Bioinformatics.org
[NEU MS in Health Informatics]
Not logged in
  • Log in
  • Bioinformatics.org
    Membership (37673+) Group hosting [?]
  • Wiki
  • Franklin Award
  • Sponsorships
  • Careers
    About bioinformatics
    Bioinformatics training
    Bioinformatics jobs

    Research
    All information groups
    Online databases Online analysis tools Online education tools More tools

    Development
    All software groups
    FTP repository
    SVN & CVS repositories [?]
    Mailing lists

    Forums
    News & Commentary
  • Submit
  • Archives
  • Subscribe

  • Jobs Forum
    (Career Center)
  • Submit
  • Archives
  • Subscribe
  • Distributed Computing Power Proj (empty) - Message forums

    Discussion forums: Open Discussion

    Expanded view | Monitor forum | Save place

    Message
    Project HIV-1 - Still alive?
    Submitted by Nobody; posted on Sunday, October 06, 2002
    Hello, I just came upon this project, and was wondering if anyone was still interested in doing this... I have a large array of hardware and programming skills that I would be willing to put to use in this project. dh003i - Let me know if you're still interested by posting to the thread. Thanks



    Post a followup to this message:
    You have to be logged in to post a reply.
    Thread view
    Project
    Submitted by Nobody; posted on Tuesday, June 05, 2001
    If there is someone out there that would like to use this project to compute some data let me know. Thanks
    Project HIV-1
    Submitted by David J. Heinrich; posted on Monday, May 13, 2002
    As a preface to this post, let me say that I don't know what the particular specializations of any members of bioinformatics.org are: that is, whether people are mostly computer-oriented, or mostly biology oriented. Thus, if I state the obvious, please forgive me. As you all know, HIV-1 is a retrovirus. It infects its hosts (namely, humans) by reverse transcribing its RNA into DNA, which then integrates with the host genome's DNA; at this point, it usually remains dormant for sometime, until it is (for reasons not yet completely understood) activated. For background, the HIV1 genome is composed of nine genes, encoding fifteen proteins: gag, encoding MA, CA, NC, p2, and p6; pol, encoding PR, RT, and IN; vif, encoding Vif; vpr, encoding Vpr; tat, encoding Tat; vpu, encoding Vpu; env, encoding SU and TM; and nef, encoding Nef. A brief review of these fifteen proteins, in order of their function in the HIV-1 life cycle, may be helpful. The Tat protein enhances the processivity of transcribing polymerases of the transcription complexes initiated at the HIV-1 promoter, and may enhance transcription initiation rates; thus, it increases HIV-1 mRNA production about 100-fold. (Frankel & Young, 1998). By binding the RRE site in the env coding region, Rev mediates the transition from the default mRNA pathway, where HIV-1 mRNA is spliced prior to nuclear export, to the infectious pathway, where transcripts are transported to the cytoplasm. (Frankel & Young, 1998). MA, an N-terminal component of the Gag polyprotein, aids targeting of the Gag-Pol and Gag polyproteins to the plasma membrane prior to HIV-1 assembly, helping Env glycoproteins incorporate with long cytoplasmic tails into HIV-1 particles (Freed, et. al, 1995), and facilitating the infection of non-dividing cells. (Frankel & Young, 1998). CA, the second component of the Gag polyprotein, forms the core of HIV-1 particle, its C-terminal domain functioning in assembly and being important for CA dimerization and Gag oligomerization, its N-terminal domain being important for infectivity by participating in viral uncoating through its association with cyclophilin A, a putative cellular chaperone (Luban, 1996). (Frankel & Young, 1998). NC, the third component of the Gag polyprotein, coats genomic RNA inside the HIV-1 core. Its primary function is to bind to packaging signal specifically and deliver full-length viral RNAs into the assembled virion; its secondary function, to bind single-stranded nucleic acids nonspecifically, leading to the coating of genomic RNA, protecting it from nucleases and compacting it in the core; its tertiary function, to enhance other nucleic-acid dependent steps in the cell cycle by nonspecific binding. (Frankel & Young, 1998). p6, comprising the 51 C-terminal amino acids of Gag, is important for incorporation of Vpr during viral assembly and for mediating efficient particle release. (Frankel & Young, 1998). Vpu stimulates virion release (Lamb & Pinto, 1997) and allows Env transport to the cell-surface for assembly into HIV1-particles by degrading CD4, which interacts with newly synthesized Env glycoproteins (gp160?s, later cleaved into SU [gp120] and TM [gp41]) keeping them in the endoplasmic reticulum and preventing them from being transported to the cell surface. (Frankel & Young, 1998). Like Vpu, Nef reduces cellular CD4 levels, facilitating the routing of CD4 from the cell surface and golgi apparatus to lysosomes, resulting in receptor degradation and preventing inappropriate interactions with Env (Frankel & Young, 1998). It also down regulates MHC class I expression, which may protect the cells from termination by cytotoxic T cells (Gall et. al., 1997), and may have roles in HIV-1 assembly, entry, or maturation. PR produces a mature infectious HIV-1 particle by cleaving at several Gag and Gag-Pol polyprotein sites, by facilitating conformational rearrangements within them, to produce MA, CA, NC, and p6 from Gag; and PR, RT, and IN from Pol (Kaplan et. al., 1994). Vif is important in producing highly infectious mature HIV-1 virions, and likely functions before or during DNA synthesis; furthermore, it may have a function in viral assembly and/or maturation, and may function directly within the HIV-1 particle. (Frankel & Young, 1998). Located on the viral membrane surface, SU binds to specific cell surface receptors ? namely, CD4 ? aiding viral entry by causing structural changes in Env, facilitating coreceptor binding and subsequent viral entry (Frankel & Young, 1998); however, the SU-CD4 interaction is insufficient for HIV-1 entry, as a group of chemokine receptors are essential viral coreceptors (Clapham & Weiss, 1997). After receptor binding, TM, also located on the HIV-1 membrane, mediates fusion between cellular and viral membranes after receptor binding. (Frankel & Young, 1998). As it contains an NLS that directs transport, Vpr is important for the localization of HIV-1 nucleoprotein complexes to the host nucleus in nondividing cells (i.e., macrophages); it also induces G2 cell cycle arrest before nuclear envelope breakdown and chromosome condensation. (Frankel & Young, 1998). RT catalyzes RNA- and DNA-dependent DNA polymerization and contains an RNaseH domain that cleaves the RNA portion of RNA-DNA hybrids generated during the polymerization reaction. This is important for the integration of the viral genome into the host genome, as the host genome is composed of DNA. (Frankel & Young, 1998). After reverse transcription, IN catalyzes reactions to integrate the HIV-1 genome into the host chromosome. (Frankel & Young, 1998). So there's an overview of the proteins. Now, lets talk about HIV and diversifying versus purifying selection. Evolution is ultimately caused by non-synonymous mutations, in which the new triplet codes for a different amino acid, and synonymous mutations, in which the new triplet codes for the same amino acid. Note that speciation is usually caused by a series of non-synonymous changes, as well as other alterations (i.e., translations, deletions, insertions, translocations, etc). Under molecular evolution, there are three types of selection on triplet codons: negative purifying selection, which causes convergence; neutral selection; and positive selection, which causes divergence. Under negative purifying selection, non-synonymous codon changes are selected against, and the rate ratio of non-synonymous to synonymous codon changes (dN/dS) is less than one. Under neutral selection, non-synonymous changes in codons have an equivalent probability of elimination or fixation, and the rate ratio of non-synonymous to synonymous codon changes is one. Under positive diversifying selection, non-synonymous codon changes are selected for, and the rate ratio of non-synonymous to synonymous codon changes is greater than one. Though there are some cases where negative purifying selection may be acting on synonymous changes (due to codon bias), non-neutral selection usually acts on non-synonymous, amino-acid altering, changes in the genome. Thus, regions where the ratio of non-synonymous to synonymous changes is greater than one are under diversifying selection; those where it is less than one, under purifying selection; and those where it is equal to one, under neutral selection. Models of molecular evolution and selection have been created to study which sites are under negative, neutral, or positive selection. Nielson and Yang (1998) used the rate ratio of non-synonymous to synonymous changes as a measure of the selection intensity and allowed this rate ratio to vary over sites. They used an empirical Bayes approach to compare the probabilities that the various sites were behaving under the Neutral model ? in which only negative and neutral selection were operating ? or the Positive selection model ? in which negative, neutral, and positive selection were operating. Nielson and Yang?s analysis suggested that positive diversification was occurring at sites 77, 32, and 7 of the V3 region of the HIV-1 env gene. Why is identifying diversifying / purifying selection in HIV-1 important? Namely, for medical reasons; but also for evolutionary ones. Diversifying selection is of great interest to evolutionary biologists, as it is the driving force to evolution. It is also of interest to doctors because it may tell us which areas of the genome HIV-1 tends to have evolve (change). Purifying selection is of interest to us because it may help us find effective drug treatments for HIV-1. If a certain region of a protein is found to always be exactly the same evolutionarily, perhaps it is because that region is functionally constrained -- any (or most) changes to that region are deleterious and result in decreased fitness. Thus, that region is an ideal target for a drug. As an interesting sidenote, the balance between diversifying and purifying selection may what keeps species "on the edge of chaos". I am not practiced in chaos theory, but there may be interesting evolutionary tie-ins. If an organism changes too slowly, it "freezes" and becomes extinct due to its failure to adapt. If it changes too much, it may run itself right over the edge of chaos. In a preliminary study done as a project for a computational biology class, I did an empirical Bayesian analysis to find sites under positive selection in HIV-1. This is basically an analysis in which the aligned genes of 30 HIV-1 isolates were ran through PAUP to determine their phylogeny. The neighbor-joining (nj) method (a very rough method of phylogeny, as it simply groups species based on their "distance" from one another in a distance matrix of changes) was used to determine the evolutionary relationships of the HIV-1 isolates to eachother. This method is very fast (i.e., seconds), but is the poorest method of creating a phylogeny. The nj tree files were then used along with the aligned sequences as input to codeml (a part of the PAML package) to determine the sites of HIV-1 under diversifying selection. This program determines sites under diversifying selection by determining the dN/dS ratio, considering the "evolutionary distance" between the isolates. The results of this study showed a great deal of sites (~15%) to be under very high probabilities of diversifying selection (95%); even for HIV-1, this is somewhat difficult to believe. There are some problems with this type of study. Firstly, it was done using the neighbor joining method to produce the trees for empirical Bayesian analysis, which produces questionable results; a bayesian search via metropolis-coupled MCMC would produce better trees, though taking much more time, as 30 isolates with nine genes ranging from 79 to 1004 nucleotides would have to be dealt with. Furthermore, such empirical Bayesian analysis uses the tree provided, and does not allow for uncertainty in parameters such as topology, branch lengths, or the codon model of DNA substitution. An alternative would be to use Hierarchial Bayesian analysis with a program such as MrBayes (Huelsenbeck & Ronquist, 2001). Another "shortcoming" of the methodology is one peculiar to a genome wide survey. In most cases, where testing for positive selection is performed, it is done on one protein, not sixteen. Thus, the trees made and conclusions drawn are only based off of the sequence data for that protein, not on several proteins. In this case, I had access to all of the aligned genes across the 30 isolates of HIV-1. Yet, separate trees were made from each tree. This obviously produces varying trees from one gene to the next, rather than one tree to be used for all of them. A consensus tree method could be applied to join the trees together; however, in this case, as there are regions of overlapping genes, such a method would over-represent the overlapping regions, which would be a problem if they were not representative. Normally, this is a non-issue, as only one protein is being tested for positive selection, and the tree generated is the optimal tree that could be generated (using the particular tree-generating method), given the data. In this case, there is a unique opportunity to generate a more accurate tree of the isolates lineage, as data is available for all nine genes. The nine genes account for most of the HIV-1 genome, though there are also two LTRs, which could also be included. To prepare such a genome-wide tree, the nine proteins would have to be aligned to one another, so a their overlapping regions (and gaps) would be aligned. Then a heuristics search would be performed to produce the tree for input into the empirical Bayesian analysis. Alternatively, the aligned HIV-1 genome would be inputted directly into MrBayes for analysis. Either of these methods would drastically increase the time needed for analysis over the time if all genes were analyzed separately; however, the results would be much more accurate. I propose that we use a Hierarchial Bayesian method, via MrBayes, which utilizes the metropolis-coupled markov chain monte carlo algorithm (abbreviated MCMCMC or MC^3). This is an algorithm designed to attempt to find a nearly optimal phylogeny, without actually doing an exhaustive search (which would take years if we need to find the relationship between 40 species). Basically, this is a hill climbing algorithm. It arrives at one tree and will leave that tree (with probability T) if it encounters another tree with a high probability of being "the correct tree" (probability T'); if it encounters a tree with lower probability, it will go to that tree in proportion to the ratio T/T'. What I've just described is a chain in MCMC; this method has a flaw, in that it finds local peaks and then stops. It usually cannot cross deep valleys of very low likelihood. So what you do is run "heated" chains in parallel with you chain; in the heated chains, the treescape is flattened out, so they can cross valleys easier. This algorithm is repeated over and over again, perhaps a billion times. The initial "trees" it finds are low in probability, and are discarded; after a while, all of the chains, including the heated chains, reach stationarity, at which they are sampling from the posterior probability of likely trees. Now, on to the mathematics. In MCMC, a proposed move is always accepted if it is uphill of the present tree, and may be accepted if it is not too far downhill. A move from theta to theta* is accepted with probability min(r,1): P(accept | theta -> theta*) = min(r,1) where: r = [Pr(theta*|d)Pr(theta|theta*)] / [Pr(theta|D)Pr(theta*|theta)] This is the acceptance ratio, where D is the data (namely, the sequence data). Longer runs of this chain result in better approximations to the posterior probabilities (that is, the probabilities that the trees are correct given the data). This type of algorithm will "visit" each tree in proportion to the probability that it is correct. This algorithm is run until it reaches stationarity, a point at which the log-likelihoods of the trees being correct to not display a pattern of going up or down. However, as previously noted, this method (MCMC) alone will only find local optima, not global optima. Thus, we use MCMCMC, a modification of MCMC which employs heated chains, which can "better cross deep valleys of low log-likelihood". Thus, it will explore other possible likely sets of trees. Via this method, several chains are run at once, with one chain being cold (the one for which results are logged), and the other "hot" chains serving as scouts for the cold chain. A heated chain explores a melted down landscape, in which the density function is raised to a power between 0.0 and 1.0, which causes the treescape to be "softened". Each chain run is labelled 0, 1, 2, 3, . . . n, where one of them (chain 0) is cold and all the rest are heated. The heat that is applied to each chain (B) is the power to which the posterior probability is raised. The "heat" applied tto the ith chain is B = 1 / (1 + temp * i), where temp is a user-defined number (let us say temp = 0.2), which may be any positive number. This has the effect of progressively heating the chains; chain 0 not heated at all because 1 / (1 + 0.2 * 0) is 1, and the posterior probability is not modified by raising it to 1. I have left out some important math (i.e., the formula for the posterior probability that the tree is correct) for simplicity. I have also left out the formula to determine the likelihood that a site is under diversifying selection for simplicity. So, here's the distributed biocomputing project I'm proposing: to determine the "bootstrapped" phylogeny of 40 HIV-1 genomes (8434 base-pairs, minus non-coding regions) via MCMCMC and then use the results of that analysis to determine the probability that each site in HIV-1 is under diversifying or purifying selection. This is called a Hierarchial Bayesian analysis. It allows one to account for uncertainty in tree parameters when determining the probability that a site is under diversifying or purifying selection. This approach produces very accurate results. Though it is not as time-consuming as an exhaustive search of all trees, it is still very computationally intensive. Performing a much more modest analysis than the one I'm proposing now took 40 hours on my computer. I did such analysis with 200,000 cycles and 4 chains, with the most general models. I propose doing 1 billion cycles and 100 chains, which will be much more computationally intense. It will likely require (net total) months of computing time and gigabytes of storage/RAM space. Such a study would be done by using the HIV.dat file I will supply in the next post.
