ViewVC Help
View File | Revision Log | Show Annotations | View Changeset | Root Listing
root/gclib/fqtrim/fqtrim.cpp
(Generate patch)
# Line 3 | Line 3
3   #include "GHash.hh"
4   #include "GList.hh"
5   #include <ctype.h>
6 + #include "GAlnExtend.h"
7  
8   #define USAGE "Usage:\n\
9   fqtrim [{-5 <5adapter> -3 <3adapter>|-f <adapters_file>}] [-a <min_matchlen>]\\\n\
# Line 30 | Line 31
31      (e.g. -5 CGACAGGTTCAGAGTTCTACAGTCCGACGATC)\n\
32   -3  trim the given adapter sequence at the 3' end of each read\n\
33      (e.g. -3 TCGTATGCCGTCTTCTGCTTG)\n\
34 < -a  minimum length of exact match to adaptor sequence at the proper end (6)\n\
34 > -A  disable polyA trimming (enabled by default)\n\
35 > -T  enable polyT trimming (disabled by default)\n\
36 > -y  minimum length of exact match to adaptor sequence at the proper end (6)\n\
37   -q  trim bases with quality value lower than <minq> (starting at the 3' end)\n\
38   -t  for -q option, maximum trimming at the 3' end is limited to <trim_max_len>\n\
39   -m  maximum percentage of Ns allowed in a read after trimming (default 7)\n\
# Line 75 | Line 78
78   bool isfasta=false;
79   bool convert_phred=false;
80   GStr outsuffix; // -o
78 //GStr adapter3;
79 //GStr adapter5;
81   GStr prefix;
82   GStr zcmd;
83   int num_trimmed5=0;
# Line 91 | Line 92
92   int qv_phredtype=0; // could be 64 or 33 (0 means undetermined yet)
93   int qv_cvtadd=0; //could be -31 or +31
94  
95 < int a3len=0;
96 < int a5len=0;
97 < // adaptor matching metrics -- for extendMatch() function
98 < const int a_m_score=2; //match score
99 < const int a_mis_score=-3; //mismatch
100 < const int a_dropoff_score=7;
101 < int a_min_score=12; //an exact match of 6 bases at the proper ends WILL be trimmed
102 < const int a_min_chain_score=15; //for gapped alignments
103 <
104 < class CSegChain;
105 <
106 < class CSegPair {
107 <  public:
107 <   GSeg a;
108 <   GSeg b; //the adapter segment
109 <   int score;
110 <   int flags;
111 <   CSegChain* chain;
112 <   CSegPair(int astart=0, int aend=0, int bstart=0, int bend=0, int mscore=0):a(astart,aend),b(bstart, bend) {
113 <      score=mscore;
114 <      if (score==0) score=a.len()*a_m_score;
115 <      flags=0;
116 <      chain=NULL;
95 > // adaptor matching metrics -- for X-drop ungapped extension
96 > const int poly_m_score=2; //match score
97 > const int poly_mis_score=-3; //mismatch
98 > const int poly_dropoff_score=7;
99 > int poly_minScore=12; //i.e. an exact match of 6 bases at the proper ends WILL be trimmed
100 >
101 > const char *polyA_seed="AAAA";
102 > const char *polyT_seed="TTTT";
103 >
104 > struct CAdapters {
105 >    GStr a5;
106 >    GStr a3;
107 >    CAdapters(const char* s5=NULL, const char* s3=NULL):a5(s5),a3(s3) {
108        }
109 <   int len() { return  a.len(); }
119 <   bool operator==(CSegPair& d){
120 <      //return (a.start==d.a.start && a.end==d.a.end && b.start==d.b.start && b.end==d.b.end);
121 <      //make equal even segments that are included into one another:
122 <      return (d.a.start>=a.start && d.a.end<=a.end && d.b.start>=b.start && d.b.end<=b.end);
123 <      }
