ViewVC Help
View File | Revision Log | Show Annotations | View Changeset | Root Listing
root/gclib/fqtrim/fqtrim.cpp
(Generate patch)
# Line 6 | Line 6
6   #include "GAlnExtend.h"
7  
8   #define USAGE "Usage:\n\
9 < fqtrim [{-5 <5adapter> -3 <3adapter>|-f <adapters_file>}] [-a <min_matchlen>]\\\n\
10 <   [-q <minq> [-t <trim_max_len>]] [-p {64|33}] [-o <outsuffix>]\\\n\
9 > fqtrim [{-5 <5adaptor> -3 <3adaptor>|-f <adaptors_file>}] [-a <min_matchlen>]\\\n\
10 >   [-R] [-q <minq> [-t <trim_max_len>]] [-p {64|33}] [-o <outsuffix>]\\\n\
11     [-l <minlen>] [-C] [-D] [-Q] [-n <rename_prefix>] [-r <discarded.lst>]\\\n\
12      <input.fq>[,<input_mates.fq>\n\
13   \n\
14 < Trim low quality bases at the 3' end and can trim adapter sequence(s), filter\n\
14 > Trim low quality bases at the 3' end and can trim adaptor sequence(s), filter\n\
15   for low complexity and collapse duplicate reads.\n\
16   If read pairs should be trimmed and kept together (i.e. without discarding\n\
17   one read in a pair), the two file names should be given delimited by a comma\n\
# Line 25 | Line 25
25      file(s) named <input>.<outsuffix> which will be created in the \n\
26      current (working) directory; (writes to stdout if -o- is given);\n\
27      a suffix ending with .gz, .gzip or .bz2 will enforce compression\n\
28 < -f  file with adapter sequences to trim, each line having this format:\n\
29 <    <5'-adapter-sequence> <3'-adapter-sequence>\n\
30 < -5  trim the given adapter or primer sequence at the 5' end of each read\n\
28 > -f  file with adaptor sequences to trim, each line having this format:\n\
29 >    <5'-adaptor-sequence> <3'-adaptor-sequence>\n\
30 > -5  trim the given adaptor or primer sequence at the 5' end of each read\n\
31      (e.g. -5 CGACAGGTTCAGAGTTCTACAGTCCGACGATC)\n\
32 < -3  trim the given adapter sequence at the 3' end of each read\n\
32 > -3  trim the given adaptor sequence at the 3' end of each read\n\
33      (e.g. -3 TCGTATGCCGTCTTCTGCTTG)\n\
34 < -A  disable polyA trimming (enabled by default)\n\
35 < -T  enable polyT trimming (disabled by default)\n\
34 > -A  disable polyA/T trimming (enabled by default)\n\
35   -y  minimum length of exact match to adaptor sequence at the proper end (6)\n\
36   -q  trim bases with quality value lower than <minq> (starting at the 3' end)\n\
37   -t  for -q option, maximum trimming at the 3' end is limited to <trim_max_len>\n\
# Line 49 | Line 48
48   -Q  convert quality values to the other Phred qv type\n\
49   -V  verbose processing\n\
50   "
51 <
51 >
52   //-z  for -o option, the output stream(s) will be first piped into the given\n
53   //   <zcmd> command, which must output to stdout (e.g. -z 'bzip2 -9 -c')\n
54  
55 <
56 < // example 3' adapter for miRNAs: TCGTATGCCGTCTTCTGCTTG
55 >
56 > // example 3' adaptor for miRNAs: TCGTATGCCGTCTTCTGCTTG
57  
58   //For paired reads sequencing:
59   //3' : ACACTCTTTCCCTACACGACGCTCTTCCGATCT
# Line 63 | Line 62
62   //FILE* f_out2=NULL; //for paired reads
63   //FILE* f_in=NULL; //input fastq (stdin if not provided)
64   //FILE* f_in2=NULL; //for paired reads
65 +
66   FILE* freport=NULL;
67  
68   bool debug=false;
69   bool verbose=false;
70   bool doCollapse=false;
71   bool doDust=false;
72 + bool doPolyTrim=true;
73   bool fastaOutput=false;
74   bool trashReport=false;
75 < //bool rawFormat=false;
75 > bool revCompl=false; //also reverse complement adaptor sequences
76   int min_read_len=16;
77   double max_perc_N=7.0;
78   int dust_cutoff=16;
79   bool isfasta=false;
80   bool convert_phred=false;
81 < GStr outsuffix; // -o
81 > GStr outsuffix; // -o
82   GStr prefix;
83   GStr zcmd;
84   int num_trimmed5=0;
# Line 93 | Line 94
94   int qv_cvtadd=0; //could be -31 or +31
95  
96   // adaptor matching metrics -- for X-drop ungapped extension
97 + //const int match_reward=2;
98 + //const int mismatch_penalty=3;
99 + const int match_reward=2;
100 + const int mismatch_penalty=4;
101 + const int Xdrop=10;
102 +
103   const int poly_m_score=2; //match score
104   const int poly_mis_score=-3; //mismatch
105   const int poly_dropoff_score=7;
# Line 101 | Line 108
108   const char *polyA_seed="AAAA";
109   const char *polyT_seed="TTTT";
110  
111 < struct CAdapters {
112 <    GStr a5;
113 <    GStr a3;
114 <    CAdapters(const char* s5=NULL, const char* s3=NULL):a5(s5),a3(s3) {
115 <      }
111 > struct CASeqData {
112 >   //positional data for every possible hexamer in an adaptor
113 >   GVec<uint16>* pz[4096]; //0-based coordinates of all possible hexamers in the adaptor sequence
114 >   GVec<uint16>* pzr[4096]; //0-based coordinates of all possible hexamers for the reverse complement of the adaptor sequence
115 >   GStr seq; //actual adaptor sequence data
116 >   GStr seqr; //reverse complement sequence
117 >   int amlen; //fraction of adaptor length matching that's
118 >              //enough to consider the alignment
119 >   GAlnTrimType trim_type;
120 >   bool use_reverse;
121 >   CASeqData(bool rev=false):seq(),seqr(),
122 >             amlen(0), use_reverse(rev) {
123 >     trim_type=galn_None; //should be updated later!