    Project HIV-1
    Submitted by David J. Heinrich; posted on Monday, May 13, 2002
    #NEXUS BEGIN DATA; DIMENSIONS ntax=40 nchar=8434; FORMAT datatype=dna interleave=no gap=- missing=*; MATRIX HIV004 ATGGGTGCGAGAGCGTCAGTATTAAGCGGCGGAAAATTAGATTCATGGGAGAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAGGCTGAAACATTTGGTATGGGCAAGCAGGGAGCTGGAAAGATTCGCACTTAACCCTAGCCTTTTAGAAACAGGAGAAGGATGTCAACAACTAATGGGACAATTACAACCAGCTCTCGGGACAGGAACAGAAGAACTTAGATCATTATATAATACATTAGCAACTCTCTATTGTGTACATCACAGGATAGAGATAAAAGACACCAAGGAGGCTTTAGATAAAATAGAGGAAATACAAAATAAGAGCAAGCAAAAGAAACAGCAGGCAGCAGCTGACACAGGAAACAGCAGCAATGTCAGTCAAAATTATCCCATAGTGCAAAATGCACAAGGGCAAATGGTACACCAGCCTGTATCACCTAGAACTTTGAATGCATGGGTGAAAGTAGTAGAAGAAAAGGCTTTCAGCCCCGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAATATGATGCTGAACATAGTGGGGGGACACCAGGCAGCTATGCAAATGTTAAAAGATACCATCAATGAGGAAGCTGCAGAATGGGACAGGCTACATCCAGTACAGGCAGGGCCTATTGCACCAGGCCAGATGAGAGACCCAAGGGGAAGTGACATAGCAGGAACAACTAGTACCCTTCAAGAACAAATAGGGTGGATGACAGGCAACCCACCTATCCCAGTGGGAGATATCTATAGAAGATGGATAATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTGTTAGCATTTTGGACATAAAACAAGGGCCAAAAGAACCCTTCAGAGACTATGTAGATAGGTTTTTTAAAGCTCTCAGAGCTGAACAGGCTACACAGGAAGTAAAAGGATGGATGACAGATACCTTACTGATCCAAAATGCAAATCCAGACTGCAAGTCCATTTTAAGAGCATTAGGAACAGGAGCTACATTAGAAGAAATGATGACAGCATGCCAGGGAGTGGGAGGACCCAGCCATAAAGCAAGGGTTTTGGCTGAGGCAATGAGCCAAGTACAA******ACAAATGTAATGATGCAGAGAAGCAATTTTAAGGGCCAGAAAAGA***ATTAAGTGCTTCAACTGTGGCAAAGAAGGACATCTAGCCAGAAATTGCAGGGCCCCTAGAAAAAAGGGCTGTTGGAAGTGTGGGAGGGAAGGACACCAAATGAAAGACTGCACCGAGAGACAGGCTAATTTTTTAGGGAAAATTTGGCCTTCCAGCAAAGGAAGGCCAGGGAACTTTCTCCAGAGCAGACCAGAGCCAACAGCCCCACCAGCAGAGAGCTTCGGGTTCGGAGAGGAGGAGATAGCCCCCTCCCCGAAACAGGAGCCGAAGGAGAAGGAGCTATATCCTTTAACCTCCCTCAAATCACTCTTTGGCAGCGACCCATAGTTAAAATAAAAGTAGCAGGGCAGCTGAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATAAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAAACAGTATGAGGAAATAATCATAGAGATTGAGGGAAAAAAGGCTATAGGTACAGTGTTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAACATGTTGACTCAGATTGGCTGTACTTTAAATTTCCCAATTAGTCCTATTGACACTGTACCAGTACAATTAAAGGCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAAATCTGTACAGAAATGGAAAAGGAAGGAAAGATTTCAAAAATTGGGCCTGAAAATCCATATAACACTCCAGTGTTTGCCATAAAGAAAAAGGACAGCACTAAATGGAGAAAGTTAGTTGATTTTAGAGAACTCAATAAAAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCAGCAGGGTTAAAAAAGAAGAAATCAGTAACAGTACTGGATGTGGGGGATGCATATTTTTCAGTCCCTCTAGATGAAAACTTCAGGAAGTATACTGCATTCACCATACCTAGCATAAACAATGAGACACCAGGGGTTAGATATCAGTACAACGTGCTACCACAGGGATGGAAAGGATCACCAGCTATATTCCAGAGTAGCATGACAAAAATCTTAGAACCATTTAGAACACAGAACCCAGAAATAGTTATCTATCAATATATGGATGACTTGTATGTGGGATCTGACTTAGAAATAGGACAGCATAGAGAAAAAGTGGAAGAATTAAGGAAGCATCTATTGAGGTGGGGACTTACCACACCAGATAAAAAACATCAGAAAGAACCCCCATTCCTCTGGATGGGATATGAGCTCCATCCTGACAAATGGACGGTGCAACCTATACAGCTGCCAGACAAAGAATGCTGGACTGTCAATGATATACAAAAATTAGTGGGAAAACTAAATTGGGCAAGTCAGATATATCCAGGGATTAAAGTAAAGCAACTATGCAAACTCCTTAGGGGGACCAAAGCACTAACAGACATAGTACCACTGACTGCAGAAGCAGAATTGGAGTTGGCAGAAAACAGGGAAATTCTAAAAGAACCAGTACATGGAGTATATTATGACCCATCAAAAGACTTAATAGCAGAAGTACAGAAACAAGGGCTAGACCAGTGGACATATCAAATATATCAAGAGCCATTTAAAAACCTGAAAACAGGGAAGTATGCAAAAAGGAGGGCTGCCCACACTAATGATGTAAGGCAATTAACAGAAGTGATACAAAAAATATGCCTGGAAGCCATAGTAATATGGGGAAAGACTCCTAAATTTAGACTACCCATACAAAGGGAAACATGGGAGACATGGTGGACAGACTATTGGCAGGCCACCTGGATCCCTGAATGGGAGTTTGTCAATACCCCCCCTCTAGTAAAATTATGGTACCAGTTAGAACAGGGGCCCATACTAGGAGCAGAAACTTTCTATGTAGATGGGGCAGCTAATAGGGAAACTAAAATAGGAAAAGCAGGGTATGTCACTGACAAAGGAAGGCAGAAAGTAATTACCCTAACTGAAACAACAAATCAAAAGACTGAACTAGAAGCAATTCATCTAGCTTTGCAGGATTCAGGATTAGAAGTAAATATAGTAACAGATTCACAATATGCATTGGGGATTATTCAAGCACAACCAGATAAGAGTGAATCAGAATTAGTCAGTCAAATAATAGAGCAGTTAATAAAAAAGGAAAAGGTTTACCTAACATGGGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAATAGATAAATTAGTCAGTTCTGGAATTAGAAAGGTACTATTTCTAGATGGGATAGATAAGGCTCAAGAAGACCATGATAGATATCACAGCAATTGGAGAACAATGGCTAGTGATTTTAATCTGCCACCTATAGTAGCAAAAGAAATAGTAGCCAGCTGTGATAAATGTCAACTAAAAGGGGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAATTGGATTGTACACATCTAGAAGGAAAAATAATCATGGTAGCAGTCCATGTAGCCAGTGGCTATATAGAAGCAGAAGTTATCCCAACAGAAACAGGACAGGAAACAGCATACTTTATATTAAAATTAGCAGGTAGATGGCCAGTAAAAGTAATACATACAGATAATGGCAGCAATTTCACCAGCAGTACAGTTAAAGCAGCCTGTTGGTGGGCAAATATCCAACAGGAATTTGGGATTCCCTACAATCCCCAAAGTCAAGGAGTGGTGGAATCTATGAATAAGGAATTAAAGAAAATTATAGGGCAGATAAGAGACCAAGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTCATTCATAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACTTACAAACTAAAGAACTACAAAAACAAATTACAAAAATTCAAAACTTTCGGGTTTATTACAGGGACAGCAGAGACCCAATTTGGAAAGGACCAGCAAAACTACTCTGGAAAGGTGAAGGGGCAGTAGTAATACAGGACAATAGTGATATAAAGGTAGTACCAAGAAGAAAAGCAAAGATCATTAGGGATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAGGTAGACAGGATGAGGATTAGAACATGGCATAGTTTAGTAAAACATCATATGTATGTCTCAAAGAAAGCTAGAAGGTGGATGTATAGACATCACTATGAGAGTAGGCATCCAAAAATAAGCTCAGAAGTACACATCCCACTAGGGGATGCAGACTTAGTAGTGACAACATATTGGGGTCTGCATACAGGAGAAAGAGAATGGCATTTGGGTCAGGGGGTCTCCATAGAATGGAGAATGAAAAGGTACAGAACACAAGTAGACCCTGGCCTGGCAGACCAACTAATTCATATACATTACTTTGATTGTTTTTCAGAATCTGCCATAAGGGAAGCCATATTAGGACATAGAGTTAGTCCTAGGTGTGAATATCAAGCAGGACATAACCAGGTAGGATCTTTACAATATTTGGCACTGAAAGCATTAGTAACACCAACAAGGGCAAAGCCACCTTTGCCTAGTGTTAGGAAATTAGCAGAGGATAGATGGAACAAGCCCCAGAAGACCAGGGGCCACAGAGGGAACCATACAGCGAATGGATGTTAGAACTGCTAGAAGAGCTTAAGCATGAAGCAGTTAGACATTTTCCTAGGCTGTGGCTTCATGGATTAGGACAACATATCTATGACACCTATGGGGATACTTGGGAAGGAGTTGAAGCTATAATAAGAATTTTGCAACAACTACTGTTTGTCCATTT*CAGAATTGGGTGCCAACAATGGAGCCAGTAGATCCTAACATAGAGCCCTGGAACCAGCCAGGAAGCCGGCCTAAAACTGCTTGTAACCAGTGTTATTGTAAAAGATGTTGCTATCATTGTCCACACTGCTTTTTAAAGAAAGGCTTAGGAATTTACTATGGCAGGAAGAAGCGGAGACAACGACGAGCAGCTTCTCACAGCAGTGAAAATCATCAAGATCCTATACCAAAGCAACCCTCAACCCAACCCAACAGGAAGCCGACAGGCCCGGAGGAAATGGCAGGAAGAAGCGGAGACAACGACGAGCAGCTTCTCACAGCAGTGAAAATCATCAAGATCCTATACCAAAGCAATGATACCTTTGCAAATAGCAGGCATAGTAGCACTAATAGTAGCAGCTATTATAGTGATAATTGTGTGGACTATAGTATTCATAGAATATAGAAAGCTGTTAAAGCAAAAGAAAATAGATAGGTTAATTGATAGAATAAGAGAAAGAGCAGAAGACAGTGGCAATGAGAGCGAGGGGGACACAGAAGAATTGGCACGACTTGGGGTGGAGATGGGG*CTCCTCATGATTGGAATGTTAATGATCTGTAATGCTACAGACAACTTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAAGACGCAAACACCACTCTATTTTGTGCATCTGATGCTCAAGCATATAGTCCTGAAAAACATAATGTCTGGGCTACACATTACTGTGTACCCACAGACCCCAACCCACAAGAGATACTTCTGGGAAATGTAACAGAAAATTTTAACATGTGGAAAAATAATATGGTAGAACAGATGCATGAGGATATAATCAGTTTATGGGATGAAAGCCTAAAACCATGTGTAAAGCTAACCCCTCTCTGTGTCACTTTAAACTGTGCTGAAGTAACCTCC***TACAACACTACA*********************************GAAATGAAAAACTGCTCTTTCAATGTAACCACAGAACTAATAGATAGGAGGAAGCAAGAATACGCGCTTTTTTATAAACTTGATATAGTACCAATTAATGATAATGTAAGTGATTATAGGCTAATAAATTGTAATGTCTCAACCATTAAGCAGGCTTGTCCTAAGGTAACCTTTGAGCCAATTCCCATACATTATTGTGCTCCAGCTGGTTTTGCAATTCTGAAGTGTAGGGATAAGGAGTTCAATGGAACAGGACCATGCAAGAATGTCAGCACAGTACAATGCACACATGGAATCAAGCCAGTAGTATCAACTCAACTACTGTTAAATGGCAGTCTAGCAGAAGAAAAGGTAAAGATTAGATCTGAAAACTTCACAAACAATGCTAAAACCATAATAGTACAGTTTAACAATACTGTAAGAATTAATTGTACCAGACCTGGCAACAATACA******AGAAAAAGTATACATTTAGGACCAGGACACGCTTTCTATGCCACAGGTATAATAGGGGATATAAGACAAGCACATTGTAAAGTCAGTAAAGCAGAATGGCTCAACACTTTACAACAGGTAGCTACACAATTACGAGGAAAGTTTAACAAA***ACAATAATCTTTGATAACCCCTCCCCAGGAGGGGATATAGAAATTACATCACATAGCTTTAATTGTAGAGGAGAATTTTTCTATTGTAATACATCAGGACTGTTTAATAAC************TTTAATAGCACTTGGAACGAATTAAATGGCACAGAGCCA***AAT***ATAACTCTCCCATGCAGAATAAAGCAAATTGTAAGGATGTGGCAGAGAGTAGGACAAGCAATGTACGCCCCTCCCATCCAAGGAGAAATAAGGTGTGACTCCAACATTACAGGACTACTATTAACAAGAGATGGTGGG***AAT***AGTACAGAGACCTTCAGACCTACAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAGTATAAAGTAGTGGAAATTAAACCACTAGGAGTAGCACCCACCAGGGCAAAAAGAAGAGTGGTGGAGAGAGAAAAAAGAGCA******ATAGGAGCTGTGCTCTTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCGGCGTCAATAACGCTGACGGTACAGGTCAGACAATTATTGTCTGGCATAGTGCAACAGCAAAGCAATTTGCTGAAGGCTATCGAGGCACAACAGCATCTGTTGAAACTCACTGTCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTAGAAAGATACCTAAAGGATCAACAGCTCCTAGGGATTTGGGGCTGCTCTGGAAAACTCATCTGCACCACTAATGTGCCCTGGAACATTAGTTGGAGT***AAATCTTATGATGAGATTTGGGACAACATGACCTGGATAGAATGGGAAAGGGAAATTGACAATTACACACAAACAATATACACCCTACTTGAAGAATCGCAGACCCAGCAGGAAAAGAATGAACAAGACTTATTGTCATTAGACAAATGGGCAAGTCTGTGGAGTTGGTTTGACATAACAAATTGGCTATGGTATATAAAAATATTTATAATGATAGTAGGAGGCTTAATAGGTTTAAGAATAATTTTTGCTGTGCTTTCTGTAGTGAATAGATGTAGGCAGGGATACTCACCTTTGTCGTTCCAGCAACCCAACAGGAAGCCGACAGGCCCGGAGGAATCGAAGAAGGAGGTGGAGAGCAAGGCAGAACCAGATCGATTCGATTAGTCAGCGGATTCTTAGCGATTGCCTGGGACGATCTGAGGAACCTGTGCCTCTTCAGCTACCACCGATTGAGAGACTTCATCTTGATTGTAGCGAGGATTGTGGAAACCCTGGGACACAGGGGGTGGGAGATTCTCAAATATCTGGGGAATCTGACACAGTATTGGGGCCAAGAACTGAAGAAAACTGAAGAATAGTGCTATCAATTTGCTTAATACCACAGCAATAGCAGTAGCTGAAGGAACAGATAGGATAATAGAAATAGTACAGAGAGTTTTAAGAGGTATTCTCCACATACCTAGAAGAATTAGACAGGGCTTAGAAAGGGCTTTGCTAATGGGTGGAAAGTGGTCAAAAAGTAGCATAGTGGGATGGCCTGAGATTAGGGAAAGATTAAGACGCACTCCTGCAGCAGCAGACGGAGTAGGAGCAGTATCTAAAGATTTAGAAAAATTTGGAGCAATTACAAGCAGCAATACAGCACATACTAATGATACTTGCGCCTGGCTGGAAGCACAAGAGGAT***GAGGTAGGCTTTCCAGTCAGACCACAGGTACCTTTAAGACCAATGACTTATAAGGCAGCTTTTGATCTTGGCTTCTTTTTAAAAGAAAAGGGGGGACTGGATGGGCTAATTTACTCCCAGAAAAGAAAAGAGATCCTTGACCTGTGGGTCTATCATACACAAGGCTTCTTCCCTGAT