124 <   bool operator>(CSegPair& d){ //ordering based on b (adaptor) start coord and score
125 <     if (b.start==d.b.start) {
126 <        if (score==d.score) {
127 <           //just try to be consistent:
128 <           if (b.end==d.b.end) {
129 <             return (a.start==d.a.start)?(a.end<d.a.end):(a.start<d.a.start);
130 <             }
131 <           return (b.end>d.b.end);
132 <           }
133 <         else return (score<d.score);
134 <        }
135 <     return (b.start>d.b.start);
136 <     }
137 <   bool operator<(CSegPair& d){ //ordering based on b (adaptor) coord
138 <     /*if (b.start==d.b.start && b.end==d.b.end) {
139 <          return (a.start==d.a.start)?(a.end<d.a.end):(a.start<d.a.start);
140 <          }
141 <     return (b.start==d.b.start)?(b.end<d.b.end):(b.start<d.b.start);*/
142 <     if (b.start==d.b.start) {
143 <        if (score==d.score) {
144 <           //just try to be consistent:
145 <           if (b.end==d.b.end) {
146 <             return (a.start==d.a.start)?(a.end>d.a.end):(a.start>d.a.start);
147 <             }
148 <           return (b.end<d.b.end);
149 <           }
150 <         else return (score>d.score);
151 <        }
152 <     return (b.start<d.b.start);
153 <     }
154 < };
155 <
156 < int cmpSegEnds(pointer sa, pointer sb) { //sort by adaptor seg ends AND score
157 < CSegPair& x = *(CSegPair *)sa;
158 < CSegPair& y = *(CSegPair *)sb;
159 < /*
160 < if (x.b.end==y.b.end) {
161 <     if (x.b.start==y.b.start) {
162 <         if (x.a.end==y.a.end) {
163 <            if (x.a.start==y.a.start) return 0;
164 <            return ((x.a.start>y.a.start) ? -1 : 1);
165 <            }
166 <          else {
167 <            return ((x.a.end>y.a.end) ? -1 : 1);
168 <            }
169 <          }
170 <      else {
171 <       return ((x.b.start>y.b.start) ? -1 : 1);
172 <       }
173 <     }
174 <    else {
175 <     return ((x.b.end>y.b.end) ? -1 : 1);
176 <     }
177 < */
178 <  if (x.b.end==y.b.end) {
179 <     if (x.score==y.score) {
180 <     if (x.b.start==y.b.start) {
181 <         if (x.a.end==y.a.end) {
182 <            if (x.a.start==y.a.start) return 0;
183 <            return ((x.a.start<y.a.start) ? -1 : 1);
184 <            }
185 <          else {
186 <            return ((x.a.end<y.a.end) ? -1 : 1);
187 <            }
188 <          }
189 <      else {
190 <       return ((x.b.start<y.b.start) ? -1 : 1);
191 <       }
192 <      } else return ((x.score>y.score) ? -1 : 1);
193 <     }
194 <    else {
195 <     return ((x.b.end>y.b.end) ? -1 : 1);
196 <     }
197 <
198 < }
109 > };
110  
111 < class CSegChain:public GList<CSegPair> {
201 < public:
202 <   uint astart;
203 <   uint aend;
204 <   uint bstart;
205 <   uint bend;
206 <   int score;
207 <   bool endSort;
208 <  CSegChain(bool aln5=false):GList<CSegPair>(true,true,true) {//sorted, free elements, unique
209 <   //as SegPairs are inserted, they will be sorted by a.start coordinate
210 <   score=0;
211 <   astart=MAX_UINT;
212 <   aend=0;
213 <   bstart=MAX_UINT;
214 <   bend=0;
215 <   endSort=aln5;
216 <   if (aln5) { setSorted(cmpSegEnds); }
217 <   }
