+adaptors3.Count();
1543   }
1545 < void setupFiles(FILE*& f_in, FILE*& f_in2, FILE*& f_out, FILE*& f_out2,
1546 <                       GStr& s, GStr& infname, GStr& infname2) {
1545 > void setupFiles(FILE*& f_in, FILE*& f_in2, FILE*& f_out, FILE*& f_out2,
1546 >                       GStr& s, GStr& infname, GStr& infname2) {
1547   // uses outsuffix to generate output file names and open file handles as needed
1548   infname="";
1549   infname2="";
# Line 1479 | Line 1571
1571   s.startTokenize(",:");
1572   s.nextToken(infname);
1573   bool paired=s.nextToken(infname2);
1574 < if (fileExists(infname.chars())==0)
1574 > if (fileExists(infname.chars())==0)
1575      GError("Error: cannot find file %s!\n",infname.chars());
1576   GStr fname(getFileName(infname.chars()));
1577   GStr picmd;
# Line 1501 | Line 1593
1593   if (!paired) return;
1594   if (doCollapse) GError("Error: sorry, -C option cannot be used with paired reads!\n");
1595   // ---- paired reads:-------------
1596 < if (fileExists(infname2.chars())==0)
1596 > if (fileExists(infname2.chars())==0)
1597       GError("Error: cannot find file %s!\n",infname2.chars());
1598   picmd="";
1599   GStr fname2(getFileName(infname2.chars()));

Diff Legend

Removed lines
+ Added lines
< Changed lines
> Changed lines