124 >     for (int i=0;i<4096;i++) {
125 >        pz[i]=NULL;
126 >        pzr[i]=NULL;
127 >        }
128 >     }
129 >
130 >   void update(const char* s) {
131 >         seq=s;
132 >         table6mers(seq.chars(), seq.length(), pz);
133 >         amlen=iround(double(seq.length())*0.8);
134 >         if (amlen<12)
135 >                amlen=12;
136 >         if (!use_reverse) return;
137 >         //reverse complement
138 >         seqr=s;
139 >         int slen=seq.length();
140 >         for (int i=0;i<slen;i++)
141 >           seqr[i]=ntComplement(seq[slen-i-1]);
142 >         table6mers(seqr.chars(), seqr.length(), pzr);
143 >   }
144 >
145 >   ~CASeqData() {
146 >     for (int i=0;i<4096;i++) {
147 >       delete pz[i];
148 >       delete pzr[i];
149 >     }
150 >   }
151   };
152  
153 < GPVec<CAdapters> adapters;
153 > GVec<CASeqData> adaptors5;
154 > GVec<CASeqData> adaptors3;
155 >
156 > CGreedyAlignData* gxmem_l=NULL;
157 > CGreedyAlignData* gxmem_r=NULL;
158  
159   // element in dhash:
160   class FqDupRec {
# Line 158 | Line 204
204  
205   GHash<FqDupRec> dhash; //hash to keep track of duplicates
206  
207 < int loadAdapters(const char* fname);
207 > void addAdaptor(GVec<CASeqData>& adaptors, GStr& seq, GAlnTrimType trim_type);
208 > int loadAdaptors(const char* fname);
209  
210 < void setupFiles(FILE*& f_in, FILE*& f_in2, FILE*& f_out, FILE*& f_out2,
211 <                       GStr& s, GStr& infname, GStr& infname2);
210 > void setupFiles(FILE*& f_in, FILE*& f_in2, FILE*& f_out, FILE*& f_out2,
211 >                       GStr& s, GStr& infname, GStr& infname2);
212   // uses outsuffix to generate output file names and open file handles as needed
213 <
213 >
214   void writeRead(FILE* f_out, GStr& rname, GStr& rinfo, GStr& rseq, GStr& rqv, int& outcounter);
215   void trash_report(char trashcode, GStr& rname, FILE* freport);
216  
217 < bool getFastxRec(GLineReader& fq, GStr& rseq, GStr& rqv,
217 > bool getFastxRec(GLineReader& fq, GStr& rseq, GStr& rqv,
218            GStr& rname, GStr& rinfo, GStr& infname);
219  
220 < char process_read(GStr& rname, GStr& rseq, GStr& rqv, int &l5, int &l3);
220 > char process_read(GStr& rname, GStr& rseq, GStr& rqv, int &l5, int &l3);
221   //returns 0 if the read was untouched, 1 if it was trimmed and a trash code if it was trashed
222  
223   bool ntrim(GStr& rseq, int &l5, int &l3); //returns true if any trimming occured
# Line 178 | Line 225
225   int dust(GStr& seq);
226   bool trim_poly5(GStr &seq, int &l5, int &l3, const char* poly_seed); //returns true if any trimming occured
227   bool trim_poly3(GStr &seq, int &l5, int &l3, const char* poly_seed);
228 < bool trim_adapter5(GStr& seq, int &l5, int &l3); //returns true if any trimming occured
229 < bool trim_adapter3(GStr& seq, int &l5, int &l3);
228 > bool trim_adaptor5(GStr& seq, int &l5, int &l3); //returns true if any trimming occured
229 > bool trim_adaptor3(GStr& seq, int &l5, int &l3);
230  
231   void convertPhred(char* q, int len);
232   void convertPhred(GStr& q);
233  
234   int main(int argc, char * const argv[]) {
235 <  GArgs args(argc, argv, "YQDCVl:d:3:5:m:n:r:p:q:f:t:o:z:a:");
235 >  GArgs args(argc, argv, "YQDCRVAl:d:3:5:m:n:r:p:q:f:t:o:z:a:");
236    int e;
237    if ((e=args.isError())>0) {
238        GMessage("%s\nInvalid argument: %s\n", USAGE, argv[e]);
# Line 196 | Line 243
243    convert_phred=(args.getOpt('Q')!=NULL);
244    doCollapse=(args.getOpt('C')!=NULL);
245    doDust=(args.getOpt('D')!=NULL);
246 +  revCompl=(args.getOpt('R')!=NULL);
247 +  if (args.getOpt('A')) doPolyTrim=false;
248    /*
249    rawFormat=(args.getOpt('R')!=NULL);
250    if (rawFormat) {
# Line 204 | Line 253
253    */
254    prefix=args.getOpt('n');
255    GStr s=args.getOpt('l');
256 <  if (!s.is_empty())
256 >  if (!s.is_empty())
257       min_read_len=s.asInt();
258    s=args.getOpt('m');
259 <  if (!s.is_empty())
259 >  if (!s.is_empty())
260       max_perc_N=s.asDouble();
261    s=args.getOpt('d');
262    if (!s.is_empty()) {
# Line 233 | Line 282
282          qv_phredtype=64;
283          qv_cvtadd=-31;
284          }
285 <       else
285 >       else
286           GMessage("%s\nInvalid value for -p option (can only be 64 or 33)!\n",USAGE);
287       }
288    s=args.getOpt('f');
289    if (!s.is_empty()) {
290 <   loadAdapters(s.chars());
290 >   loadAdaptors(s.chars());
291     }
292 <  bool fileAdapters=adapters.Count();
292 >  bool fileAdaptors=adaptors5.Count()+adaptors3.Count();
293    s=args.getOpt('5');
294    if (!s.is_empty()) {
295 <    if (fileAdapters)
295 >    if (fileAdaptors)
296        GError("Error: options -5 and -f cannot be used together!\n");
297      s.upper();
298 <    adapters.Add(new CAdapters(s.chars()));
298 >    addAdaptor(adaptors5, s, galn_TrimLeft);
299      }
300    s=args.getOpt('3');
301    if (!s.is_empty()) {
302 <    if (fileAdapters)
302 >    if (fileAdaptors)
303        GError("Error: options -3 and -f cannot be used together!\n");
304 <    s.upper();
305 <    if (adapters.Count()>0)
257 <          adapters[0]->a3=s.chars();
258 <     else adapters.Add(NULL, new CAdapters(s.chars()));
304 >      s.upper();
305 >      addAdaptor(adaptors3, s, galn_TrimRight);
306      }
307    s=args.getOpt('y');
308    if (!s.is_empty()) {
309       int minmatch=s.asInt();
310       poly_minScore=minmatch*poly_m_score;
311       }
312 <  
312 >
313    if (args.getOpt('o')!=NULL) outsuffix=args.getOpt('o');
314                           else outsuffix="-";
315    trashReport=  (args.getOpt('r')!=NULL);
# Line 279 | Line 326
326    if (trashReport)
327      openfw(freport, args, 'r');
328    char* infile=NULL;
329 +
330 +  if (adaptors5.Count()>0)
331 +    //gxmem_l=new CGreedyAlignData(match_reward, mismatch_penalty, Xdrop-2);
332 +        gxmem_l=new CGreedyAlignData(match_reward, mismatch_penalty, Xdrop);
333 +  if (adaptors3.Count()>0)
334 +    gxmem_r=new CGreedyAlignData(match_reward, mismatch_penalty, Xdrop);
335 +
336    while ((infile=args.nextNonOpt())!=NULL) {
337 +    //for each input file
338      int incounter=0; //counter for input reads
339      int outcounter=0; //counter for output reads
340      int trash_s=0; //too short from the get go
341      int trash_Q=0;
342      int trash_N=0;
343      int trash_D=0;
