Bioinformatics.org
[NEU MS in Health Informatics]
Not logged in
  • Log in
  • Bioinformatics.org
    Membership (37753+) Group hosting [?]
  • Wiki
  • Franklin Award
  • Sponsorships
  • Careers
    About bioinformatics
    Bioinformatics training
    Bioinformatics jobs

    Research
    All information groups
    Online databases Online analysis tools Online education tools More tools

    Development
    All software groups
    FTP repository
    SVN & CVS repositories [?]
    Mailing lists

    Forums
    News & Commentary
  • Submit
  • Archives
  • Subscribe

  • Jobs Forum
    (Career Center)
  • Submit
  • Archives
  • Subscribe
  • News & Commentary - Message forums

    Request for Comments: a Multi-threaded Java Blast Client
    Submitted by Chunnuan Chen; posted on Saturday, October 12, 2002 (5 comments)

    Submitter

    Hi,

    I have registered the Multi-threaded Java Blast Client at bioinformatics.org (www.bioinformatics.org/javablastclient). This is a standalone (no web interface needed) BLAST client using Java Swing components. It can run BLAST similarity searches based on input sequence(s) or the Request IDs given out by NCBI's QBLAST in both batch and multi-threaded modes. Hope it can help you do your daily BLAST work more efficiently.

    Please check it out and your suggestions/comments are very much welcome.

    Thanks,

    Chun-Nuan

    Expanded view | Monitor forum | Save place

    Message
    .*[^\W]+.*
    Submitted by Nobody; posted on Thursday, June 03, 2004
    AACTAATTGCCTCACATTGTCACTGCAAATCGACACCTA TTAATGGGTCTCACCTCCCAACTGCTTCCCCCTCTGTTCTTCCTGCTAGCATGTGCCGG



    Post a followup to this message:
    You have to be logged in to post a reply.
    Thread view
    .*[^\W]+.*
    Submitted by Nobody; posted on Thursday, June 03, 2004
    AACTAATTGCCTCACATTGTCACTGCAAATCGACACCTA TTAATGGGTCTCACCTCCCAACTGCTTCCCCCTCTGTTCTTCCTGCTAGCATGTGCCGG

     

    Copyright © 2016 · Scilico, LLC