218 < bool operator==(CSegChain& d) {
219 <   //return (score==d.score);
220 <    return (astart==d.astart && aend==d.aend && bstart==d.bstart && bend==d.bend);
221 <   }
222 < bool operator>(CSegChain& d) { // order based on b (adaptor) coordinate
223 <   //return (score<d.score);
224 <   if (bstart==d.bstart && bend==d.bend) {
225 <          return (astart==d.astart)?(aend>d.aend):(astart>d.astart);
226 <          }
227 <     return (bstart==d.bstart)?(bend>d.bend):(bstart>d.bstart);
228 <   }
229 < bool operator<(CSegChain& d) {
230 <   //return (score>d.score);
231 <   if (bstart==d.bstart && bend==d.bend) {
232 <          return (astart==d.astart)?(aend<d.aend):(astart<d.astart);
233 <          }
234 <     return (bstart==d.bstart)?(bend<d.bend):(bstart<d.bstart);
235 <   }
236 < void addSegPair(CSegPair* segp) {
237 <   if (AddIfNew(segp)!=segp) return;
238 <   score+=segp->score;
239 <   if (astart>segp->a.start) astart=segp->a.start;
240 <   if (aend<segp->a.end) aend=segp->a.end;
241 <   if (bstart>segp->b.start) bstart=segp->b.start;
242 <   if (bend<segp->b.end) bend=segp->b.end;
243 <   }
244 < //for building actual chains:
245 < bool extendChain(CSegPair* segp) { //segp expected to be "Greater Than" current chain
246 <   int bgap=0;
247 <   int agap=0;
248 <   //if (endSort) {
249 <   if (bstart>segp->b.start) {
250 <      bgap = (int)(bstart-segp->b.end);
251 <      if (abs(bgap)>2) return false;
252 <      agap = (int)(astart-segp->a.end);
253 <      if (abs(agap)>2) return false;
254 <      }
255 <     else {
256 <      bgap = (int) (segp->b.start-bend);
257 <      if (abs(bgap)>2) return false;
258 <      agap = (int)(segp->a.start-aend);
259 <      if (abs(agap)>2) return false;
260 <      }
261 <   if (agap*bgap<0) return false;
262 <   addSegPair(segp);
263 <   score-=abs(agap)+abs(bgap);
264 <   return true;
265 <   }
266 < };
111 > GPVec<CAdapters> adapters;
112  
113   // element in dhash:
114   class FqDupRec {
# Line 313 | Line 158
158  
159   GHash<FqDupRec> dhash; //hash to keep track of duplicates
160  
161 + int loadAdapters(const char* fname);
162 +
163   void setupFiles(FILE*& f_in, FILE*& f_in2, FILE*& f_out, FILE*& f_out2,
164                         GStr& s, GStr& infname, GStr& infname2);
165   // uses outsuffix to generate output file names and open file handles as needed
# Line 329 | Line 176
176   bool ntrim(GStr& rseq, int &l5, int &l3); //returns true if any trimming occured
177   bool qtrim(GStr& qvs, int &l5, int &l3); //return true if any trimming occured
178   int dust(GStr& seq);
179 < bool trim_adapter3(GStr& seq, int &l5, int &l3); //returns true if any trimming occured
179 > bool trim_poly5(GStr &seq, int &l5, int &l3, const char* poly_seed); //returns true if any trimming occured
180 > bool trim_poly3(GStr &seq, int &l5, int &l3, const char* poly_seed);
181   bool trim_adapter5(GStr& seq, int &l5, int &l3); //returns true if any trimming occured
182 + bool trim_adapter3(GStr& seq, int &l5, int &l3);
183  
184   void convertPhred(char* q, int len);
185   void convertPhred(GStr& q);
# Line 387 | Line 236
236         else