344 +    int trash_poly=0;
345      int trash_A3=0;
346      int trash_A5=0;
347      s=infile;
# Line 310 | Line 366
366         int a5=0, a3=0, b5=0, b3=0;
367         char tcode=0, tcode2=0;
368         tcode=process_read(seqid, rseq, rqv, a5, a3);
369 <       //if (!doCollapse) {
314 <         if (fq2!=NULL) {
369 >       if (fq2!=NULL) {
370              getFastxRec(*fq2, rseq2, rqv2, seqid2, seqinfo2, infname2);
371              if (seqid.substr(0,seqid.length()-1)!=seqid2.substr(0,seqid2.length()-1)) {
372                 GError("Error: no paired match for read %s vs %s (%s,%s)\n",
# Line 343 | Line 398
398                 int nocounter=0;
399                 writeRead(f_out2, seqid2, seqinfo2, rseq2, rqv2, nocounter);
400                 }
401 <            } //paired read
347 <       // }
401 >            } //pair read
402         if (tcode>1) { //trashed
403 +         #ifdef GDEBUG
404 +         GMessage(" !!!!TRASH code = %c\n",tcode);
405 +         #endif
406            if (tcode=='s') trash_s++;
407 +          else if (tcode=='A' || tcode=='T') trash_poly++;
408              else if (tcode=='Q') trash_Q++;
409                else if (tcode=='N') trash_N++;
410                 else if (tcode=='D') trash_D++;
# Line 359 | Line 417
417              rseq=rseq.substr(a5,a3-a5+1);
418              if (!rqv.is_empty()) rqv=rqv.substr(a5,a3-a5+1);
419              }
420 +         #ifdef GDEBUG
421 +            GMessage("  After trimming:\n");
422 +            GMessage("%s\n",rseq.chars());
423 +         #endif
424            writeRead(f_out, seqid, seqinfo, rseq, rqv, outcounter);
425            }
426         } //for each fastq record
# Line 386 | Line 448
448                 }
449              }
450           outcounter++;
451 <         if (qd->count>maxdup_count) {
451 >         if (qd->count>maxdup_count) {
452              maxdup_count=qd->count;
453              maxdup_seq=seq;
454              }
455           if (isfasta) {
456             if (prefix.is_empty()) {
457 <             fprintf(f_out, ">%s_x%d\n%s\n", qd->firstname, qd->count,
457 >             fprintf(f_out, ">%s_x%d\n%s\n", qd->firstname, qd->count,
458                             rseq.chars());
459               }
460             else { //use custom read name
# Line 403 | Line 465
465           else { //fastq format
466            if (convert_phred) convertPhred(qd->qv, qd->len);
467            if (prefix.is_empty()) {
468 <            fprintf(f_out, "@%s_x%d\n%s\n+\n%s\n", qd->firstname, qd->count,
468 >            fprintf(f_out, "@%s_x%d\n%s\n+\n%s\n", qd->firstname, qd->count,
469                             rseq.chars(), qd->qv);
470              }
471            else { //use custom read name
# Line 439 | Line 501
501           GMessage("         Trashed by N%%:%9d\n", trash_N);
502         if (trash_Q>0)
503           GMessage("Trashed by low quality:%9d\n", trash_Q);
504 +       if (trash_poly>0)
505 +         GMessage("   Trashed by poly-A/T:%9d\n", trash_poly);
506         if (trash_A5>0)
507 <         GMessage(" Trashed by 5' adapter:%9d\n", trash_A5);
507 >         GMessage(" Trashed by 5' adaptor:%9d\n", trash_A5);
508         if (trash_A3>0)
509 <         GMessage(" Trashed by 3' adapter:%9d\n", trash_A3);
509 >         GMessage(" Trashed by 3' adaptor:%9d\n", trash_A3);
510         }
511      if (trashReport) {
512            FWCLOSE(freport);
# Line 450 | Line 514
514      FWCLOSE(f_out);
515      FWCLOSE(f_out2);
516     } //while each input file
517 <
517 > delete gxmem_l;
518 > delete gxmem_r;
519   //getc(stdin);
520   }
521  
# Line 465 | Line 530
530     const char* seq;
531     bool valid;
532     NData() {
533 +    seqlen=0;
534      NCount=0;
535      end5=0;
536      end3=0;
# Line 495 | Line 561
561       perc_N=(n*100.0)/(end5-end3+1);
562       }
563   };
564 <
564 >
565   static NData feat;
566   int perc_lenN=12; // incremental distance from ends, in percentage of
567            // sequence length, where N-trimming is done (default:12 %) (autolimited to 20)
568 <          
568 >
569   void N_analyze(int l5, int l3, int p5, int p3) {
570   /* assumes feat was filled properly */
571   int old_dif, t5,t3,v;
572   if (l3<l5+2 || p5>p3 ) {
573     feat.end5=l5+1;
574     feat.end3=l3+1;
575 <   return;
575 >   return;
576     }
577  
578   t5=feat.NPos[p5]-l5;
579   t3=l3-feat.NPos[p3];
580   old_dif=p3-p5;
581   v=(int)((((double)(l3-l5))*perc_lenN)/100);
582 < if (v>20) v=20; /* enforce N-search limit for very long reads */
582 > if (v>20) v=20; /* enforce N-search limit for very long reads */
583   if (t5 < v ) {
584     l5=feat.NPos[p5]+1;
585     p5++;
# Line 530 | Line 596
596             feat.end3=l3+1;
597             return;
598             }
599 <    else
599 >    else
600        N_analyze(l5,l3, p5,p3);
601   }
602  
# Line 571 | Line 637
637   feat.init(rseq);
638   l5=feat.end5-1;
639   l3=feat.end3-1;
640 < N_analyze(feat.end5-1, feat.end3-1, 0, feat.NCount-1);
640 > N_analyze(feat.end5-1, feat.end3-1, 0, feat.NCount-1);
641   if (l5==feat.end5-1 && l3==feat.end3-1) {
642      if (feat.perc_N>max_perc_N) {
643             feat.valid=false;
# Line 589 | Line 655
655     return true;
656     }
657   feat.N_calc();
658 <
658 >
659   if (feat.perc_N>max_perc_N) {
660        feat.valid=false;
661        l3=l5+1;
# Line 601 | Line 667
667   //--------------- dust functions ----------------
668   class DNADuster {
669   public:
670 <  int dustword;
671 <  int dustwindow;
672 <  int dustwindow2;
670 >  int dustword;
671 >  int dustwindow;
672 >  int dustwindow2;
673    int dustcutoff;
674    int mv, iv, jv;
675    int counts[32*32*32];
# Line 698 | Line 764
764                      }
765             }
766           }
767 < //return first;
767 > //return first;
768   }
769   };
770  
# Line 716 | Line 782
782   return ncount;
783   }
784  
719 int get3mer_value(const char* s) {
720 return (s[0]<<16)+(s[1]<<8)+s[2];
721 }
722
723 int w3_match(int qv, const char* str, int slen, int start_index=0) {
724 if (start_index>=slen || start_index<0) return -1;
725 for (int i=start_index;i<slen-3;i++) {
726   int rv=get3mer_value(str+i);
727   if (rv==qv) return i;
728   }
729 return -1;
730 }
731
732 int w3_rmatch(int qv, const char* str, int slen, int end_index=-1) {
