Bioinformatics.org
[NEU MS in Bioinformatics]
Not logged in

Bioinformatics.org
Membership (37265+) Group hosting [?]

Careers
About bioinformatics
Bioinformatics training
Bioinformatics jobs

Research
All information groups
Online databases Online analysis tools Online education tools More tools

Development
All software groups
FTP repository
SVN & CVS repositories [?]
Mailing lists

Forums
News & Commentary
Jobs Forum
(Career Center)

News & Commentary - Message forums

Request for Comments: a Multi-threaded Java Blast Client
Submitted by Chunnuan Chen; posted on Saturday, October 12, 2002 (5 comments)
Submitter Hi,

I have registered the Multi-threaded Java Blast Client at bioinformatics.org ([link]). This is a standalone (no web interface needed) BLAST client using Java Swing components. It can run BLAST similarity searches based on input sequence(s) or the Request IDs given out by NCBI's QBLAST in both batch and multi-threaded modes. Hope it can help you do your daily BLAST work more efficiently.

Please check it out and your suggestions/comments are very much welcome.

Thanks,

Chun-Nuan

Expanded view | Monitor forum | Save place

ABOUT CLIENT
Submitted by Nobody; posted on Tuesday, August 12, 2003
dear friend I am a final year student involved in chat server project.I have face a lot of problem when i want to start "THREADED IN JAVA".I have clear concept in the fields of c++ . thank you send mail in the following: sanju25_dinda@indiatimes.com
tdtydyt
Submitted by Nobody; posted on Sunday, February 01, 2004
ftdf7d7dc7d7gu78g8i
.*[^\W]+.*
Submitted by Nobody; posted on Thursday, June 03, 2004
AACTAATTGCCTCACATTGTCACTGCAAATCGACACCTA TTAATGGGTCTCACCTCCCAACTGCTTCCCCCTCTGTTCTTCCTGCTAGCATGTGCCGG
.*[Bb]lastn.*
Submitted by Nobody; posted on Thursday, June 03, 2004
AACTAATTGCCTCACATTGTCACTGCAAATCGACACCTA TTAATGGGTCTCACCTCCCAACTGCTTCCCCCTCTGTTCTTCCTGCTAGCATGTGCCGG
.*[Bb]lastn.*
Submitted by Nobody; posted on Thursday, June 03, 2004
AACTAATTGCCTCACATTGTCACTGCAAATCGACACCTA TTAATGGGTCTCACCTCCCAACTGCTTCCCCCTCTGTTCTTCCTGCTAGCATGTGCCGG
Start a new thread:
You have to be logged in to post a reply.

 

Copyright © 2016 · Scilico, LLC