237           GMessage("%s\nInvalid value for -p option (can only be 64 or 33)!\n",USAGE);
238       }
239 <  if (args.getOpt('3')!=NULL) {
240 <    adapter3=args.getOpt('3');
241 <    adapter3.upper();
242 <    a3len=adapter3.length();
243 <    }
244 <  if (args.getOpt('5')!=NULL) {
245 <    adapter5=args.getOpt('5');
246 <    adapter5.upper();
247 <    a5len=adapter5.length();
239 >  s=args.getOpt('f');
240 >  if (!s.is_empty()) {
241 >   loadAdapters(s.chars());
242 >   }
243 >  bool fileAdapters=adapters.Count();
244 >  s=args.getOpt('5');
245 >  if (!s.is_empty()) {
246 >    if (fileAdapters)
247 >      GError("Error: options -5 and -f cannot be used together!\n");
248 >    s.upper();
249 >    adapters.Add(new CAdapters(s.chars()));
250      }
251 <  s=args.getOpt('a');
251 >  s=args.getOpt('3');
252    if (!s.is_empty()) {
253 <     int a_minmatch=s.asInt();
254 <     a_min_score=a_minmatch<<1;
253 >    if (fileAdapters)
254 >      GError("Error: options -3 and -f cannot be used together!\n");
255 >    s.upper();
256 >    if (adapters.Count()>0)
257 >          adapters[0]->a3=s.chars();
258 >     else adapters.Add(NULL, new CAdapters(s.chars()));
259 >    }
260 >  s=args.getOpt('y');
261 >  if (!s.is_empty()) {
262 >     int minmatch=s.asInt();
263 >     poly_minScore=minmatch*poly_m_score;
264       }
265    
266    if (args.getOpt('o')!=NULL) outsuffix=args.getOpt('o');
# Line 856 | Line 716
716   return ncount;
717   }
718  
859
860 // ------------------ adapter matching - simple k-mer seed & extend, no indels for now
861 //when a k-mer match is found, simply try to extend the alignment using a drop-off scheme
862 //check minimum score and
863 //for 3' adapter trimming:
864 //     require that the right end of the alignment for either the adaptor OR the read must be
865 //     < 3 distance from its right end
866 // for 5' adapter trimming:
867 //     require that the left end of the alignment for either the adaptor OR the read must
868 //     be at coordinate < 3 from start
869
870 bool extendMatch(const char* a, int alen, int ai,
871                 const char* b, int blen, int bi, int mlen, int& l5, int& l3, CSegChain& segs, bool end5=false) {
872 //so the alignment starts at ai in a, bi in b, with a perfect match of length mlen
873 #ifdef DEBUG
874 GStr dbg(b);
875 #endif
876 //if (debug) {
877 //  GMessage(">> in %s\n\textending hit: %s at position %d\n", a, (dbg.substr(bi, mlen)).chars(), ai);
878 //  }
879 int a_l=ai; //alignment coordinates on a
880 int a_r=ai+mlen-1;
881 int b_l=bi; //alignment coordinates on b
882 int b_r=bi+mlen-1;
883 int ai_maxscore=ai;
884 int bi_maxscore=bi;
885 int score=mlen*a_m_score;
886 int maxscore=score;
887 int mism5score=a_mis_score;
888 if (end5 && ai<(alen>>1)) mism5score-=2; // increase penalty for mismatches at 5' end
889 //try to extend to the left first, if possible
890 while (ai>0 && bi>0) {
891   ai--;
892   bi--;
893   score+= (a[ai]==b[bi])? a_m_score : mism5score;
894   if (score>maxscore) {
895       ai_maxscore=ai;
896       bi_maxscore=bi;
897       maxscore=score;
898       }