733 if (end_index>=slen) return -1;
734 if (end_index<0) end_index=slen-1;
735 for (int i=end_index-2;i>=0;i--) {
736   int rv=get3mer_value(str+i);
737   if (rv==qv) return i;
738   }
739 return -1;
740 }
741
785   struct SLocScore {
786    int pos;
787    int score;
# Line 757 | Line 800
800   };
801  
802   bool trim_poly3(GStr &seq, int &l5, int &l3, const char* poly_seed) {
803 + if (!doPolyTrim) return false;
804   int rlen=seq.length();
805   l5=0;
806   l3=rlen-1;
# Line 765 | Line 809
809   //assumes N trimming was already done
810   //so a poly match should be very close to the end of the read
811   // -- find the initial match (seed)
812 < int lmin=GMAX((rlen-12), 0);
812 > int lmin=GMAX((rlen-16), 0);
813   int li;
814   for (li=rlen-4;li>lmin;li--) {
815     if (seedVal==*(int*)&(seq[li])) {
# Line 779 | Line 823
823   SLocScore loc(ri, poly_m_score<<2);
824   SLocScore maxloc(loc);
825   //extend right
826 < while (ri<rlen-2) {
826 > while (ri<rlen-1) {
827     ri++;
828     if (seq[ri]==polyChar) {
829                  loc.add(ri,poly_m_score);
# Line 796 | Line 840
840        }
841     }
842   ri=maxloc.pos;
843 < if (ri<rlen-3) return false; //no trimming wanted, too far from 3' end
843 > if (ri<rlen-6) return false; //no trimming wanted, too far from 3' end
844   //ri = right boundary for the poly match
845   //extend left
846   loc.set(li, maxloc.score);
# Line 817 | Line 861
861         maxloc=loc;
862         }
863      }
864 < if (maxloc.score>poly_minScore && ri>=rlen-3) {
865 <    l5=li;
866 <    l3=ri;
864 > li=maxloc.pos;
865 > if ((maxloc.score==poly_minScore && ri==rlen-1) ||
866 >    (maxloc.score>poly_minScore && ri>=rlen-3) ||
867 >    (maxloc.score>(poly_minScore*3) && ri>=rlen-8)) {
868 >  //trimming this li-ri match at 3' end
869 >    l3=li-1;
870 >    if (l3<0) l3=0;
871      return true;
872      }
873   return false;
874   }
875  
828
876   bool trim_poly5(GStr &seq, int &l5, int &l3, const char* poly_seed) {
877 + if (!doPolyTrim) return false;
878   int rlen=seq.length();
879   l5=0;
880   l3=rlen-1;
# Line 835 | Line 883
883   //assumes N trimming was already done
884   //so a poly match should be very close to the end of the read
885   // -- find the initial match (seed)
886 < int lmax=GMIN(8, rlen-4);//how far from 5' end to look for 4-mer seeds
886 > int lmax=GMIN(12, rlen-4);//how far from 5' end to look for 4-mer seeds
887   int li;
888   for (li=0;li<=lmax;li++) {
889     if (seedVal==*(int*)&(seq[li])) {
# Line 865 | Line 913
913         }
914      }
915   li=maxloc.pos;
916 < if (li>3) return false; //no trimming wanted, too far from 5' end
916 > if (li>5) return false; //no trimming wanted, too far from 5' end
917   //li = right boundary for the poly match
918  
919   //extend right
920   loc.set(ri, maxloc.score);
921   maxloc.pos=ri;
922 < while (ri<rlen-2) {
922 > while (ri<rlen-1) {
923     ri++;
924     if (seq[ri]==polyChar) {
925                  loc.add(ri,poly_m_score);
# Line 887 | Line 935
935        maxloc=loc;
936        }
937     }
938 <
939 < if (maxloc.score>poly_minScore && li<=3) {
940 <    l5=li;
941 <    l3=ri;
938 > ri=maxloc.pos;
939 > if ((maxloc.score==poly_minScore && li==0) ||
940 >     (maxloc.score>poly_minScore && li<2)
941 >     || (maxloc.score>(poly_minScore*3) && li<8)) {
942 >    //adjust l5 to reflect this trimming of 5' end
943 >    l5=ri+1;
944 >    if (l5>rlen-1) l5=rlen-1;
945      return true;
946      }
947   return false;
948   }
949  
950 < bool trim_adapter3(GStr& seq, int&l5, int &l3) {
950 > bool trim_adaptor3(GStr& seq, int&l5, int &l3) {
951 > if (adaptors3.Count()==0) return false;
952   int rlen=seq.length();
953   l5=0;
954   l3=rlen-1;
955 < //first try a full match, we might get lucky
956 < int fi=-1;
957 < if ((fi=seq.index(adapter3))>=0) {
958 <   if (fi<rlen-fi-a3len) {//match is closer to the right end
959 <      l5=fi+a3len;
960 <      l3=rlen-1;
961 <      }
962 <    else {
963 <      l5=0;
964 <      l3=fi-1;
965 <      }
914 <   return true;
915 <   }
916 < #ifdef DEBUG
917 < if (debug) GMessage(">TRIM3 >>   Read: %s\n",seq.chars());
918 < #endif
919 <
920 < //also, for fast detection of other adapter-only reads that start past
921 < // the beginning of the adapter sequence, try to see if the first a3len-4
922 < // bases of the read are a substring of the adapter
923 < if (rlen>a3len-3) {
924 <   GStr rstart=seq.substr(1,a3len-4);
925 <   if ((fi=adapter3.index(rstart))>=0) {
926 <     l3=rlen-1;
927 <     l5=a3len-4;
928 <     while (fi+l5<a3len && l5<l3 && adapter3[fi+l5]==seq[l5]) l5++;
929 <     return true;
930 <     }
931 <  }
932 < CSegChain a3segs; //no chains here, just an ordered collection of segment pairs
933 <  //check the easy cases - 11 bases exact match at the end
934 < int fdlen=11;
935 <  if (a3len<16) {
936 <   fdlen=a3len>>1;
937 <   }
938 < if (fdlen>4) {
939 <     //check if we're lucky enough to have the last 11 bases of the read a part of the adapter
940 <     GStr rstart=seq.substr(-fdlen-3,fdlen);
941 <     if ((fi=adapter3.index(rstart))>=0) {
942 < #ifdef DEBUG
943 <       if (debug) GMessage("  W11match found: %*s\n", rlen-3, (adapter3.substr(fi,fdlen)).chars());
944 < #endif
945 <       if (extendMatch(seq.chars(), rlen, rlen-fdlen-3,
946 <                     adapter3.chars(), a3len, fi,  fdlen, l5,l3, a3segs))
947 <            return true;
948 <       }
949 <     //another easy case: first 11 characters of the adaptor found as a substring of the read
950 <     GStr bstr=adapter3.substr(0, fdlen);
951 <     if ((fi=seq.rindex(bstr))>=0) {
952 < #ifdef DEBUG
953 <       if (debug) GMessage("  A11match found: %*s\n", fi+fdlen, bstr.chars());
954 < #endif
955 <       if (extendMatch(seq.chars(), rlen, fi,
956 <                     adapter3.chars(), a3len, 0,  fdlen, l5,l3, a3segs))
957 <            return true;
958 <       }
959 <     } //tried to match 11 bases first
960 <    
961 < //no easy cases, so let's do the wmer hashing for the first 12 bases of the adaptor
962 < //-- only extend if the match is in the 3' (ending) region of the read
963 < int wordSize=3;
964 < int hlen=12;
965 < if (hlen>a3len-wordSize) hlen=a3len-wordSize;
966 < int imin=rlen>>1; //last half of the read, left boundary for the wmer match
967 < if (imin<a3len) { imin=GMIN(a3len, rlen-wordSize); }
968 < imin=rlen-imin;
969 < for (int iw=0;iw<hlen;iw++) {
970 <   //int32* qv=(int32*)(adapter3.chars()+iw);
971 <   int qv=get3mer_value(adapter3.chars()+iw);
972 <   fi=-1;
973 <   //while ((fi=fast4rmatch(*qv, seq.chars(), rlen, fi))>=0 && fi>=imin) {
974 <   while ((fi=w3_rmatch(qv, seq.chars(), rlen, fi))>=0 && fi>=imin) {
975 <     //GMessage(" ... fi=%d after w3_rmatch() (imin=%d)\n", fi, imin);
976 <
977 < #ifdef DEBUG
978 <     if (debug) GMessage("    Wmatch found: %*s\n", fi+wordSize, (adapter3.substr(iw,wordSize)).chars());
979 < #endif
980 <     if (extendMatch(seq.chars(), rlen, fi, adapter3.chars(),
981 <                   a3len, iw, wordSize, l5,l3, a3segs)) return true;
982 <     fi--;
983 <     if (fi<imin) break;
984 <     }
985 <   } //for each wmer in the first hlen bases of the adaptor
986 < /*
987 < //couldn't find a good trimming extension, hash 12 more bases of the adapter to collect more segment pairs there
988 < //but only do this if we already have segment pairs collected in the last 12 bases of the adapter
989 < if (a3segs.bstart>3 || a3segs.bend<(uint)(hlen-wordSize)) return false;
990 < int hlen2=a3len-wordSize;
991 < //if (hlen2>a3len-4) hlen2=a3len-4;
992 < if (hlen2>hlen) {
993 < #ifdef DEBUG
994 <     if (debug && a3segs.Count()>0) {
995 <        GMessage("  >>>>>2nd. hash: %s\n",seq.chars());
955 > bool trimmed=false;
956 > GStr wseq(seq);
957 > int wlen=rlen;
958 > GXSeqData seqdata;
959 > int numruns=revCompl ? 2 : 1;
960 >
961 > for (int ai=0;ai<adaptors3.Count();ai++) {
962 >   for (int r=0;r<numruns;r++) {
963 >     if (r) {
964 >          seqdata.update(adaptors3[ai].seqr.chars(), adaptors3[ai].seqr.length(),
965 >                 adaptors3[ai].pzr, wseq.chars(), wlen, adaptors3[ai].amlen);
966          }
967 < #endif
968 <     for (int iw=hlen;iw<hlen2;iw++) {
969 <         //int* qv=(int32 *)(adapter3.chars()+iw);
970 <         int qv=get3mer_value(adapter3.chars()+iw);
971 <         fi=-1;
972 <         //while ((fi=fast4rmatch(*qv, seq.chars(), rlen, fi))>=0 && fi>=imin) {
973 <         while ((fi=w3_rmatch(qv, seq.chars(), rlen, fi))>=0 && fi>=imin) {
974 <           extendMatch(seq.chars(), rlen, fi, adapter3.chars(),
975 <                         a3len, iw, wordSize, l5,l3, a3segs);
976 <           fi--;
977 <           if (fi<imin) break;
978 <           }
979 <         } //for each wmer between hlen2 and hlen bases of the adaptor
980 <     }
981 < //lastly, analyze collected a3segs for a possible gapped alignment:
982 < GList<CSegChain> segchains(false,true,false);
983 < #ifdef DEBUG
984 < if (debug && a3segs.Count()>0) {
985 <   GMessage(">>>>>>>>>   Read: %s\n",seq.chars());
986 <   }
987 < #endif
988 < for (int i=0;i<a3segs.Count();i++) {
989 <   if (a3segs[i]->chain==NULL) {
990 <       if (a3segs[i]->b.start>3) continue; //don't start a hopeless chain
991 <       CSegChain* newchain=new CSegChain();
992 <       newchain->setFreeItem(false);
1023 <       newchain->addSegPair(a3segs[i]);
1024 <       a3segs[i]->chain=newchain;
1025 <       segchains.Add(newchain); //just to free them when done
1026 <       }
1027 <   for (int j=i+1;j<a3segs.Count();j++) {
1028 <      CSegChain* chain=a3segs[i]->chain;
1029 <      if (chain->extendChain(a3segs[j])) {
1030 <          a3segs[j]->chain=chain;
1031 < #ifdef DEBUG
1032 <          if (debug) dbgPrintChain(*chain, adapter3.chars());
1033 < #endif      
1034 <          //save time by checking here if the extended chain is already acceptable for trimming
1035 <          if (chain->aend>(uint)(rlen-4) && chain->bstart<4 && chain->score>a_min_chain_score) {
1036 <            l5=0;
1037 <            l3=chain->astart-2;
1038 < #ifdef DEBUG
1039 <          if (debug && a3segs.Count()>0) {
1040 <            GMessage(">>> >> trimmed-3: %*s\n",l3-l5+1,seq.substr(l5,l3-l5+1).chars());
1041 <            }
1042 < #endif
1043 <            return true;
1044 <            }
1045 <          } //chain can be extended
1046 <      }
1047 <   } //collect segment alignments into chains
1048 < */  
1049 < return false; //no adapter parts found
967 >     else {
968 >            seqdata.update(adaptors3[ai].seq.chars(), adaptors3[ai].seq.length(),
969 >                 adaptors3[ai].pz, wseq.chars(), wlen, adaptors3[ai].amlen);
970 >        }
971 >
972 >  GXAlnInfo* aln=match_adaptor(seqdata, adaptors3[ai].trim_type, gxmem_r, 86);
973 >  if (aln) {
974 >     trimmed=true;
975 >     //keep unmatched region on the left OR right (the longer one)
976 >     if (aln->sl > wlen-aln->sr) {
977 >         //keep left side
978 >         l3-=(wlen-aln->sl+1);
979 >         if (l3<0) l3=0;
980 >         }
981 >     else { //keep right side
982 >         l5+=aln->sr;
983 >         if (l5>=rlen) l5=rlen-1;
984 >         }
985 >     delete aln;
986 >     if (l3-l5+1<min_read_len) return true;
987 >     wseq=seq.substr(l5,l3-l5+1);
988 >     wlen=wseq.length();
989 >     }
990 >   }//forward and reverse adaptors
991 >  }//for each 3' adaptor
992 >  return trimmed;
993   }
994  
995 < bool trim_adapter5(GStr& seq, int&l5, int &l3) {
996 < //if (debug) GMessage("trim_adapter5 on: %s\n", seq.chars());
995 > bool trim_adaptor5(GStr& seq, int&l5, int &l3) {
996 > if (adaptors5.Count()==0) return false;
997   int rlen=seq.length();
998   l5=0;
999   l3=rlen-1;
1000 < //try to see if adapter is fully included in the read
1001 < int fi=-1;
1002 < if ((fi=seq.index(adapter5))>=0) {
1003 <   if (fi<rlen-fi-a5len) {//match is closer to the right end
1004 <      l5=fi+a5len;
1005 <      l3=rlen-1;
1006 <      }
1007 <    else {
1008 <      l5=0;
1009 <      l3=fi-1;
1067 <      }
1068 <   return true;
1069 <   }
1070 < #ifdef DEBUG
1071 < if (debug) GMessage(">TRIM5 >>   Read: %s\n",seq.chars());
1072 < #endif
1073 <
1074 < CSegChain a5segs(true); //list of segment pairs to analyze later if no extendMatch succeeded
1075 <
1076 < //try the easy way out first - look for an exact match of 11 bases
1077 < int fdlen=11;
1078 <  if (a5len<16) {
1079 <   fdlen=a5len>>1;
1080 <   }
1081 < if (fdlen>4) {
1082 <     GStr rstart=seq.substr(1,fdlen); //skip the first base as it's sometimes bogus
1083 <     if ((fi=adapter5.index(rstart))>=0) {
1084 < #ifdef DEBUG