899     else if (maxscore-score>a_dropoff_score) break;
900   }
901 a_l=ai_maxscore;
902 b_l=bi_maxscore;
903 //if (debug) GMessage("  after l-extend: %*s%s\t\t(score=%d)\n",a_l," ",dbg.substr(b_l,b_r-b_l+1).chars(),maxscore);
904 //now extend to the right
905 ai_maxscore=a_r;
906 bi_maxscore=b_r;
907 ai=a_r;
908 bi=b_r;
909 score=maxscore;
910 //sometimes there are extra AAAAs at the end of the read, ignore those
911 if (strcmp(&a[alen-4],"AAAA")==0) {
912    alen-=3;
913    while (a[alen-1]=='A' && alen>ai) alen--;
914    }
915 while (ai<alen-1 && bi<blen-1) {
916   ai++;
917   bi++;
918   //score+= (a[ai]==b[bi])? a_m_score : a_mis_score;
919   if (a[ai]==b[bi]) { //match
920      score+=a_m_score;
921      if (ai>=alen-2) {
922           score+=a_m_score-(alen-ai-1);
923           }
924      }
925    else { //mismatch
926      score+=a_mis_score;
927      }  
928   if (score>maxscore) {
929       ai_maxscore=ai;
930       bi_maxscore=bi;
931       maxscore=score;
932       }
933     else if (maxscore-score>a_dropoff_score) break;
934   }
935  a_r=ai_maxscore;
936  b_r=bi_maxscore;
937  int a_ovh3=alen-a_r-1;
938  int b_ovh3=blen-b_r-1;
939  int mmovh3=(a_ovh3<b_ovh3)? a_ovh3 : b_ovh3;
940  int mmovh5=(a_l<b_l)? a_l : b_l;
941  //if (debug) GMessage("  after r-extend: %*s%s\t\t(score=%d)\n",a_l," ",dbg.substr(b_l,b_r-b_l+1).chars(),maxscore);
942 #ifdef DEBUG
943  if (debug) GMessage("     extended to: %*s\n",a_r+1,dbg.substr(b_l,b_r-b_l+1).chars());
944 #endif
945  if (maxscore>=a_min_score && mmovh3<2 && mmovh5<2) {
946     if (a_l<a_ovh3) {
947        //adapter closer to the left end (typical for 5' adapter)
948        l5=a_r+1;
949        l3=alen-1;
950        }
951      else {
952        //adapter matching at the right end (typical for 3' adapter)
953        l5=0;
954        l3=a_l-1;
955        }
956     return true;
957     }
958 else { //keep this segment pair for later (gapped alignment)
959   segs.addSegPair(new CSegPair(a_l+1, a_r+1, b_l+1, b_r+1, maxscore));
960   //this will also update min & max coordinates in segs (segs.astart, .aend, .bstart, .bend)
961   }
962  //do not trim:
963  l5=0;
964  l3=alen-1;
965  return false;
966 }
967
968 /*
969 int getWordValue(const char* s, int wlen) {
970 int r=0;
971 while (wlen--) { r+=(((int)s[wlen])<<wlen) }
972 return r;
973 }
974 */
719   int get3mer_value(const char* s) {
720   return (s[0]<<16)+(s[1]<<8)+s[2];
721   }
# Line 995 | Line 739
739   return -1;
740   }
741  
742 < int fast4match(int32 qv, const char* str, int slen, int start_index=0) {
743 < if (start_index>=slen || start_index<0) return -1;
744 < for (int i=start_index;i<slen-4;i++) {
745 <   int32* rv=(int32*)(str+i);
746 <   if (*rv==qv) return i;
747 <   }
748 < return -1;
749 < }
742 > struct SLocScore {
743 >  int pos;
744 >  int score;
745 >  SLocScore(int p=0,int s=0) {
746 >    pos=p;
747 >    score=s;
748 >    }
749 >  void set(int p, int s) {
750 >    pos=p;
751 >    score=s;
752 >    }
753 >  void add(int p, int add) {
754 >    pos=p;
755 >    score+=add;
756 >    }
757 > };
758  
759 < int fast4rmatch(int32 qv, const char* str, int slen, int end_index=-1) {