1085 <       if (debug) GMessage("  W11match found: %*s\n", 1+fdlen, (adapter3.substr(fi,fdlen)).chars());
1086 < #endif
1087 <       if (extendMatch(seq.chars(), rlen, 1,
1088 <                     adapter5.chars(), a5len, fi,  fdlen, l5,l3, a5segs, true))
1089 <           return true;
1090 <       }
1091 <     //another easy case: last 11 characters of the adaptor found as a substring of the read
1092 <     GStr bstr=adapter5.substr(-fdlen);
1093 <     if ((fi=seq.index(bstr))>=0) {
1094 < #ifdef DEBUG
1095 <       if (debug) GMessage("  A11match found: %*s\n", fi+fdlen, bstr.chars());
1096 < #endif
1097 <       if (extendMatch(seq.chars(), rlen, fi,
1098 <                     adapter5.chars(), a5len, a5len-fdlen,  fdlen, l5,l3,a5segs,true))
1099 <          return true;
1100 <       }
1101 <     } //tried to matching at most 11 bases first
1102 <    
1103 < //-- no easy cases, do the wmer hashing for the last 12 bases of the adaptor
1104 < //-- only extend a wmer if it matches in the 5' (beginning) region of the read
1105 < int wordSize=3;
1106 < int hlen=12;
1107 < if (hlen>a5len-wordSize) hlen=a5len-wordSize;
1108 < int imax=rlen>>1; //first half of the read, right boundary for the wmer match
1109 < if (imax<a5len) { imax=GMIN(a5len, rlen-wordSize); }
1110 < for (int iw=0;iw<=hlen;iw++) {
1111 <   int apstart=a5len-iw-wordSize;
1112 <   fi=0;
1113 <   //int* qv=(int32 *)(adapter5.chars()+apstart);
1114 <   int qv=get3mer_value(adapter5.chars()+apstart);
1115 <   //while ((fi=fast4match(*qv, seq.chars(), rlen, fi))>=0 && fi<=imax) {
1116 <   while ((fi=w3_match(qv, seq.chars(), rlen, fi))>=0 && fi<=imax) {
1117 < #ifdef DEBUG
1118 <     if (debug) GMessage("    Wmatch found: %*s\n", fi+wordSize, (adapter5.substr(apstart,wordSize)).chars());
1119 < #endif
1120 <     if (extendMatch(seq.chars(), rlen, fi, adapter5.chars(),
1121 <                a5len, apstart, wordSize, l5,l3, a5segs, true)) return true;
1122 <     fi++;
1123 <     if (fi>imax) break;
1124 <     }
1125 <   } //for each wmer in the last hlen bases of the adaptor
1126 < /*
1127 <
1128 < //couldn't find a good trimming extension, hash 12 more bases of the adapter to collect more segment pairs there
1129 < //but only do this if we already have segment pairs collected in the last 12 bases of the adapter
1130 < if (a5segs.bend<(uint)(a5len-3) || a5segs.bstart>(uint)(a5len-hlen+4)) return false;
1131 < int hlen2=a5len-wordSize;
1132 < //if (hlen2>a5len-wordSize) hlen2=a5len-wordSize;
1133 < #ifdef DEBUG
1134 <      if (debug && a5segs.Count()>0) {
1135 <        GMessage("  >>>>>2nd. hash: %s\n",seq.chars());
1000 > bool trimmed=false;
1001 > GStr wseq(seq);
1002 > int wlen=rlen;
1003 > GXSeqData seqdata;
1004 > int numruns=revCompl ? 2 : 1;
1005 > for (int ai=0;ai<adaptors5.Count();ai++) {
1006 >   for (int r=0;r<numruns;r++) {
1007 >     if (r) {
1008 >          seqdata.update(adaptors5[ai].seqr.chars(), adaptors5[ai].seqr.length(),
1009 >                 adaptors5[ai].pzr, wseq.chars(), wlen, adaptors5[ai].amlen);
1010          }
1011 < #endif
1012 < if (hlen2>hlen) {
1013 <     for (int iw=hlen+1;iw<=hlen2;iw++) {
1014 <         int apstart=a5len-iw-wordSize;
1015 <         fi=0;
1016 <         //int* qv=(int32 *)(adapter5.chars()+apstart);
1017 <         int qv=get3mer_value(adapter5.chars()+apstart);
1018 <         //while ((fi=fast4match(*qv, seq.chars(), rlen, fi))>=0 && fi<=imax) {
1019 <         while ((fi=w3_match(qv, seq.chars(), rlen, fi))>=0 && fi<=imax) {
1020 <           extendMatch(seq.chars(), rlen, fi, adapter5.chars(),
1021 <                      a5len, apstart, wordSize, l5,l3, a5segs, true);
1022 <           fi++;
1023 <           if (fi>imax) break;
1024 <           }
1025 <         } //for each wmer between hlen2 and hlen bases of the adaptor
1026 <     }
1027 < if (a5segs.bend<(uint)(a5len-3) || a5segs.bstart>(uint)(a5len-hlen+4)) return false;
1028 < // lastly, analyze collected a5segs for a possible gapped alignment:
1029 < GList<CSegChain> segchains(false,true,false);
1030 < #ifdef DEBUG
1031 < if (debug && a5segs.Count()>0) {
1032 <   GMessage(">>>>>>>>>   Read: %s\n",seq.chars());
1033 <   }
1034 < #endif
1035 < for (int i=0;i<a5segs.Count();i++) {
1162 <   if (a5segs[i]->chain==NULL) {
1163 <       if (a5segs[i]->b.end<(int)(a5len-4)) continue; //don't start a hopeless chain
1164 <       CSegChain* newchain=new CSegChain(true);
1165 <       newchain->setFreeItem(false);
1166 <       newchain->addSegPair(a5segs[i]);
1167 <       a5segs[i]->chain=newchain;
1168 <       segchains.Add(newchain); //just to free them when done
1169 <       }
1170 <   for (int j=i+1;j<a5segs.Count();j++) {
1171 <      CSegChain* chain=a5segs[i]->chain;
1172 <      if (chain->extendChain(a5segs[j])) {
1173 <         a5segs[j]->chain=chain;
1174 < #ifdef DEBUG
1175 <         if (debug) dbgPrintChain(*chain, adapter5.chars());
1176 < #endif      
1177 <      //save time by checking here if the extended chain is already acceptable for trimming
1178 <         if (chain->bend>(uint)(a5len-3) && chain->astart<4 && chain->score>a_min_chain_score) {
1179 <            l5=chain->aend;
1180 <            l3=rlen-1;
1181 <            return true;
1182 <            }
1183 <         } //chain can be extended
1184 <      }
1185 <   } //collect segment alignments into chains
1186 < */
1187 < return false; //no adapter parts found
1188 < }
1011 >     else {
1012 >            seqdata.update(adaptors5[ai].seq.chars(), adaptors5[ai].seq.length(),
1013 >                 adaptors5[ai].pz, wseq.chars(), wlen, adaptors5[ai].amlen);
1014 >        }
1015 >         GXAlnInfo* aln=match_adaptor(seqdata, adaptors5[ai].trim_type, gxmem_l, 90);
1016 >         if (aln) {
1017 >           trimmed=true;
1018 >           if (aln->sl-1 > wlen-aln->sr) {
1019 >                   //keep left side
1020 >                   l3-=(wlen-aln->sl+1);
1021 >                   if (l3<0) l3=0;
1022 >                   }
1023 >           else { //keep right side
1024 >                   l5+=aln->sr;
1025 >                   if (l5>=rlen) l5=rlen-1;
1026 >                   }
1027 >           delete aln;
1028 >           if (l3-l5+1<min_read_len) return true;
1029 >           wseq=seq.substr(l5,l3-l5+1);
1030 >           wlen=wseq.length();
1031 >           }
1032 >         } //forward and reverse?
1033 >  }//for each 5' adaptor
1034 >  return trimmed;
1035 > }
1036  
1037 < //convert qvs to/from phred64 from/to phread33
1037 > //convert qvs to/from phred64 from/to phread33
1038   void convertPhred(GStr& q) {
1039   for (int i=0;i<q.length();i++) q[i]+=qv_cvtadd;
1040   }
# Line 1196 | Line 1043
1043   for (int i=0;i<len;i++) q[i]+=qv_cvtadd;
1044   }
1045  
1046 < bool getFastxRec(GLineReader& fq, GStr& rseq, GStr& rqv,
1046 > bool getFastxRec(GLineReader& fq, GStr& rseq, GStr& rqv,
1047            GStr& rname, GStr& rinfo, GStr& infname) {
1048   rseq="";
1049   rqv="";
# Line 1212 | Line 1059
1059        } //raw qseq format
1060   else { // FASTQ or FASTA */
1061   isfasta=(l[0]=='>');
1062 < if (!isfasta && l[0]!='@') GError("Error: fasta/fastq record marker not found(%s)\n%s\n",
1062 > if (!isfasta && l[0]!='@') GError("Error: fasta/fastq record marker not found(%s)\n%s\n",
1063        infname.chars(), l);
1064   GStr s(l);
1065   rname=&(l[1]);
1066   for (int i=0;i<rname.length();i++)
1067 <    if (rname[i]<=' ') {
1068 <       if (i<rname.length()-2) rinfo=rname.substr(i+1);
1069 <       rname.cut(i);
1070 <       break;
1067 >    if (rname[i]<=' ') {
1068 >       if (i<rname.length()-2) rinfo=rname.substr(i+1);
1069 >       rname.cut(i);
1070 >       break;
1071         }
1072    //now get the sequence
1073 < if ((l=fq.getLine())==NULL)
1073 > if ((l=fq.getLine())==NULL)
1074        GError("Error: unexpected EOF after header for read %s (%s)\n",
1075                     rname.chars(), infname.chars());
1076   rseq=l; //this must be the DNA line
1077   while ((l=fq.getLine())!=NULL) {
1078        //seq can span multiple lines
1079        if (l[0]=='>' || l[0]=='+') {
1080 <           fq.pushBack();
1080 >           fq.pushBack();
1081             break; //
1082             }
1083        rseq+=l;
1084 <      } //check for multi-line seq
1084 >      } //check for multi-line seq
1085   if (!isfasta) { //reading fastq quality values, which can also be multi-line
1086      if ((l=fq.getLine())==NULL)
1087          GError("Error: unexpected EOF after sequence for %s\n", rname.chars());
1088      if (l[0]!='+') GError("Error: fastq qv header marker not detected!\n");
1089 <    if ((l=fq.getLine())==NULL)
1089 >    if ((l=fq.getLine())==NULL)
1090          GError("Error: unexpected EOF after qv header for %s\n", rname.chars());
1091      rqv=l;
1092 <    //if (rqv.length()!=rseq.length())
1092 >    //if (rqv.length()!=rseq.length())
1093      //  GError("Error: qv len != seq len for %s\n", rname.chars());
1094      while (rqv.length()<rseq.length() && ((l=fq.getLine())!=NULL)) {
1095        rqv+=l; //append to qv string
# Line 1253 | Line 1100
1100   return true;
1101   }
1102  
1103 + #ifdef GDEBUG
1104 + void showTrim(GStr& s, int l5, int l3) {
1105 +  if (l5>0 || l3==0) {
1106 +    color_bg(c_red);
1107 +    }
1108 +  for (int i=0;i<s.length()-1;i++) {
1109 +    if (i && i==l5) color_resetbg();
1110 +    fprintf(stderr, "%c", s[i]);
1111 +    if (i && i==l3) color_bg(c_red);
1112 +   }
1113 +  fprintf(stderr, "%c", s[s.length()-1]);
1114 +  color_reset();
1115 +  fprintf(stderr, "\n");
1116 + }
1117 + #endif
1118 +
1119   char process_read(GStr& rname, GStr& rseq, GStr& rqv, int &l5, int &l3) {
1120 < //returns 0 if the read was untouched, 1 if it was just trimmed
1120 > //returns 0 if the read was untouched, 1 if it was just trimmed
1121   // and a trash code if it was trashed
1122   l5=0;
1123   l3=rseq.length()-1;
1124 + #ifdef GDEBUG
1125 +   //rseq.reverse();
1126 +   GMessage(">%s\n", rname.chars());
1127 +   GMessage("%s\n",rseq.chars());
1128 + #endif
1129   if (l3-l5+1<min_read_len) {
1130     return 's';
1131     }
# Line 1293 | Line 1161
1161     w5=0;
1162     w3=wseq.length()-1;
1163     }
1164 < if (a3len>0) {
1165 <  if (trim_adapter3(wseq, w5, w3)) {
1164 > char trim_code;
1165 > //clean the more dirty end first - 3'
1166 > int prev_w5=0;
1167 > int prev_w3=0;
1168 > bool w3upd=true;
1169 > bool w5upd=true;
1170 > do {
1171 >  trim_code=0;
1172 >  if (w3upd && trim_poly3(wseq, w5, w3, polyA_seed)) {
1173 >      trim_code='A';
1174 >      }
1175 >  else if (w3upd && trim_poly3(wseq, w5, w3, polyT_seed)) {
1176 >      trim_code='T';
1177 >      }
1178 >  else if (w5upd && trim_poly5(wseq, w5, w3, polyA_seed)) {
1179 >      trim_code='A';
1180 >      }
1181 >  else if (w5upd && trim_poly5(wseq, w5, w3, polyT_seed)) {
1182 >      trim_code='T';
1183 >      }
1184 >  else if (trim_adaptor5(wseq, w5, w3)) {
1185 >      trim_code='5';
1186 >      }
1187 >  else if (trim_adaptor3(wseq, w5, w3)) {
1188 >      trim_code='3';
1189 >      }
1190 >  if (trim_code) {
1191 >     w3upd=(w3!=prev_w3);
1192 >         w5upd=(w5!=prev_w5);
1193 >         if (w3upd) prev_w3=w3;
1194 >         if (w5upd) prev_w5=w5;
1195 >   #ifdef GDEBUG
1196 >     GMessage("#### TRIM by '%c' code ( w5-w3 = %d-%d ):\n",trim_code, w5,w3);
1197 >     showTrim(wseq, w5, w3);
1198 >   #endif
1199       int trimlen=wseq.length()-(w3-w5+1);
1200       num_trimmed3++;
1201 <     if (trimlen<min_trimmed3)
1201 >     if (trimlen<min_trimmed3)
1202           min_trimmed3=trimlen;
1203       l5+=w5;
1204       l3-=(wseq.length()-1-w3);
1205       if (w3-w5+1<min_read_len) {
1206 <         return '3';
1206 >         return trim_code;
1207           }
1208        //-- keep only the w5..w3 range
1209        wseq=wseq.substr(w5, w3-w5+1);
1210        if (!wqv.is_empty())
1211           wqv=wqv.substr(w5, w3-w5+1);
1212 <      }//some adapter was trimmed
1213 <   } //adapter trimming
1214 < if (a5len>0) {
1314 <  if (trim_adapter5(wseq, w5, w3)) {
1315 <     int trimlen=wseq.length()-(w3-w5+1);
1316 <     num_trimmed5++;