760 < if (end_index>=slen) return -1;
761 < if (end_index<0) end_index=slen-1;
762 < for (int i=end_index-3;i>=0;i--) {
763 <   int32* rv=(int32*)(str+i);
764 <   if (*rv==qv) return i;
759 > bool trim_poly3(GStr &seq, int &l5, int &l3, const char* poly_seed) {
760 > int rlen=seq.length();
761 > l5=0;
762 > l3=rlen-1;
763 > int32 seedVal=*(int32*)poly_seed;
764 > char polyChar=poly_seed[0];
765 > //assumes N trimming was already done
766 > //so a poly match should be very close to the end of the read
767 > // -- find the initial match (seed)
768 > int lmin=GMAX((rlen-12), 0);
769 > int li;
770 > for (li=rlen-4;li>lmin;li--) {
771 >   if (seedVal==*(int*)&(seq[li])) {
772 >      break;
773 >      }
774     }
775 < return -1;
776 < }
775 > if (li<=lmin) return false;
776 > //seed found, try to extend it both ways
777 > //extend right
778 > int ri=li+3;
779 > SLocScore loc(ri, poly_m_score<<2);
780 > SLocScore maxloc(loc);
781 > //extend right
782 > while (ri<rlen-2) {
783 >   ri++;
784 >   if (seq[ri]==polyChar) {
785 >                loc.add(ri,poly_m_score);
786 >                }
787 >   else if (seq[ri]=='N') {
788 >                loc.add(ri,0);
789 >                }
790 >   else { //mismatch
791 >        loc.add(ri,poly_mis_score);
792 >        if (maxloc.score-loc.score>poly_dropoff_score) break;
793 >        }
794 >   if (maxloc.score<=loc.score) {
795 >      maxloc=loc;
796 >      }
797 >   }
798 > ri=maxloc.pos;
799 > if (ri<rlen-3) return false; //no trimming wanted, too far from 3' end
800 > //ri = right boundary for the poly match
801 > //extend left
802 > loc.set(li, maxloc.score);
803 > maxloc.pos=li;
804 > while (li>0) {
805 >    li--;
806 >    if (seq[li]==polyChar) {
807 >                 loc.add(li,poly_m_score);
808 >                 }
809 >    else if (seq[li]=='N') {
810 >                 loc.add(li,0);
811 >                 }
812 >    else { //mismatch
813 >         loc.add(li,poly_mis_score);
814 >         if (maxloc.score-loc.score>poly_dropoff_score) break;
815 >         }
816 >    if (maxloc.score<=loc.score) {
817 >       maxloc=loc;
818 >       }
819 >    }
820 > if (maxloc.score>poly_minScore && ri>=rlen-3) {
821 >    l5=li;
822 >    l3=ri;
823 >    return true;
824 >    }
825 > return false;
826 > }
827  
828 < #ifdef DEBUG
829 < void dbgPrintChain(CSegChain& chain, const char* aseq) {
830 <  GStr s(aseq);
831 <  for (int i=0;i<chain.Count();i++) {
832 <   CSegPair& seg=*chain[i];
833 <   GMessage("  dbg chain seg%d: %*s [%d-%d:%d-%d]\n",i,seg.a.start-1+seg.len(),
834 <            s.substr(seg.b.start-1, seg.len()).chars(), seg.b.start,seg.b.end,seg.a.start,seg.a.end);
828 >
829 > bool trim_poly5(GStr &seq, int &l5, int &l3, const char* poly_seed) {
830 > int rlen=seq.length();
831 > l5=0;
832 > l3=rlen-1;
833 > int32 seedVal=*(int32*)poly_seed;
834 > char polyChar=poly_seed[0];
835 > //assumes N trimming was already done
836 > //so a poly match should be very close to the end of the read
837 > // -- find the initial match (seed)
838 > int lmax=GMIN(8, rlen-4);//how far from 5' end to look for 4-mer seeds
839 > int li;