1317 <     if (trimlen<min_trimmed5)
1318 <         min_trimmed5=trimlen;
1319 <     l5+=w5;
1320 <     l3-=(wseq.length()-1-w3);
1321 <     if (w3-w5+1<min_read_len) {
1322 <         return '5';
1323 <         }
1324 <      //-- keep only the w5..w3 range
1325 <      wseq=wseq.substr(w5, w3-w5+1);
1326 <      if (!wqv.is_empty())
1327 <         wqv=wqv.substr(w5, w3-w5+1);
1328 <      }//some adapter was trimmed
1329 <   } //adapter trimming
1212 >      }//trimming at 3' end
1213 > } while (trim_code);
1214 >
1215   if (doCollapse) {
1216     //keep read for later
1217     FqDupRec* dr=dhash.Find(wseq.chars());
1218     if (dr==NULL) { //new entry
1219 <          //if (prefix.is_empty())
1220 <             dhash.Add(wseq.chars(),
1219 >          //if (prefix.is_empty())
1220 >             dhash.Add(wseq.chars(),
1221                    new FqDupRec(&wqv, rname.chars()));
1222            //else dhash.Add(wseq.chars(), new FqDupRec(wqv.chars(),wqv.length()));
1223           }
# Line 1366 | Line 1251
1251         fprintf(f_out, "%s\n", rseq.chars()); //plain one-line fasta for now
1252         }
1253        else {
1254 <       fprintf(f_out, ">%s%08d\n%s\n", prefix.chars(), outcounter,
1254 >       fprintf(f_out, ">%s%08d\n%s\n", prefix.chars(), outcounter,
1255                            rseq.chars());
1256         }
1257       }
# Line 1377 | Line 1262
1262         fprintf(f_out, "%s\n+\n%s\n", rseq.chars(), rqv.chars());
1263         }
1264        else
1265 <       fprintf(f_out, "@%s_%08d\n%s\n+\n%s\n", prefix.chars(), outcounter,
1265 >       fprintf(f_out, "@%s_%08d\n%s\n+\n%s\n", prefix.chars(), outcounter,
1266                            rseq.chars(),rqv.chars() );
1267       }
1268   }
# Line 1385 | Line 1270
1270   void trash_report(char trashcode, GStr& rname, FILE* freport) {
1271   if (freport==NULL || trashcode<=' ') return;
1272   if (trashcode=='3' || trashcode=='5') {
1273 <   fprintf(freport, "%s\tA%c\n",rname.chars(),trashcode);
1273 >   fprintf(freport, "%s\ta%c\n",rname.chars(),trashcode);
1274     }
1275   else {
1276     fprintf(freport, "%s\t%c\n",rname.chars(),trashcode);
# Line 1477 | Line 1362
1362      }
1363   }
1364  
1365 + void addAdaptor(GVec<CASeqData>& adaptors, GStr& seq, GAlnTrimType trim_type) {
1366 + //TODO: prepare CASeqData here, and collect hexamers as well
1367 +  if (seq.is_empty() || seq=="-" ||
1368 +          seq=="N/A" || seq==".") return;
1369 +
1370 + CASeqData adata(revCompl);
1371 + int idx=adaptors.Add(adata);
1372 + if (idx<0) GError("Error: failed to add adaptor!\n");
1373 + adaptors[idx].trim_type=trim_type;
1374 + adaptors[idx].update(seq.chars());
1375 + }
1376 +
1377  
1378 < int loadAdapters(const char* fname) {
1378 > int loadAdaptors(const char* fname) {
1379    GLineReader lr(fname);
1380    char* l;
1381    while ((l=lr.nextLine())!=NULL) {
1382     if (lr.length()<=3 || l[0]=='#') continue;
1383 <   char* s5;
1384 <   char* s3;
1488 <   if (isspace(l[0]) || l[0]==',' || l[0]==';'|| l[0]==':') {
1383 >   if ( l[0]==' ' || l[0]=='\t' || l[0]==',' ||
1384 >        l[0]==';'|| l[0]==':' ) {
1385        int i=1;
1386        while (l[i]!=0 && isspace(l[i])) {
1387          i++;
1388          }
1389        if (l[i]!=0) {
1390 <        adapters.Add(new CAdapters(NULL, &(l[i])));
1390 >        GStr s(&(l[i]));
1391 >      #ifdef GDEBUG
1392 >          //s.reverse();
1393 >      #endif
1394 >        addAdaptor(adaptors3, s, galn_TrimRight);
1395          continue;
1396          }
1397        }
1398      else {
1399 <      p=l;
1400 <      while (*delpos!='\0' && strchr(fTokenDelimiter, *delpos)!=NULL)
1401 <             delpos++;
1402 <      s5.startTokenize("\t ;,:",);
1403 <      s5.nextToken(s3);
1399 >      GStr s(l);
1400 >      s.startTokenize("\t ;,:");
1401 >      GStr a5,a3;
1402 >      if (s.nextToken(a5))
1403 >            s.nextToken(a3);
1404 >        else continue; //no tokens on this line
1405 >      GAlnTrimType ttype5=galn_TrimLeft;
1406 >      a5.upper();
1407 >      a3.upper();
1408 >      if (a3.is_empty() || a3==a5 || a3=="=") {
1409 >         a3.clear();
1410 >         ttype5=galn_TrimEither;
1411 >         }
1412 >     #ifdef GDEBUG
1413 >     //   a5.reverse();
1414 >     //   a3.reverse();
1415 >     #endif
1416 >      addAdaptor(adaptors5, a5, ttype5);
1417 >      addAdaptor(adaptors3, a3, galn_TrimRight);
1418        }
1419     }
1420 <
1420 >   return adaptors5.Count()+adaptors3.Count();
1421   }
1422  
1423 < void setupFiles(FILE*& f_in, FILE*& f_in2, FILE*& f_out, FILE*& f_out2,
1424 <                       GStr& s, GStr& infname, GStr& infname2) {
1423 > void setupFiles(FILE*& f_in, FILE*& f_in2, FILE*& f_out, FILE*& f_out2,
1424 >                       GStr& s, GStr& infname, GStr& infname2) {
1425   // uses outsuffix to generate output file names and open file handles as needed
1426   infname="";
1427   infname2="";
# Line 1535 | Line 1449
1449   s.startTokenize(",:");
1450   s.nextToken(infname);
1451   bool paired=s.nextToken(infname2);
1452 < if (fileExists(infname.chars())==0)
1452 > if (fileExists(infname.chars())==0)
1453      GError("Error: cannot find file %s!\n",infname.chars());
1454   GStr fname(getFileName(infname.chars()));
1455   GStr picmd;
# Line 1557 | Line 1471
1471   if (!paired) return;
1472   if (doCollapse) GError("Error: sorry, -C option cannot be used with paired reads!\n");
1473   // ---- paired reads:-------------
1474 < if (fileExists(infname2.chars())==0)
1474 > if (fileExists(infname2.chars())==0)
1475       GError("Error: cannot find file %s!\n",infname2.chars());
1476   picmd="";
1477   GStr fname2(getFileName(infname2.chars()));

Diff Legend

Removed lines
+ Added lines
< Changed lines
> Changed lines