840 > for (li=0;li<=lmax;li++) {
841 >   if (seedVal==*(int*)&(seq[li])) {
842 >      break;
843 >      }
844     }
845 + if (li>lmax) return false;
846 + //seed found, try to extend it both ways
847 + //extend left
848 + int ri=li+3; //save rightmost base of the seed
849 + SLocScore loc(li, poly_m_score<<2);
850 + SLocScore maxloc(loc);
851 + while (li>0) {
852 +    li--;
853 +    if (seq[li]==polyChar) {
854 +                 loc.add(li,poly_m_score);
855 +                 }
856 +    else if (seq[li]=='N') {
857 +                 loc.add(li,0);
858 +                 }
859 +    else { //mismatch
860 +         loc.add(li,poly_mis_score);
861 +         if (maxloc.score-loc.score>poly_dropoff_score) break;
862 +         }
863 +    if (maxloc.score<=loc.score) {
864 +       maxloc=loc;
865 +       }
866 +    }
867 + li=maxloc.pos;
868 + if (li>3) return false; //no trimming wanted, too far from 5' end
869 + //li = right boundary for the poly match
870 +
871 + //extend right
872 + loc.set(ri, maxloc.score);
873 + maxloc.pos=ri;
874 + while (ri<rlen-2) {
875 +   ri++;
876 +   if (seq[ri]==polyChar) {
877 +                loc.add(ri,poly_m_score);
878 +                }
879 +   else if (seq[ri]=='N') {
880 +                loc.add(ri,0);
881 +                }
882 +   else { //mismatch
883 +        loc.add(ri,poly_mis_score);
884 +        if (maxloc.score-loc.score>poly_dropoff_score) break;
885 +        }
886 +   if (maxloc.score<=loc.score) {
887 +      maxloc=loc;
888 +      }
889 +   }
890 +
891 + if (maxloc.score>poly_minScore && li<=3) {
892 +    l5=li;
893 +    l3=ri;
894 +    return true;
895 +    }
896 + return false;
897   }
1026 #endif
898  
899   bool trim_adapter3(GStr& seq, int&l5, int &l3) {
900   int rlen=seq.length();
# Line 1378 | Line 1249
1249        }
1250      }// fastq
1251   // } //<-- FASTA or FASTQ
1252 < rseq.upper(); //TODO: what if we care about masking?
1252 > rseq.upper();
1253   return true;
1254   }
1255  
# Line 1606 | Line 1477
1477      }
1478   }
1479  
1480 +
1481 + int loadAdapters(const char* fname) {
1482 +  GLineReader lr(fname);
1483 +  char* l;
1484 +  while ((l=lr.nextLine())!=NULL) {
1485 +   if (lr.length()<=3 || l[0]=='#') continue;
1486 +   char* s5;
1487 +   char* s3;
1488 +   if (isspace(l[0]) || l[0]==',' || l[0]==';'|| l[0]==':') {
1489 +      int i=1;
1490 +      while (l[i]!=0 && isspace(l[i])) {
1491 +        i++;
1492 +        }
1493 +      if (l[i]!=0) {
1494 +        adapters.Add(new CAdapters(NULL, &(l[i])));
1495 +        continue;
1496 +        }
1497 +      }
1498 +    else {
1499 +      p=l;
1500 +      while (*delpos!='\0' && strchr(fTokenDelimiter, *delpos)!=NULL)
1501 +             delpos++;
1502 +      s5.startTokenize("\t ;,:",);
1503 +      s5.nextToken(s3);
1504 +      }
1505 +   }
1506 +
1507 + }
1508 +
1509   void setupFiles(FILE*& f_in, FILE*& f_in2, FILE*& f_out, FILE*& f_out2,
1510                         GStr& s, GStr& infname, GStr& infname2) {
1511   // uses outsuffix to generate output file names and open file handles as needed

Diff Legend

Removed lines
+ Added lines
< Changed lines
> Changed lines