HIV006 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATGCATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAGAATAAAACACCTAGTATGGGCAAGCAGGGAGCTGGAAAGATTCGCGCTTAACCCTAGCCTTCTAGAAACATCAGAAGGATGTCAACAAATACTGGAACAGTTACAACCAACTCTCAAGACAGGATCAGAAGAAGTTAAATCATTATATAATACAGTAGCAACTCTCTATTGTGTACATCAACGGATAGAGATAAAAGACACCAAGGAAGCTTTGGATAAAATAGAGGAGATACAAAATGAGAACAAGCAAAAGACCCAACAGGCAACTGGC***ACAGGAAGCAGCAGCAAAGTCAGTCAAAATTACCCCATAGTGCAAAATGCACAAGGGCAAATGACACACCAGTCCATGTCACCTAGGACTTTAAATGCATGGGTGAAAGTAATAGAAGAAAAGGCTTTCAGCCCAGAAGTAATACCCATGTTTTCAGCATTGTCAGAGGGAGCCACCCCACAAGATTCAAACATGATGCTGAACATAGTGGGGGGACACCAGGCAGCTATGCAAATGTTGAAAGATACCATCAATGAGGAAGCTGCTGAATGGGATAGGTTACATCCAGCACAGGCAGGGCCTTTTCCACCAGGGCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAAGAACAAATAGGATGGATGACAAGCAACCCACCTATCCCAGTGGGAGACATCTATAAAAGATGGATAATCCTAGGATTAAATAAGATAGTAAGAATGTATAGCCCTGTTAGCATTTTAGACATAAGACAAGGGCCAAAAGAACCCTTCAGAGACTATGTAGATAGGTTCTTTAAAACTCTTAGAGCTGAGCAAGCTACACAGGAGGTAAAGAACTGGATGACAGAAACCCTGCTGGTCCAAAATGCAGATCCAGATTGTAAAGCCATTTTAAGAGCATTAGGACCAGGGGCTACATTAGAAGAAATGATGACAGCATGCCAGGGAGTGGGAGGACCCGGCCATAAAGCCAGGGTTTTGGCTGAGGCCATGAGTCAAGTACAA******GCAAACATAATGATGCAGAAAAGTAATTTTAGGGGCCCAAAAAGA***ATTAAGTGTTTCAACTGTGGCAAAGAAGGACACCTAGCCAGAAATTGCAGGGCCCCTAGGAAAAAGGGCTGTTGGAAATGTGGAAAGGAAGGCCATCAAATGAAAAACTGCACTGAGAGACAGGCTAATTTTTTAGGAAGAATTTGGCCTTCCAGCAAAGGGAGGCCAGGAAATTTTCCTCAGAGCAGACCAGAGCCATCAGCCCCACCAGCAGAAGACTTAGACTTTGGGAGGGGAGAGATAACCCCCCCCCTGAAACAGGAACAGAAAGACAGGGAACATCCTCCTTCAATTTCCCTCAAATCACTCTTTGGCAACGACCCCTTGTCACAGTAAGAATAGGAGGACAGCTAAAAGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACATAGATTTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAGGTAAGACAGTATGATCAAATACTTATAGAAATTTGTGGAAAAAAGGCTATAGGTACGGTATTAGTAGGACCTACCCCTGTCAACATAATTGGAAGAAATATATTGACTCAGCTTGGTTGTACTTTAAATTTTCCAATAAGTCCTATTGAAACTGTACCAGTAACATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTAACAGAGGAGAAAATAAAAGCATTAACAGAGATTTGTATGGAGATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCTATAAAGAAAAAGGACAGCACTAAGTGGAGGAAATTAGTAGATTTCAGGGAGCTCAATAAAAGAACTCAGGACTTTTGGGAAGTTCAATTAGGAATACCCCATCCAGCGGGTTTAAAAAAGAAAAAATCAGTAACAGTACTAGATGTGGGGGATGCATATTTTTCAGTTCCTTTAGATGAAAGCTTCGGAAAGTATACTGCATTCACTATACCAAGTATAAACAATGAGACACCAGGGGTCAGATATCAGTACAATGTACTTCCACAGGGATGGAAAGGATCACCATCAATATTCCAGAGTAGCATGACAAAAATCTTAGAGCCCTTTAGATCAAAAAATCCAGAAATAGTTATCTATCAATACATGGATGACTTGTATGTAGGCTCTGATTTAGAAATAGGGCAGCATAGAACAAAAATAGGGGAGTTAAGAGCTCATCTATTGAGCTGGGGATTTACTACACCAGACAAAAAGCATCAGAAAGAACCTCCATTTCTTTGGATGGGACATGGACTCCATCCTGACAAATGGACAGTCCAGCCTATAATGCTGCCAGATAAAGACAGCTGGACTGTCAATGATATACAGAAATTAGTGGGAAAACTAAATTGGGCAAGTCAGATTTATCCAGGGATTAAAGTAAGGCAATTGTGTAAACTCCTCAGGGGAGCCAAAGCACTGACAGATATAGTGACACTGACTGAGGAAGCAGAATTAGAATTGGCAGAGAACAGAGAGATTCTAAAAGAACCTGTGCATGGAGTATATTATGACCCATCAAAAGATTTAGTAGCAGAGATACAGAAACAAGGACAAGACCAATGGACATATCAAATTTATCAGGAGCCATTTAAGAATCTAAAAACAGGAAAATATGCAAAAAAGGGGTCTGCTCACACTAATGATGTAAAACAATTAACAGCAGTGGTGCAAAAAGTGGCCACAGAAGGCATAATAATATGGGGAAAGACTCCTAAATTTAGGCTACCCATACAAAAAGAAACATGGGAAGCATGGTGGATGGAGTACTGGCAGGCTACCTGGATTCCTGAATGGGAGTTTATCAATACCCCTCCTCTAGTAAAACTATGGTACCAGCTGGAGAAAGAACCCATAGTAGGAGCAGAGACTTTCTATGTAGACGGGGCAGCTAACAGGGAGACTAAGACAGGAAAAGCAGGGTATGTTACTGACAGAGGAAGACAAAAGGTTGTTCCTCTAACTGAGACAACAAATCAAAAGACTGAATTACATGCAATCCATCTAGCTTTGCAGGATTCAGGGTCAGAAGTAAATATAGTAACAGACTCACAATATGCATTAGGGATTATTCAGGCACAACCAGACAGGAGTGAATCAGAGATAGTCAATAAAATAATAGAGAAACTAATAGAAAAAGAAAGAGTCTACCTGTCATGGGTACCAGCGCACAAGGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTCAGTTATGGAATCAGGAGGGTGTTATTTTTAGAAGGGATAGATAAGGCTCAAGAAGAACATGAAAAATATCACAGCAATTGGAAAGCAATGGCTAGTGATTTTAATCTGCCACCTATAGTAGCAAAGGAAATAGTAGCCAGCTGTGATAAATGTCAACTAAAAGGGGAAGCTATGCATGGACAGGTAGACTGTAGTCCAGGGATATGGCAATTAGATTGCACACATCTAGAAGGAAAAGTAATCATAGTAGCAGTCCATGTAGCCAGTGGCTATATAGAAGCAGAAGTTATCCCAGCAGAAACAGGACAGGAGACAGCATACTTTCTGCTAAAATTAGCAGGAAGATGGCCAGTAAAAGTAGTACACACAGATAATGGCCCCAATTTCACCAGCAGCGCAGTTAAGGCTGCCTGTTGGTGGGCAAATATCCAACAGGAATTTGGGATTCCCTACAATCCCCAAAGTCAAGGAGTAGTGGAGTCTATGAATAAGGAATTAAAGAAAATCATAGGGCAGGTAAGAGAGCAAGCTGAACACCTTAAGACAGCAGTACAAATGGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAATAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTATAAAAATTCAGAATTTTCGGGTTTATTACAGGGACAGCAGAGATCCAATTTGGAAAGGACCAGCAAAACTACTCTGGAAAGGTGAAGGGGCAGTGGTAATACAGGACAATAACGATATAAAAGTAGTACCAAGAAGAAAAGCAAAGATCATTAGGGATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGATTAGAACATGGAACAGTTTAGTAAAACATCATATGTATGTCTCAAAGAAAGCTAGAGGGTGGTTTTATAGACATCACTATGAAAGCAGGCATCCAAAAGTAAGTTCAGAAGTACACATCCCACTAGGGGATGCTAGGCTAGTAGTAAAAACATACTGGGGTCTGCATACAGGAGAAAAAGACTGGCACTTGGGCCATGGGGTCTCCATAGAATGGAGACAGGAAAGGTGTAGCACACAAATAGACCCTGACCTGGCGGACCAACTAATTCATCTGTATTATTTTGACTGTTTTTCAGACTCTGCCATAAGGAAAGCCATAGTAGGACACATAGTTAGCCCTAGGTGTAACTATCCAGCAGGACACAACAAGGTAGGATCTCTACAATACTTGGCACTGAAAGCATTAGTAACACCAACAAGGGAAAGGCCACCTTTGCCTAGTGTTAGGAAACTAACAGAGGAGAGATGGAACAAGCCCCAGAAGACCAGGGGCCGCAGAGGGAACCACACAATGAATGGATGTTAGAACTGTTAGAAGATCTTAAGCATGAAGCTGTCAGACATTTTCCAAGGCCGTGGCTCCATGGATTAGGACAACATATCTATAACACCTATGGGGATACTTGGGAAGGGGTTGAAGCTATAATAAGAACTTTGCAACAACTACTGTTTGTTCATTC*CAGAATTGGGTGCCAACAATGGATCCAGTAGATCCTAACCTAGAGCCCTGGAATCATCCGGGAAGTCAGCCTAAAACTGCTTGTAGCAATTGTTACTGTAAAAAGTGTTGCTTGTATTGCCAAATTTGCTTTCTAAAAAAAGGCTTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACACAGACGCGGAACTCCTCACAGCAGTAAGGATCATCAAATTCCTATATCAAAGCAACCCTTACCCCGCACCCAGAGGGACCAGACAGGCCCGGAAGAAATGGCAGGAAGAAGCGGAGACACAGACGCGGAACTCCTCACAGCAGTAAGGATCATCAAATTCCTATATCAAAGCAATGACACCTTTAGAAATCTATGCAATAGTAGCATTAGTAGTAGTGTTTGTCATAGCAATAGTTGTGTGGACTATAGTAGGTATAGAATATAGGAAATTGCTAAAACAAAGAAAAATAGACAGGTTAATTGAGAGAATAAGAGAAAGAGCAGAAGACAGTGGCAATGAAAGCGAGGGGGATGCAGAGGAATTATCAACACTTGGGATGGAGGTGGGGAACTATGCTCTTTTGGATGATAATAATGTGTAAGGCTGCAGAAAACTTATGGGTCACGGTATACTATGGGGTACCTGTGTGGAGAGATGCAGAGACCACCCTATTTTGTGCATCAGATGCTAAAGCATATGATAAAGAAGTACACAATGTCTGGGCTACACATGCCTGCGTACCCACAGACCCTGACCCACAAGAAATAATTTTGGAAAATGTGACAGAGAAATTTAACATGTGGAAAAATAACATGGTAGAACAAATGCAAACAGATATAATCAGTCTCTGGGACCAAAGCCTAAAGCCATGTGTAAAGTTAACCCCTCTCTGCGTTACTTTAAATTGTGCTGGACCC***AGCTCTAACAACAGTAACGTTAACAGCAGCAACGATAACTGGTCTGAA***GAAATGAAAAACTGCTCCTTCAACATGACCACAGAACTAAGAGATAAAAGGAAAACTGTACATTCACTTTTTTATAAACTTGATATAGTATCAACTGGTAGTAAT***AGTAGGTATAGACTAATAAATTGTAATACATCAGCCATGACACAGGCCTGTCCTAAGGTAACCTTTGAGCCAATTCCTATACATTATTGTGCCCCAGCTGGTTTTGCGATTCTAAAGTGCAAGGATACAAATTTTACTGGAACAGGGCCATGCAAGGATGTCAGCACAGTACAATGCACACATGGAACCAAGCCAGTAGTATCAACTCAACTGCTGTTAAATGGCAGTCTAGCAGAGAAAGAGGTAATGATTAGATCTGAAAATATCACAGACAATGGCAAAATCATAATAGTACAGCTTACTGAGCCTGTAAACATCACTCGTATCAGACCTGGCGAGAATAAA******AGAACAAGTATACGTATAGGACCAGGACAAACCTTCTATGCAACAGGTGTAATAGGGGACATAAGAAAAGCATATTGTAATGTCAGCAGAGCAGCATGGAATAGCACTTTACAAAAGATAAGTACACAATTAAGA***CAATACTTTAATAACAAAACAATAATCTTTAAGAACTCCTCAGGAGGGGATTTAGAAGTTACAACACATAGTTTCAATTGTGGAGGAGAATTTTTCTATTGCAATACAACAGACCTGTTCAAT***ACTTGGAACGAACCTGTCACAAATAGCACAATGGCCAATGGA***************ACTATAACTCTACCATGCAGAATAAAGCAAATTATAAATATGTGGCAGAGAGTAGGACAAGCAATGTATGCCCCTCCTATTGAAGGAAATATAAGGTGTGAATCAAACATTACAGGACTACTATTAACAAGAGATGGTGGAAGTGCTAATAGCAGCGAGACCTACAGACCTATAGGAGGAAATATGAGGGACAATTGGAGAAGTGAACTATATAAGTATAAAGTAGTAAAAATTGAACCCATAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGGAGAGAGAAAAAAGAGCAATTGGACTGGGAGCTGCCTTCCTTGGGTTCTTAGGAGCAGCAGGAAGTACTATGGGCGCGGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGCATAGTGCAACAGCAAAGCAATTTGCTGAGGGCTATAGAGGCTCAGCAGCATCTGCTGAAACTCACGGTCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATACCTAAAGGATCAGCAGCTCCTAGGAATTTGGGGTTGCTCTGGAAAACTCATCTGCACCACTAATGTGCCCTGGAACTCTAGTTGGAGTAATAAATCTCAGAGTGAGATATGGGGTAACATGACCTGGATGCAATGGGACAGGGAAGTTATCAATTACACAAACATAATATATGATCTAATTGAAGAATCGCAAAACCAGCAGGAAAAGAATGAGCAAGATTTATTGGCATTAGACAAGTGGGCAAGTCTGTGGAGTTGGTTTGACATATCAAATTGGTTATGGTATATAAAAATATTTATAATAATAGTAGGAGGCTTAATAGGATTAAGAATAGTTTTTGCAGTGCTTTCTATAATAAATAGAGCCGGGCAGGGATACTCACCCTTGTCATTGCAGACCCTTACCCCGCACCCAGAGGGACCAGACAGGCCCGGAAGAATCAAAGAAGAAGGTGGAGAGCAAGACAGAGACAGATCGATTCGATTAGTGAGCGGATTCTTAGCACTTGCCTGGGACGATCTGCGGAGCCTGTGCCTCTTCAGCTACCGCCGATTGAGAGACTTCATCTCGATTGCAGCGAGGACTGTGGAACTTCTGGGACGCAGGGGGTGGGAGGGCCTCAAATATCTGGGGAATCTTCTGGGATATCGGGGTCAGGAACTAAAGAGTAGTGCTATTAATCTGATAGATACCATAGCAATAGCAGTAGCTGGGTGGACAGATAGGGTTATAGAAATAGGACAAAGATTTTGTAGAGCTATTCGTAACATACCTAGGAGAATCAGACAGGGCGCAGAAAGGGCTTTGCAAATGGGGGGCAAATGGTCAAAAAGTAGCATAGTGGGATGGCCTCAGATTAGGGAAAGATTAAGACGAGCTCCTCCAGCAGCAAGAGGAGTAGGACCAGTATCTCAAGATTTGGATAAGCATGGAGCAGTCACAAGCAGTAATACAGCAGCTACTAATGCTGATTGCGCCTGGCCAGAGGCGCAAGAGGAA***GAGGTAGGCTTTCCAGTCAAGCCGCAGGTGCCTTTGAGACCGATGACATATAAGGGAGCTTTCGATCTCAGCCACTTTTTAAAAGAAAAGGGGGGACTGGATGGGTTAATCTACTCCAAGAAAAGACAAGAAATCCTTGATCTGTGGGTCTATCACACACAAGGTTACTTCCCTGAT HIV015 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATACATGGGAAAGAATTCGGTTACGGCCAGGAGGAAAGAAAAAATATGCACTAAAACATTTGATATGGGCAAGCAGGGAGCTAGAACGATTTACACTTAATCCTGGCCTTTTAGAGACATCAGAAGGCTGTAAACAAATAATAGGACAGCTACAACCATCTATTCAAACAGGATCAGAAGAAATTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTACATGAAAGGATAGAGGTAAAAGACACCAAAGAAGCTGTAGAAAAGATGGAGGAAGAACAAAACAAAAGTAAGAAAAAGACACAGCAAGCAGCAGCTGAT*********AGCAGCCAGGTCAGCCAAAATTACCCTATAGTGCAGAACCTACAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTGAACGCATGGGTAAAAGTAATAGAAGAAAAGGCCTTCAGCCCGGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCTATGCAAATGCTAAAAGAGACCATCAATGACGAAGCTGCAGAATGGGACAGATTACATCCAGTGCATGCAGGGCCTGTTGCACCAGGCCAAATGAGAGAACCAAGGGGAAGTGATATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGCATGGATGACAAGCAACCCACCTATCCCAGTAGGAGAAATCTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTGTCAGCATTTTGGACATAAGACAGGGACCAAAGGAACCTTTTAGAGACTATGTAGACCGGTTCTATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGATGTAAAAAACTGGATGACAGAAACCTTGTTGGTCCAAAATGCAAACCCAGATTGTAAAACTATCTTAAAAGCATTGGGACCACAGGCTACACTAGAAGAAATGATGACAGCATGCCAGGGAGTGGGGGGGCCCGGCCATAAAGCAAGAGTTTTGGCTGAGGCAATGAGCCAAGTAACAGGT***ACTGCAGTAATGATGCAGAGAGGCAATTTTAAGGGCCCAAGAAAAAGTATTAAGTGTTTCAACTGTGGCAAGGAAGGGCACACAGCAAAAAATTGCAGGGCCCCTAGAAAAAAGGGCTGTTGGAAATGCGGAAGGGAAGGACACCAAATGAAAGATTGCACTGAAAGACAGGCTAATTTTTTAGGGAAGATTTGGCCTTCCCACAAGGGAAGGCCGGGGAATTTTCTTCAGAGCAGACCAGAGCCAACAGCCCCACCAGCAGAGAGCTTCGGGTTTGGGGAGGAGATAACAACCCCCTCTCAGAAACAGGAGCAGAAAGACAAGGAGTATCCTCCTTTAGCTTCCCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGACAGCTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATAAATTTGCCAGGAAAATGGAAGCCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAAATACTCATAGAAATCTGTGGATATAAAGCTATGGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATTTGTTGACCCAGATTGGCTGCACTTTAAATTTTCCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAGAATTGGGCCTGAAAATCCATATAATACTCCAATATTTGCCATAAAGAAAAAAGACAGTACCAAGTGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGATTTCTGGGAGGTTCAATTAGGAATACCGCATCCTGCAGGGCTGAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTCTCAGTTCCCTTAGATGAAGATTTTAGGAAATATACCGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTCCCACAGGGATGGAAAGGATCACCGGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCCTTTAGAAAACAAAATCCAGAAATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAATTAAGAGAACATCTATTGAGGTGGGGATTTACCACACCAGATAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAAACCTGCCAGAAAAAGAAAGCTGGACTGTCAATGATATACAGAAGTTAGTGGGGAAATTAAACTGGGCAAGCCAGATTTATGCAGGAATTAAAGTAAAGCAATTATGTAAACTCCTTAGGGGAACCAAAGCACTAACAGAAGTAGTACCACTAACAGAAGAAGCAGAATTAGAACTGGCAGAAAACAGGGAAATTCTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAACTACAGAAACAAGGGGACGGCCAATGGACATACCAAATTTATCAAGAACCATTTAAAAATCTAAAAACAGGAAAGTATGCAAGAACGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAGCCACAGAAAGCATAGTGATATGGGGAAAGACTCCTAAATTTAAACTACCCATACAAAAGGAAACATGGGAAACATGGTGGATAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAATTTGTCAATACCCCTCCTTTAGTAAAATTATGGTACCAGTTAGAGAAGGAACCCATAATAGGAGCAGAAACTTTCTATGTAGATGGGGCAGCTAATAGAGAGACTAAATTAGGAAAAGCAGGATATGTTACTGACAGAGGAAGACAGAAAGTTGTCCCTTTCACTGACACGACAAATCAGAAGACTGAGTTACAAGCAATTAATCTAGCTTTACAGGATTCGGGATTAGAAGTAAACATAGTAACAGATTCACAATATGCACTAGGAATCATTCAAGCACAACCAGATAAGAGTGAATCAGAGTTAGTCAGTCAAATAATAGAGCAGCTAATAAAAAAGGAAAAGGTTTACCTGGCATGGGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTCAGTCAGGGAATCAGGAAAGTACTATTTTTGGATGGAATAGATAAGGCTCAGGAAGAACATGAGAAATATCACAACAATTGGAGAGCAATGGCTAGTGATTTTAACCTACCACCTGTGGTAGCGAAAGAAATAGTAGCTAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAATTAGATTGTACACATCTGGAAGGAAAAGTTATCCTGGTAGCAGTTCATGTAGCCAGTGGCTATATAGAAGCAGAAGTTATTCCAGCAGAAACGGGGCAAGAAACAGCATACTTTCTCTTAAAATTAGCAGGAAGATGGCCAGTAAAAGTAGTACATACAGATAATGGCAGCAATTTCACCAGTGCTACAGTTAAGGCCGCCTGTTGGTGGGCAGGGATCAAACAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACAGGTAAGAGATCAAGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTTATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGATACAGTGCAGGGGAAAGAATAATAGACATAATAGCAACAGACATACAAACTAGAGAATTACAAAAACAAATCATAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATCCAATTTGGAAAGGACCAGCAAAGCTTCTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGACAATAGTGACATAAAGGTAGTACCAAGAAGAAAAGTAAAGATCATTAGGGATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGATTAACACATGGAAAAGTTTAGTAAAATACCATATGTATGTTTCAAAGAAAGCTAACAGATGGTTTTATAGACATCACTATGACAGCCACCACCCAAAAATAAGTTCAGAAGTACACATCCCACTAGGAGAAGCTAGACTGGTAGTAACAACATATTGGGGTCTGCATACAGGAGAAAAAGAATGGCATCTGGGTCAGGGAGTCTCCATAGAATGGAGGAAAAGGAGATATAGCACACAAGTAGACCCTGGCCTGGCAGACCAACTAATTCATATGTATTATTTTGATTGTTTTGCAGAATCTGCTATAAGAAAAGCCATATTAGGACATATAGTTAGTCCTAGTTGTGAGTATCAAGCAGGACATAACAAGGTAGGATCCTTACAGTATTTGGCACTAGCAGCATTAATAGCACCAAAAAAGATAAAGCCACCTTTGCCTAGTGTTAGGAAGCTAACAGAAGATAGATGGAACAAGCCCCAGAAGACCAAGGGCCGCAGAGGGAGCCATACAATGAATGGACATTAGAGCTTTTAGAGGAGCTTAAGAGTGAAGCTGTCAGACATTTTCCTAGGATATGGCTCCATAGCTTAGGACAACATATCTATGAAACTTATGGGGATACCTGGGCAGGTGTTGAAGCTATAATAAGAATTCTGCAACAACTACTGTTTATTCATTT*CAGAATTGGGTGTCAACAATGGATCCAGTAGATCCTAATCTAGAGTCCTGGAACCATCCAGGAAGTCAGCCTAGGACTGCTTGTAATAAGTGTCATTGTAAAAAGTGTTGCTATCATTGCCAAGTTTGCTTCATAACGAAAGGCTTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAAACCTCCTCAAGGCGATCAGGCTCATCAAGTTCCTATACCAGAGCAACCCTCCTCCCAGTCCCGAGGGGACCCGACAGGCCCGAAGAAAATGGCAGGAAGAAGCGGAGACAGCGACGAAAACCTCCTCAAGGCGATCAGGCTCATCAAGTTCCTATACCAGAGCAATGCAACCTTTAGTGATAATAGCAATAGCAGCATTAGTAGTAGCAATAATAATAGCAATAGTTGTGTGGACCATAGTATACATAGAATATAGGAGGATAAAAAGGCAAAGAAAAATAGACTGTTTAATTGATAGAATAAGAGAAAGAGCAGAAGACAGTGGCAATGAGAGCGAGGGAGAAAGAGAGGAATTGTCAAAACTTGGGGTGGAAATGGGGCATCATGCTCCTTGGGATGTTGATGACCTGTAGTGCTGCAGAAGATTTGTGGGTCACAGTTTATTATGGGGTGCCTATATGGAAGGAAGCAACTACCACTCTATTTTGTGCATCAGATGCTAAAGCATATAAAAAAGAGGCACATAATATCTGGGCCACACATGCCTGTGTACCCACGGACCCCAACCCACAAGAAATAGAATTGGAAAATGTGACAGAAAACTTTAACATGTGGAAAAATAACATGGTGGAACAAATGCATGAGGATATAATCAGTTTATGGGATCAAAGCCTAAAACCATGTGTAAAATTAACTCCACTCTGTGTCACTTTAAACTGCACTGATGAATTGAGG***AACAGCAAGGGCAATGGGAAG************GAGGAGGAA***AAAAGGAAAAACTGCTCTTTCAATGTAAGG************GATAAGAGGGAGCAAGTATATGCACTTTTTTATAAACTTGATATAGTGCCAATAGACAATAATAGTACTAATTATAGGTTAATAAATTGTGATACCTCAACCATTACACAGGCTTGTCCAAAGATATCCTTTGAACCAATTCCCATACATTTTTGTGCCCCAGCTGGTTTTGCAATTCTAAAGTGTAGAGATAAGAAGTTCAATGGGACAGGCCCATGCTCAAATGTCAGCACAGTACAATGTACACATGGAATTAGACCAGTGGTGTCAACTCAACTGCTGTTGAATGGCAGTCTAGCAGAAGAAGAGATCATAATTAGATCTGAAAATCTCACAAACAATGTTAAAACCATAATAGTACAGCTTAATGCATCTATAGTAATTAATTGTACAAGGCCCTACAAATATACA******AGGCAAAGGACATCGATAGGACTAAGGCAACTCTATACAATAACAGGAAAAACAGGATACATAGGACAAGCACATTGTAAAATTAGCAGAGCAGAATGGAATAAAGCTTTACAACAGGTAGCTACAAAACTAGGAAACCTT***CTTAACAAAACAACAATAACTTTTAAGCCATCCTCAGGAGGGGACCCAGAAATTACATCACACATGCTTAATTGTGGAGGGGACTTCTTCTACTGTAATACATCAAGACTGTTTAATAGTACATGGAATCAG******AGTACAGGGTTCAATAATGGC******************ACAGTCACACTCCCATGCAGAATAAAACAAATTGTAAACTTGTGGCAGAGAGTAGGAAAAGCAATGTATGCCCCTCCCATCGAAGGACTAATTAAATGTTCATCAAATATTACAGGGCTACTATTAACAAGAGATGGTGGTGCAAATAATAGTTCTGAGACCATCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCAATAGGAGTAGCACCCACCAAGGCAAGGAGAAGAGTGGTGGAAAGAGAAAAAAGAGCA******CTAGGAGCTGTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACGATGGGCGCAGCGTCAGTGACGCTGACGGTACAGGCCAGACAGTTAATGTCTGGTATAGTGCACCAGCAAAACAATTTGCTGAGGGCTATAGAGGCGCAACAACATCTGTTGCAACTCACGGTCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATACCTAAGGGATCAACAGCTCCTAGGAATTTGGGGTTGCTCTGGAAGGCACATTTGCACCACTAATGTACCCTGGAACTCTAGTTGGAGTAATAGATCTCTAGATGAGATTTGGCAGAACATGACCTGGATGGAGTGGGAAAGAGAAATTGACAATTACACAGGCTTAATATACAGCTTAATTGAAGAATCGCAGATCCAGCAAGAAAAGAATGAAAAAGAATTATTGGAATTGGACAAATGGGCAAGTTTGTGGAATTGGTTTAGCATAACAAAATGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCCTGATAGGTTTAAGAATAGTTTTTGCTGTGCTTTCTGTAGTAAATAGAGTTAGGCAGGGATACTCACCTCTGTCATTTCAGACCCTCCTCCCAGTCCCGAGGGGACCCGACAGGCCCGAAGAAATAGAAGAAGAAGGTGGAGAGCGAGGCAGAGACAGATCCATTCGATTGGTGAACGGATTATTTGCACTTTTCTGGGACGACCTGAGGAACCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTCAATCTTAATTGCAGCGAGGATTGTGGAACTTCTGGGACGCAGGGGGTGGGAAGCCCTCAAATACCTGTGGAACCTCCTGCAGTATTGGAGTCAGGAACTGAGGAATAGTGCTAGTAGCTTGCTTGATACCATAGCAATAGCAGTAGCTGAGAGGACAGATAGGGTTATAGAAGTAGTACAAAGAGCTTGCAGAGCTATTCTTAACGTACCCAGAAGAATAAGACAGGGCTTGGAAAGGCTTTTGCTAATGGGTGGCAAATGGTCAAAAAGTAGTTTAGTTGGATGGCCTGCTATAAGGGAAAGAATAAGAAAA******CCAGCAGCAGATGGGGTAGGAGCAGTATCTCGAGACCTGGAAAAACATGGGGCAATCACAAGTAGCAATACAGCAAGTACTAATGATACCTGTGCATGGCTGGAAGCACAAGAGGAGAGCGAGGTGGGCTTTCCAGTTAGACCTCAGGTACCTTTAAGACCAATGACTTACAAAGAAGCTGTTGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTTGGTCCAAGAAAAGACAAGAGATCCTTGATCTTTGGGTCTACAACACACAAGGCATCTTCCCCGAT HIV026 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATAGATGGGAAAAAATTAGGTTAAGGCCAGGGGGAAAGAAAAAATATAAGTTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCACAGTTAATCTTGGCCTGTTAGAAACATCAGAAGGATGTAGACAAATACTGGTACAGCTACAACCATCCCTCCAAACAGGATCAGAAGAACTTAAATCATTATATAACACAGTAGCAGTCCTCTATTGTGTGCATCAAGGGATAGAGGTAAAAGACACCAAGGAAGCTTTAGATAAGATAGAGGAAGAGCAAAACAAAAGTAAGAAAAAAGCACAGCCAGCAGCAGCTGACACAGGAAACAGCAGCCAGGTCAGCCACAATTACCCTATAGTGCAGAACCTCCAGGGGCAAATGGTACATCAGTCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTCAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCATCCCACAAGATTTAAACACTATGCTAAACACAGTGGGGGGACATCAAGCAGCTATGCAAATGTTAAAAGAAACCATCAATGAGGAAGCTGCAGAATGGGATAGATTACATCCAGTACATGCAGGGCCTGTTGCACCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACAAATAATCCACCTATCCCAGTAGGAGAAATCTATAAAAGATGGATAATCCTAGGATTAAATAAAATAGTAAGAATGTATAGCCCTACTAGCATTCTGGACATAAGACAAGGACCAAAGGAACCCTTTAGAGACTATGTAGACCGGTTCTATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGAGGTAAAAAATTGGATGACAGAAACCTTGTTGGTCCAAAATGCGAACCCAGACTGTAAGACTATTTTAAAAGCATTAGGACCAGCAGCTACACTAGAAGAAATGATGACAGCATGTCAGGGAGTGGGGGGACCCAGCCATAAAGCAAGAATTTTGGCTGAAGCAATGAGCCAAGTAACAAAT***GCTACCATAATGATGCAGAGAGGCAATTTTAGGAACCAAAGAAAGACTGTTAAGTGTTTCAATTGTGGTAAAGAGGGGCACATAGCCAAAAATTGCAGGGCCCCTAGGAGAAAGGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAAGATTGTACTGAGAGACAGGCTAATTTTTTAGGGAAGATCTGGCCCTCCCACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGACCAGAGCCAACAGCCCCACCAGAGGAGAGCTTCAGGTTTGGGGAAGAGACAACAACTCCTGCTCAGAAGCAGGAACCGATAGACAAGGAGTATCCTCCCTTAGCTTCCCTCAGACCACTCTTTGGCAACGACCCCTCGTCACAATAAAAATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTGAGACAGTATGATCAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATTTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTCAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACCCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTTAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTATATGAAGACTTCAGGAAGTATACTGTATTTACCATACCTAGTATAAACAATGAGGCACCAGGAGTTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCGCCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAACCTTTTAGAAAACAAAATCCAGACGTGGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAGTATCTGTTGAAGTGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTACATCCTGATAAATGGACAGTACAGCCTATAACACTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGAAAATTAAATTGGGCAAGTCAGATTTATCCAGGGATTAAAGTAAAGCAATTATGTAAACTCCTTAGGGGAGCCAAAGCATTAACAGAAGTAATACCACTAACAAAAGAAGCAGAGCTAGAATTGGCAGAAAACAGGGAGATTCTAAAAGTACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAACAGCAGAAATACAGAAGCAGGGGCAAGGCCAATGGACATATCAAATTTATCAAGAGCCATTTAGAAGTCTGAAAACAGGAAAGTATGCAAAAATGAGGGGTACCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAGTAACCACAGAAAGCATAATAATATGGGGAAAGATCCCCAAATTTAAACTACCCATACAAAAAGAAACATGGGACGCATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTCAATACCCCTCCCTTAGTAAAATTATGGTACCAGTTAGAGAAAGAACCCATAGTAGGAGCAGAAACTTTCTACGTAGATGGGGCAGCTAATAGGGAGACTAAATTAGGAAAAGCAGGATATGTTACTGACAGAGGAAGACAAAAGGTTATCTCCCTAACTGACACAACAAATCAGAAGACTGAGTTACAAGCAATTCATCTAGCTTTGCAGGATTCAGGATTAGAAGTAAACATAGTATCAGACTCACAATATGCATTAGGAATCATTCAAGCACAACCAGATAAGAGTGAATCAGAGTTAGTCAGTCAAATAATAGAGCAATTAATAAAAAAGGAAAAGGTCTACCTGGCATGGGTACCAGCACATAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTCAGTGCGGGAATCAGGAAAGTACTATTTTTAGATGGAATAGATAAGGCGCAAGAAGAACATGAGAAATATCATAGTAATTGGAGAGCAATGGCTAGTGATTTTAATCTGCCACCTGTAGTAGCAAAAGAAATAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAACTAGATTGTACACATTTAGAAGGAAAAGTTATCCTGGTAGCAGTTCATGTAGCCAGTGGATATATAGAAGCAGAGGTTATTCCAGCAGAGACAGGGCAGGAAACAGCATACTTTCTCTTAAAATTAGCAGGAAGATGGCCAGTAACAACAATACATACAGACAATGGCAGCAATTTCACCAGTACTACAGTTAAGGCCGCCTGTTGGTGGGCAGGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACAGGTAAGAGATCAAGCTGAACATCTTAAGACAGCAGTACAGATGGCAGTATTCATCCACAATTTTAAGAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGGAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAGCAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAAATCCACTTTGGAAAGGACCAGCAAAGCTCCTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGATAATAGTGAAATAAAAGTAGTGCCAAGAAGAAAAGTAAAGATTATTAGGGATTATGGAAAGCAGATGGCAGGTGATGATTGTGTGGCAGGTAGACAGGATGAGGATTAGAACATGGAAAAGCTTAGTAAAACACCATATGTATATTTCAGGGAAAGCTAAGAGATGGTCTTATAAACATCACTATGAAAGCACTAATCCAAGAGTAAGTTCAGAAGTACACATCCCATTAGGGGATGCTAAATTGGTAATAAAAACATATTGGGGTCTGCATACAGGAGAAAGAGACTGGCATTTGGGTCAGGGAGCCTCCATAGAATGGAGGAAAAAGGGATACAGCATACAAGTAGACCCTGGCCTAGCAGACCAACTAATTCATCTGTATTATTTTGATTGTTTTTCAGAATCTGCTATAAGAAATGCCATATTAGGACATATAGTTAGCCCTAGGTGTGAATATCAAGCAGGACATAACAAGGTAGGATCTCTACAGTACTTGGCACTAGCAGCATTGATAACACCAAAAAAGACAAAGCCACCTTTGCCTAGTGTTACGAAACTGACAGAGGATAGATGGAACAAGCCCCAGAAGACCAAGGGCCACAGAGAGAGCCATACAATGAATGGACACTAGAGCTTTTAGAGGAGCTTAAGAGTGAAGCTGTTAGACATTTTCCTAGGATATGGCTCCATAGCTTAGGACAATATATCTATGAAACTTATGGTGATGCCTGGACAGGAGTAGAAGCCTTAATAAGAACTCTGCAACAACTGCTGTTTATTCATTT*CAGAATTGGGTGTCGACAATGGAGCCAGTAGATCCTAGACTAGAGCCTTGGAATCATCCAGGAAGTCAGCCTAAGACTGCTTGTACCAAATGCTATTGTAAAAAGTGTTGCTTGCATTGCCAAGTTTGTTTTATAACAAAAGGCTTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCCTCCAGACAGTCAAACTCGTCAAGTTTCTCTATCAAAGCAACCCACCTCCCAGCCCCGAGGGGACCCGACAGGCCCGGAGGAAATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCCTCCAGACAGTCAAACTCGTCAAGTTTCTCTATCAAAGCAATCGTATCTTTACAAATAGTAGCAATAGTAGCATTAGTAGTAGTAACAATAATAGCAATAGTTGTGTGGACCATAGTATTCATAGAATATAGGAAAATATTAAGACAAAGAAAAATAGACAGGTTAATTGATAGGATAAGGGAAAGAGCAGAAGACAGTGGCAATGAAAGTGAAGGAGATCAGGAAGAATTATCAGAACTTGGGGTGGAGATGGGGCACCTTGTTCCTTGGGATGTTGATGATCTGTAGTGCTGAAGAAAAATTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAAGAAGCAACTACCACTCTATTTTGTGCATCAGATGCCAAAGCACATGGGACAGAGGTACATAATGTTTGGGCCACACACGCTTGTGTACCCACAGACCCCAACCCACAAGAAATAGTATTGGAAAATGTGACAGAATATTTTGACATGTGGAAAAATAACATGGTAGAACAGATGCAGGAGGATGTAATCAGTTTATGGGATCAAAGCCTAAAACCATGTGTAAAATTAACCCCACTCTGTGTTACTTTAGATTGCACTGATTATGTAGGG***AATGCTACTAATACCACTAGCTGGGGAGCGATGAGA***GGG***GAAATAAAAAACTGCTCTTTCAATATCACTACAAACATAAGAGATAAGGTGCATAAAGAATATGCACTTTTTTATAAACTTGATGTAGTACCAATAGAAAAGAAGAATACTAGCTTTAGATTGATAAGTTGTAACACCTCAACCATTACACAGGCCTGTCCAAAGGTATCCTTTGAGCCAATTCCCATACATTATTGTACCCCGGCTGGTTTTGCGATTCTAAAGTGTAACAATAAGAAGTTTGATGGAAAAGGACAATGTACAAATGTCAGCACAATACAATGTACACATGGAATTAGGCCAGTAGTGTCAACTCAACTGCTGCTAAATGGCAGTCTAGCAGAAGAAGAGGTGGTACTTAGATCTGACAATTTCACAGACAATGCTAAAACCATAATAGTACATCTGAATGAATCTGTAGAAATTAATTGTACAAGGCCCAGCAACAATTCA******AGAAAAAGTATATACATAGGACCAGGGAGAAGATTTCATGTAACAAGAGTAACAGGAGATATAAGACAAGCACATTGTAACATTAGTAAAGCAAAATGGGAGAAAACTCTAAAACAGATAGTTGAAAAATTAAGAGAAAAATTTGGA***AACAAAACAATAATCTTTAATCAATCCTCAGGAGGGGACCCAGAAATTGTAACTCATAGTTTTAATTGTGGAGGGGAATTTTTCTACTGTAATTCAACACAATTGTTTAATAGTACTTGGAATACTAGAGAGTCAAATGAC***ACAAATAATACTGGA************AATATCACACTCCCATGCAGAATAAAACAAATATTAAATTTGTGGCAGGAAGTAGGAAAAGCAATGTATGCCCCTCCCATCAGCGGACAAATTAGCTGTTCATCAAATATTACAGGGCTATTATTAACAAGAGATGGTGGTAATACTAATACTACTGAGACCTTCAGACCTGGAGGAGGAAATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAGTTGAACCATTAGGAATAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCA******CTAGGAGCTATGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCACGGTCAATAACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAACAGCAGAACAATCTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAGTCCTAGCTGTGGAAAGATACCTACAGGATCAACAGCTCCTAGGGATTTGGGGTTGCTCTGGAAAACTCATCTGCACCACTGCTGTGCCTTGGAATTCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGGGTAACATGACCTGGATGCAGTGGGAAAAAGAAATTAACAATTACACAGGCTTAATATACACCTTAATTCAAGAATCACAGAATCAACAAGAAAAGAATGAACAAGAATTATTGGAATTGGATAAGTGGGGAAGTTTGTGGAGTTGGTTTAGCATAACAAACTGGCTGTGGTATATTAAAATATTCATAATGATAGTAGGAGGCTTAGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTTTAGTGAATAGAGTTAGGCAGGGATATCCACCATTATCATTTCAGACCCACCTCCCAGCCCCGAGGGGACCCGACAGGCCCGGAGGAATCGAAGAAGAAGGTGGAGAGGGAGACAGAGACAGATCCAGTCGCTTAGTGCATGGATTCTTAGCACTCGTCTGGGACGATCTACGCAGCCTGTGCCTCTTCAGTTACCACCGCTTGAGAGACTTACTCTCGATTGCAGCGAGGATTGTGGAACTTCTGGGACGCAGGGGGTGGGAAATCCTCAAGTATTGGTGGAATCTCCTGCAGTATTGGAGTCAGGTTCTAAAGAATAGTGCTGTTAGCTTGCTCAATGTTACAGCTATCGCAGTAGCTGAGGGGACAGATAGGATTATAGAAGTAGTGCAAAGAGTTGGTAGAGCTATTCTCCACATACCTGTTAGAATAAGACAGGGCTTAGAAAGAGCTTTGCTAATGGGTGGCAAGTGGTCAAAAAGTAGAAAGATTGGATGGCCTACTGTAAGGGAAAGAATGAAACAAGTTGACCCAGCAGCAGAGGGGGTGGGAGCAGTATCTCGAGACTTGGAAAAACATGGAGCAATCACAAGTAGCAATACAGCAGCTACTAATGCTGATTGTGCCTGGCTAGAAGCACAAGAGGAG***GAGGTGGGTTTTCCAGTCAGACCTCAGGTACCTTTAAGACCAATGACTTTCAAGGGAGCCTTGGATCTTAGCCACTTTTTAAGAGAAAAGGGGGGACTGGAAGGGCTAGTTTACTCCCAAAAAAGGCAAGACATCCTTGACCTGTGGGTCTACCACACACAAGGCTACTTCCCTGAT HIV030 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGACAAATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATCAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAGATAATGGGACAGCTACAACCGTCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAAGATAGAGGTAAAAGACACCAAGGAAGCTTTAGACAAGGTAGAGGAAGAGCAAAACAACAGTAAGAAAAAGGCACAGCAAGAAGCAGCTGACGCAGGAAACAGAAACCAGGTCAGCCAAAATTACCCTATAGTGCAAAACCTACAGGGACAAATGGTACATCAGGCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTAGTGGAAGAGAAGGCTTTCAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGAAACCATCAATGAGGAAGCTGCAGAATGGGATAGATTGCACCCAGTGCATGCAGGGCCTATTGCACCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACAAATAATCCACCTATCCCAGTAGGAGAAATATATAAGAGATGGATAATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTACCAGCATTCTGGATATAAAACAAGGACCAAAAGAACCCTTTAGAGATTATGTAGACCGGTTCTATAAAACCCTAAGAGCCGAGCAAGCTACACAGGAAGTAAAAAATTGGATGACAGAAACCTTGTTGGTCCAAAATGCGAATCCAGATTGTAAGACTATTTTAAAAGCATTAGGACCAGCAGCTACACTAGAAGAAATGATGACAGCATGTCAGGGAGTGGGGGGACCCGGCCATAAAGCAAGAGTTTTGGCTGAAGCAATGAGCCAAGTAACAGGT***GCTGCCATAATGATGCAGAGAGGCAATTTTAGGAACCAAAGAAAGACTGTTAAGTGTTTCAATTGTGGCAAAGAAGGGCACATAGCCAGAAATTGCAGGGCCCCTAGGAAAAAGGGCTGTTGGAAATGTGGAAAGGAAGGACATCAAATGAAGGATTGCACAGAAAGACAGGCTAATTTTTTAGGGAAGATCTGGCCTTCCCACAAGGGGAGGCCAGGAAATTTTCTTCAGAGCAGACCAGAGCCAACAGCCCCACCAGAAGAGAGCTTCAGGTTTGGGGAAGCAGCAACAGCTCCCTCTCAGAAGCAGGAGCCGATAGACAAGGAGTAGTATCCCTTAGCCTCCCTCAAATCACTCTTTGGCAGCGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTAGTAGAAGAAATGAGTTTGCCAGGAAGATGGAAACCAAAAATGATAGGAGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCGTAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAATAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAGGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAAAGAACTCAAGATTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTCCTGGATGTGGGTGATGCATATTTTTCAGTTCCCCTAGATAAAGACTTCAGAAAATATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGAGCAGCATAGAACAAAAATAGAGGAACTGAGACAGCATCTGTTGAAGTGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGAAAATTGAATTGGGCAAGTCAGATTTATGCAGGGATTAAAGTAAAGCAATTATGTAAGCTACTTAGGGGACCCAAAGCACTAACAGAAGTAATACCACTAACAAAAGAAGCAGAGCTAGAACTAGCAGAAAACAGGGAGATTCTAAAAGAACCAGTACATGGAGTGTATTGTGACCCATCAAAAGACTTAGTAGCAGAAATACAGAAGCAGGGGGAAGGCCAATGGACATATCAAATTTATCAAGAACCATTTAAGAATCTGAAAACAGGAAAGTATGCAAGAATGAGGGGTGCCCACACTAATGATATAAAACAGTTAACAGAGGCAGTGCAAAAAATAGCCACAGAAGGCATAGTAATATGGGGAAAGACTCCTAAATTTAGACTACCCATACAAAAGGAAACATGGGAAGCATGGTGGACGGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTCAATACCCCTCCCTTAGTGAAATTATGGTACCAGTTAGAGAAAGAACCCATAGTAGGAGCAGAAACTTTCTATGTAGATGGGGCAGCTAATAGGGAGACTAAATTAGGAAAAGCAGGATATGTTACTGACAGGGGAAGACAAAAAGTTGTCTCCCTAAATGACACAACAAATCAGAAGACTGAGTTACAAGCAATTCATCTAGCTTTGCAGGATTCGGGACTAGAAGTAAACATAGTAACAGACTCACAATATGCATTAGGAATCATTCAAGCACAACCAGATAAAAGTGAATCAGAGTTAGTCAGTCAAATAATAGAGCAGTTAATAAAAAAGGAAAAGGTCTACCTGGCATGGGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTCAGTGCTGGAATCAGAAAAGTACTATTTTTAGATGGAATAGATAAGGCCCAAGAAGACCATGAGAAATATCACAGTAATTGGAGAGCAATGGCTAATGATTTTAACCTGCCACCTGTAGTAGCAAAAGAAATAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAACTAGATTGTACACATTTAGAAGGAAAAATTATCCTGGTAGCAGTTCATGTAGCTAGTGGATATATAGAAGCAGAAGTCATTCCAGTAGAGACAGGGCAGGAAACAGCATATTTTCTCTTAAAATTAGCAGGAAGATGGCCAGTAAAAACAGTACATACAGACAATGGCCCTAATTTCACCAGTACTACGGTTAAGGCCGCCTGTTGGTGGGCAGGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAGTCAAGGGGTAGTAGAATCTATGAATAAAGAGTTAAAGAAAATTATAGGACAGGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGAACCATTTTGGAAAGGACCAGCAAAGCTTCTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGATAATAGTGACATAAAAGTAGTGCCAAGAAGAAAAGCAAAGATCATTAGGGATTATGGAAAACAGATGGGCAGTGATGATTGTGTGGCAAGTAGACAGGATGAGGATTAGAACATGGAACAGTTTAGTAAAACACCATATATATTGTTCACGGAAAGCTAAGAACTGGGTTTATAGACATCACTATGAAAGCACTAATCCAAGAGTAAGTTCAGAAGTACACATCCCACTAGGGGAAGCTAAATTGGTAATAACAACATATTGGGGTCTGCATACAGGAGAAAGAGACTGGCATTTGGGCCAGGGAGCCTCCATAGAATGGAGGAAAAGGAGATATAGCACACAAGTAGACCCTAACCTAGCAGACCAACTAATTCACCTGTATTATTTTGATTGTTTTTCAGAATCTGCTATAAGAAATGCCATATTAGGACGTATAGTTAGTCCTAGGTGTGAATATCAAGCAGGACATAGCAAGGTAGGATCTCTACAATACTTGGCACTAGCAGCATTAACAACACCAAAAAAGATAAAGCCACCTTTGCCTATTGTTACAAAACTGACAGAAGATAGATGGAACAAGCCCCAGAAGACCAAGGGCCACAGAGGGAGCCATACAATGCATGGACACTAGAGCTTTTAGAGGAGCTTAAGAGTGAAGCTGTTAGACATTTTCCCAGGATATGGCTACATAGCTTAGGACAATATATCTATGAAACTTATGGGGATACTTGGGCAGGAGTAGAAGCCATAATAAGAATACTGCAACAACTGCTGTTTATTCATTT*CAGAATTGGGTGTCGCCAATGGAGCCAGTAGATCCTAGACTAGAGCCCTGGAAGCATCCAGGAAGTCAGCCTAGGACCCCTTGTACCAATTGCTATTGTAAAAAGTGTTGCCTTCATTGCCAAGTTTGTTTCACAAGAAAAGGCTTAAGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCCTCAAGACAGTCAGACTCATCAAGTTTCTCTACCAAAGCAACCCTCCTCCCAGCAACGAGGGGACCCCGACAGCCCGAAGAAAATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCCTCAAGACAGTCAGACTCATCAAGTTTCTCTACCAAAGCAATGTTATCTTTACAAATAGCAGCAATAGTAGCATTAGTAGTAGCAGCAATAATAGTAATAGTTGTGTGGACCATAGTAGTCATAGAATATAGGAAATTATTAAGACAAAGAAAAATAAACAGGTTAATTGATAGACTAACAGAAAGAGCAGAAGACAGTGGCAATGAAAGTGAAGGAGACCAGGAAGAATTATCAGCGCTTGGGGTGGAGAGGGGGCACCTTGCTCCTTGGGATGTTAATGATCAGTAGTGTTGCAGGAAACTTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAAGAAGCAACTACCACTCTATTTTGTGCATCAGATGCTAAAGCTTATGATACAGAGGTACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGACCCCAACCCACAAGAAGTAGTAATGGGAAATGTGACAGAAAATTTTAACATGTGGAAAAATGACATGGTAGAACAGATGCAGGAAGATATAATCAGTTTATGGGATCAAAGCCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTACTTTAAAATGCACTGATTATAAT******AATGCCACTAACAGT******TGGGGAAGGATGGAGAAAGGA***GAAATACAAAACTGCTCTTTCAAGGTCACCACAAACATAAGAGATAAGGTACAGAAAGAATCTGCACTTTTTTATAAAACTGATGTAGTACCAATAGATAATAATAAGACTAGTAATAGGTTGATACATTGTAATAGATCTGTCATTACACAAGCCTGTCCAAAGGTATCCTTTGAGCCAATTCCCATACATTATTGTGCCCCAGCTGGTTTTGCGATTTTAAAGTGTAATGATAAAAAGTTCAATGGAAAAGGACCATGTAAAAATGTCAGCACAGTACAGTGTACACATGGAATTAGGCCAGTAGTGTCAACTCAACTGCTGTTAAATGGTAGTCTAGCAGAAAAAGAAGTAGTAATTAGATCTGACAATTTCACAGATAATACTAAAACCATAATAGTACATCTGAACGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACA******AGAAAAGGTATACATATAGGACCAGGGAGAGCAGTTTATACGACAGGAATAGTAGGAGATATAAGACTAGCACATTGTAACATTAGTAGAGCAAGATGGAATAAAACTCTAAACCAAATATTTAGAAAATTAAGAGAAATTTTTGAA***AATAAAACAATAGTCTTTAATCGATCCTCAGGAGGAGACCCAGAAATTGTAATGCACAGCTTTAATTGTGGAGGGGAATTTTTCTACTGTAATTCAACAAAACTGTTTAATAGTACTTGGAATAATAGTACTTGGAATGAT***AATGGAAATGAC***************ACTATCATACTGCCATGTAGAATAAAACAAATTATAAACATGTGGCAGGAAGTAGGAAAAGCAATGTATGCCCCTCCCATTGGAGGACTAATTAGATGTTCATCAAATATTACAGGGCTGATATTAACAAGAGATGGTGGTAATGATAACAGTAGTGAGATCTTCAGACCTGGAGGGGGAAATATGAGGGACAATTGGAGAAATGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCG******CTAGGAGCTATGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCACGGTCACTGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAACAGCAAAACAATTTGCTGAGAGCTATTGAGGCGCAACAACATCTGTTGCAACTCACAGTCTGGGGCATCAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATACCTAAGGGATCAACAGCTCCTAGGGATTTGGGGTTGCTCTGGAAAACTCATCTGCACCACTACTGTGCCTTGGAATGCTAGTTGGAGTAATAAAACCCTGGATCAGATTTGGAATAACATGACCTGGATGGAGTGGGAAAGAGAAATTGACAATTACACAAGCTTAATATATACCTTAATTGAACAATCGCAAAACCAACAAGAAAAGAATGAACAAGAATTATTGGAATTGGATAAGTGGGCAAGTTTGTGGAGTTGGTATGACATATCAAATTGGCTGTGGTATATAAAAATATTCATAATGATAGTAGGAGGCTTGATAGGTTTAAGAATAGTTTTTGCTGTGCTTTCTATAGTGAATAGAGTTAGGCAGGGATACTCACCATTGTCGTTTCAGACCCTCCTCCCAGCAACGAGGGGACCCCGACAGCCCGAAGAAATCGAAGAAGAAGGTGGAGAGAGAGACAGAGGCAGATCCGTTCGATTAGTGAGCGGATTCTTAGCACTTTTCTGGGACGACCTGCGGAGCCTGTGCCTCTTCAGCTACCGCCGCTTGAGAGACTTACTCTTGATTGTAGCGAAGATTGTGGAAACTCTGGGACGCAGGGGGTGGGAAGTCCTCAAGTATTGGTGGAATCTCCTGCAGTATTGGAGCCAGGAACTAAAGAATAGTGCTGTCAGCTTGTTCAATACTATAGCTATAGCAGTAGCTGAGGGAACAGATAGGGTTATAGAAGTAGTACAAAGAGCTTGTAGAGCAATTCTCCACATACCTAGAAGAGTGAGACAGGGCTTGGAAAGGGCCTTGCTAATGGGTGGCAAGTGGTCAAAA******TGTAGTGGATGGCCTACTGTAAGGGAAAGAATGAAACAA******CCAGCAGCAGATGGGGTGGGAGCAGCATCTCGAGACCTGAAAAAACATGGAGCAATCACAAGTAGCAATACAGCAACTAATAACGCTGCTTGTGCCTGGCTAGAAGCACAAGAGGAA***GAGGAGGGTTTTCCAGTCAGACCACAGGTACCTTTAAGACCAATGACTTACAAGGGAGCTTTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGTTAATTTACTCCCCAAAAAGACAAGAGATCCTTGATCTGTGGGTCTACCACACACAAGGCTACTTCCCTGAT HIV036 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATGCTTGGGAGAAAATTCGGTTAAGGCCAGGGGGAAAGAAACAATATAGAATGAAACATTTAGTATGGGCAAGCAGGGAGCTGGAAAAATTCGCACTCAACCCTAGTCTTTTAGAAACAGCAGAAGGATGTAGACAAATAATAGGGCAGTTACAACCAGCTCTCCCGACAGGAACAGAAGACATTAGATCATTATATAATACAGTAGCAGTCCTCTATTATGTACATCAAAGGATAGAGGTAAAAGACACCAAGGAAGCTCTAGATAAAATAGAGGAAGAACAAAACAAACACAAGCAGAAGACACAGCATGCAGCAGCTGACACAGGAAGCAGC******AGCAGTCAGAATTACCCCATAGTGCAAAATGCACAAGGGCAAATGGTACACCAGGCCATATCACCTAGGACTTTAAATGCATGGGTCAAAGTAGTAGAAGAGAAGGCTTTCAGCCCAGAAGTAATACCCATGTTTTCAGCACTATCAGAAGGAGCCACCCCACAAGACTTAAATACTATGCTAAACACAGTGGGGGGACATCAAGCAGCTATGCAAATGTTAAAAGATACTATCAATGAGGAAGCTGCAGAATGGGACAGGGTACATCCAGTACATGCAGGGCCTATTCCACCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACCAGCAACCCACCTATCCCAGTGGGAGAAATCTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTGTCAGCATTTTGGACATAAGACAAGGGCCAAAAGAACCCTTTAGAGACTATGTAGATAGGTTCTTTAAAACTCTCAGAGCTGAGCAAGCTACACAGGAGGTAAAAAATTGGATGACAGACACCTTGCTGGTCCAAAATGCGAACCCAGATTGTAAATCCATCTTGAGAGCGTTAGGACCAGGGGCTACATTAGAGGAAATGATGACAGCATGTCAGGGAGTGGGAGGACCCGGCCATAAAGCAAGGGTTTTGGCTGAAGCAATGAGCCAAGTACAAAAT***CCAAACATAATGATGCAGAGAGGCAATTTTAGGAGTCAAAAAAGA***ATTAAGTGTTTCAACTGTGGCAAGGAAGGGCACCTAGCCAGAAATTGCAGGGCCCCTAGGAAAAAGGGCTGCTGGAAATGTGGAAAGGAAGGACATCAAATGAAAGACTGTACTGAGAGGCAGGCTAATTTTTTAGGGAAAATTTGGCCTTCCCACAAGGGGAGGCCAGGGAATTTCCTTCAGAACAGGCCAGAGCCAACAGCCCCACCAGCAGAAAGCTTCAGGTTCGAGGAAGAGGAGACAACCTCCGCTCCGAAGCAGGAGCTGAAAGACAGGGAG*****GCCCTTAATTTCCCTCAAATCACTCTTTGGCAACGACCCCTTGTCACAGTAAAAATAGAAGGACAGCTGAAAGAAGCTCTATTAGATACAGGAGCAGATGATACAGTGTTAGAAGACATAAATCTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATAGTTATAGAAATTTGTGGAAAAAGGGCCATAGGTACAGTATTAGTAGGACCCACGCCTGTCAACATAATTGGAAGAAATATGTTGGTTCAGCTTGGTTGTACTTTAAATTTTCCAATAAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGTAGAGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAACACTCCAGTGTTTGCTATAAAGAAAAAAGACAGCACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTCAATAAGAGAACTCAAGACTTCTGGGAAGTTCAGTTAGGAATACCACATCCAGCAGGATTGAAAAAGAAAAAATCAGTAACAGTACTAGATGTGGGGGACGCATATTTTTCCGTTCCCTTACATGAAGACTTCAGAAAATATACTGCATTCACCATACCTAGTATAAACAATGAGACACCAGGAATTAGGTATCAGTACAATGTACTTCCACAGGGATGGAAGGGATCACCATCAATATTCCAGAGTAGCATGACAAAAATCTTAGATCCCTTTAGATCAAAAAATCCAGAAATAGTCATCTACCAATACATGGATGACTTGTATGTAGGATCTGATTTAGAAATAGGTCAGCATAGAGCAAAAATAGAGGAATTAAGAGCTCATTTATTGAAATGGGGATTTACTACACCAGACAAAAAACATCAAAAAGAACCCCCATTTCTTTGGATGGGGTATGAACTCCATCCTGACAAATGGACAGTACAGCCTATACAGCTACCAGAAAAGGATAGCTGGACTGTCAATGATATACAGAAGTTAGTGGGAAAGTTAAATTGGGCAAGTCAGATTTATGCAGGGATTAAAGTAAGGCAACTGTGTAAACTCCTTAGGGGGGCTAAAGCACTAACAGACATAGTACCACTGACTAAAGGAGCAGAATTAGAATTGGAAGAGAACAGGGAGATTCTAAAGGACCCTGTACATGGGGTATACTATGACTCATCAAAAGACTTAATAGCAGAAATACAGAAACAGGGGCATGACCAATGGACATATCAAATTTATCAAGAACCATTTAAAAATCTGAAAACAGGGAAGTATGCAAAAATGAGGACTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAGCCATGGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAGACTGCCCATCCAAAAGGAAACATGGGAGACATGGTGGACAGATTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTCAATACCCCTCCTCTAGTAAAACTATGGTACCAGTTAGAAAAGGAACCCATAGCAAGAGCAGAAACTTTCTATGTAGATGGGGCAGCTAATAGAGAGACTAAACTAGGAAAGGCAGGGTATGTCACTGACAGAGGAAGACAAAAAATTGTCTCCCTGACGGAGACAACAAATCAAAGGGCTGAATTACATGCAATCTATTTGGCTTTACAGGATTCAGGATTAGAGGTAAATATAGTAACAGACTCACAGTATGCATTAGGAATCATTCAAGCACAACCAGATAAGAGTGAATCAGAGTTAGTCAACCAAATAATAGAAAAGTTAATAGGAAAGGAAAGGATCTACCTGTCATGGGTACCAGCACACAAAGGGATTGGGAGAAATGAACAGGTAGACAAATTAGTCAGTTCTGGAATCAGGAAAGTGTTATTTTTAGATGAGATAGATAAGGCTCAAGAAGAACATGAAAGATATCATAGTAATTGGAGAGCAATGGCTCATGACTTTAATCTGCCACCTATAGTAGCAAAAGAAATAGTAGCTAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAACTAGATTGCACACATCTAGAAGGAAAAGTTATCCTGGTAGCAGTCCATGTAACCAGTGGCTATATGGAAGCAGAAGTCATCCCAGCAGAAACAGGGCAGGAGACAGCATACTTTATATTAAAACTAGCAGGAAGATGGCCAGTAAAAGTAATACATACAGACAATGGGCCCAATTTCACTAGTGCAACAGTTAAGGCGGCCTGTTGGTGGGCAGGTGTCCAACAGGAATTTGGGATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATCTATGAATAAAGAATTAAAGAAAATCATAGGGCAGGTAAGAGATCAAGCTGAACACCTTAAGACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGATACAGTGCAGGGGAAAGAATAATAGACATAATAGCAACAGATATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCACAAATTTCGGGTTTATTACAGGGACAGCAGAGATCCAATTTGGAAAGGACCAGCAAAGCTCCTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGACAATAGTGATATAAAGGTAGTACCAAGAAGAAAAGTAAAGATCATTAGGGATTATGGAAAACAGATGGCAGGCGATGATTGTGTGGCAGGTAGACAGGATGAGGATTAGAACATGGAACAGTTTAGTAAAACATCATATGTATGTTTCAAAGAAAGCTACGGGTTGGTTCTATAGACATCACTATGAAAGCAGACATCCAAGGGTAAGTTCAGAAGTGCACATCCCGCTAGGGGAGGCTAGATTAGTAGTAAGAACATATTGGGGTCTGCACTCAGGAGAAAAAGACTGGCACTTGGGTCATGGGGTCTCCATAGAATGGAGGCAGAAAAGGTATAGTACACAAATAGACCCTGATCTGGCAGACCATCTAATCCATCTGTATTATTTTGACTGTTTTTCAGAATCTGCCATAAGGAAAGCCATATTAGGAGAAATAGTTAGTCCTAGGTGTGAATATCAAGCAGGACATAACAAGGTAGGATCTTTGCAATATTTGGCATTGAGAGCATTAGTAGCTTCAACAAGGACAAACCCACCTTTGCCTAGTGTTAGGAAATTAGCAGAGGATAGATGGAACAAGCCCCAGAAGACCAGGGGCCACAGAGGGAGCCATACAATGACTGGGTGTTAGAACTGTTAGAGGAGCTCAAGCAGGAAGCTGTTAGACATTTCCCTAGGCAGTGGCTACATGGCCTGGGACAACATATCTATAATACCTATGGGGATACTTGGGAAGGAGTTGAAGCTTTTATAAGAACTTTGCAACAACTACTGTTTGTTCATTT*CAGAATTGGGTGCCAACAATGGATCCGGTAGACCCTAAACTAGAGCCCTGGAACCATCCGGGAAGTCAGCCTAAAACTGCTTGTACCAAGTGTTATTGTAAAAAGTGTTGCTATCATTGCCCAGTGTGCTTTCTAAACAAAGGCTTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACCCCGACGAAGATCTTCTCAAAACAGTGAGGATCATCAAAATCCTATACCAAAGCAATCCCTACCCCACACCCAGAGGGTCTCGACAGGCCCGGAAGAAATGGCAGGAAGAAGCGGAGACCCCGACGAAGATCTTCTCAAAACAGTGAGGATCATCAAAATCCTATACCAAAGCAATGTTACCCTTAGCAACATTGTCAATAGTAGGACTGATAGTAGCGTTAATCTTAGCAATAGTGGTATGGACTATAGTATTTATAGAATATAAGGAAATTAAGAAGCAAAAGAAAATAGACTGGCTAATCAAGAGAATAAGTGAAAGAGCAGAAGACAGTGGCAATGAGAGTGAGGGGGATACCGAAGAATTGGCAACAATGGGGGTGGATATGGGGCATCTTAGGCTTTTGGATGTTAATGATTTGTAGTGTGGTGGGAAACTTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAGAGAAGCAAAAACTACTCTATTCTGTGCATCAGATGCTAAAGCATATGAGAGAGAAGTGCATAATGTCTGGGCTACACATGCCTGTGTACCCACAGACCCCAACCCACAAGAAATAGTTTTGGAAAATGTAACAGAAAATTTTAACATGTGGAAAAATGACATGGTGGATCAGATGCATGAGGATATAATCAGTTTATGGGATCAAAGCCTAAAGCCATGTGTAAAATTAACCCCTCTCTGCGTCACTTTAAATTGTAGT***************GATGCCACTAGTACCAATAGC*********AACACCACTGAA***GAAATAAAAAACTGCTCTTACAGGACTACCACAGAACTAAAAGATAAGACGCAGAGAGTCTATTCACTGTTTTATAAACTTGATGTAGTACAAATTGATCCAAGT***AATACTTATAGACTAATAAGTTGTAATACCTCAGCCATCGCACAAGCTTGTCCAAAGGTATCCTTTGAGCCAATTCCTATACATTATTGTACCCCAGCTGGTTTTGCGATTCTAAAATGTAAGGATACGGAATTCAATGGAACAGGGTCATGCAAGAATGTTAGCTCAGTACAATGTACACATGGAATTAGGCCAGTAGTATCAACTCAACTGCTGTTGAATGGCAGTCTAGCAGAAGGAGAGGTAATGATTAGATCTGAGAATATTACAGACAATGCCAAAAACATAATAGTACAGTTTACTGAACCTGTACAAATTAGTTGTACCAGACCCGGCAACAATACA******AGAAGAAGTATCCGCTTTGGACCAGGACAAGCCTTCTATACAAAT***ATAATAGGGGATATAAGACAAGCATATTGTAGTATCAACGAAACAAAATGGAATGCCACTTTACAAAAGGTAGCTAAACAATTACAA***AACTACTTCCCTAACAAAACAATAAGCTTTGCTAACTCTTCAGGAGGGGACCTAGAAATTACAACACATAGTTTTAATTGTGGAGGAGAATTTTTCTATTGCAATACATCAAACCTGTTTAAT***ACATACAATCCT***AATAGTACAGAA*********AGTAATTCA******GACTTAAACATCACACTCCCATGCAGAATAAAACAAATTATAAACATGTGGCAGAGAGTAGGACGAGCAATGTATGCCCCTCCCATTGCAGGAGTAATAAAGTGTACATCAAACATTACAGGAATAATATTGTCAAGAGATGGTGGGAACAGTACCAATGGGGAGACCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAGTATAAAGTAGTAAAACTAGAACCACTAGGAGTAGCACCCACCAAGCCAAGGAGAAGAGTGGTGGAGAGAGAAAAAAGAGCAGTTGGACTGGGAGCTGTCTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCGGCATCAATAACGCTGACGGTACAGGCCAGACAACTGTTGTCTGGTATAGTGCAACAGCAAAGCAATTTGCCGAAGGCTATAGAGGCTCAACAGCATCTGTTGAAACTCACGGTCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTATGGAAAGATACCTACAGGATCAACAGCTCCTGGGAATTTGGGGCTGCTCTGGAAAACTCATCTGCACCACTACTGTGCCCTGGAACTCTAGTTGGAGTAATAAGACTCAGGATGAGATTTGGGACAAAATGACCTGGTTGCAATGGGACAAAGAAATTAGCAATTACACAGAAATAATATACCAGCTACTTGAGGACTCGCAGAACCAGCAGGAAAAGAATGAGCAAGACTTATTGGCATTAGACAAATGGGCAAATTTGTGGAATTGGTTTGACATAACAAGATGGCTATGGTATATAAAAATATTTATAATAATAGTAGGAGGCTTGATAGGATTAAGAATAGTTATTGCTATAATTTCTGTAGTAAATAGAGTTAGGCAGGGATACTCACCTTTGTCATTTCAGATCCCTACCCCACACCCAGAGGGTCTCGACAGGCCCGGAAGAATCGAAGAAGGAGGTGGAGAGCAAGGCAGAGACAGATCGATTCGATTAGTGAGCGGATTCTTAGCGCTTGCCTGGGACGATCTGAGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGATTGCATCTTGATTGCAGCGAGGACTGTGGAACTTCTGGGACACAGGGGGTGGGAAGGCCTCAAGCATCTATGGAATCTTCTGTTATATTGGGGTCAGGAATTGAAGAATAGTGCTATTAGTTTACTTGATACCATAGCAATAGCAGTAGCTGAGTGGACAGATAGGATTATAGAAATAGGACAAAGAGCTTGCAGAGCTATTCGCAATATACCTACAAGAATAAGACAGGGCTTTGAAAGGGCTTTACTGATGGGAGGCAAGTGGTCAAAAAGTAGCATAGTGGGATGGCCTGAAGTTAGGGAGAGAATGAAAAGAACTCCTCCAGCAGCAGAAGGAGTAGGAGCAGTGTCTCAAGATTTAGCTGCACGTGGAGCAGTCACAAGCAGTAATACAGCACATACTAATCCTGATTGTGCCTGGCTGGGAGCGCAAGAAGAGGGGGAGGTAGGCTTCCCAGTCAAGCCACAGGTACCTTTAAGACCAATGACCTACAAGGGAGCTGTGGATCTCAGCCACTTTTTAAAAGAAAAGGGGGGACTGGATGGGTTAATTTACTCCCAGAGAAGGCAAGAAATCCTTGATCTGTGGGTCTACCACACACAAGGCTACTTCCCTGAT HIV039 ATGGGTGCGAGAGCGTCAGTATTAAGCGGCGGAAAATTAGATAGATGGGAAAAAATTCGGTTGAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAACCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAAATCATTATTTAATACAGTAGCAACCCTCTATTGTGTGCATCAAAACATAGATGTAAGAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAACAAAACAAAAGTAAGAAAAAAGCACAGCAAGCAGCAGCTGACGCAGAAAAAAGCAGCCAGGTCAGCCAAAATTACCCTATAGTGCAGAACCTACAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTCAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGAGACCATCAATGAGGAAGCTGCAGAATGGGATAGATTGCATCCAGTGCATGCAGGGCCTATTGCACCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAAGAACAAATAGGATGGATGACAAATAATCCACCTATCCCAGTAGGAGAAATTTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTACCAGTATTCTGGACATAAGACAAGGACCAAAGGAACCCTTTAGAGATTATGTAGACCGGTTCTATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGAGGTAAAAAATTGGATGACAGAAACCTTGCTGGTCCAAAATGCGAACCCAGATTGTAAGACTATTTTAAAAGCATTAGGACCAGCAGCTACACTAGAAGAAATGATGACAGCATGTCAGGGAGTAGGGGGACCCGGCCATAAAGCAAGAGTTTTGGCTGAAGCAATGAGCCAGGTAACAAAT***GCTACCATAATGATGCAGAGAGGCAATTTTAGGAATCAAAGAAGGACTGTTAAGTGTTTCAATTGTGGCAAAGAAGGGCACATAGCCAAAAATTGCAGGGCCCCTAGGAAGAAGGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAAGATTGTACTGAGAGACAGGCTAATTTTTTAGGGAAGATCTGGCCTTCCCACAAGGGGAGGCCAGGGAATTTTCTACAGAGCAGACCAGAGCCAACAGCCCCACCAGAAGAGAGCTTCAGGTTTGGGGAGGAGACAACAACTCCCTCTCAGAAGCAGGAGCCGATAGACAAGGAGTAGTATCCTTTGACTTCCCTCAAATCACTCTTTGGCAACGACCCATCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACATGAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAGAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAGATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAGGACTTCAGAAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAGAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAGGTGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAGCCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGAAAATTGAATTGGGCAAGTCAGATTTATGCAGGGATTAAAGTAAAGCAATTATGTAAACTCCTTAGAGGAACCAAAGCACTAACAGAAGTAGTACCACTAACAGAAGAAGCAGAGCTAGAACTGGCAGAAAACAGGGAGATTCTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACCTAGTAGCAGAAGTACAGAAACAGGGGCAAGGCCAATGGACATATCAAATTTATCAAGAGCCATTTAAAAATCTGAAAACAGGAAAGTATGCAAAAATGAGGGGTGCCCACACCAATGATGTAAAACAGTTAACAGAGGCAGTGCAAAAAATAGCCACAGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAAACTACCCATACAAAAAGAAACATGGGAAGCATGGTGGATGGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTCAATACCCCTCCCTTAGTGAAATTATGGTACCAGTTAGAGAAAGAACCCATAGTAGGAGCAGAAACTTTCTATGTAGATGGGGCAGCTAATAGAGAAACTAAATTAGGAAAAGCAGGATATGTTACTGACAGAGGAAGACAAAAAGTTGTTCCCCTAACTGACACAACAAATCAGAAGACTGAGTTACAAGCAATTCATCTAGCTTTGCAGGATTCGGGATTAGAAGTAAACATAGTAACAGACTCACAATATGCATTAGGAATCATTCAAGCACAACCAGATAAGAGTGAATCAGAGTTAGTCAGTCAAATAATAGAGCAGTTAATAAAAAAGGAAAAGGTCTACCTGGCATGGGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAATAGATAAATTAGTCAGTAATGGAATCAGGAAAGTACTATTTTTGGATGGAATAGATAAGGCCCAAGAAGATCATGAGAAATATCACAGTAATTGGAGAGCAATGGCTAGTGATTTTAACCTGCCACCTATAGTAGCAAAAGAGATAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAACTAGATTGTACACATTTAGAAGGAAAAATTATCCTGGTAGCAGTTCATGTAGCCAGTGGATATATAGAAGCAGAGGTTATTCCAGCAGAGACAGGACAGGAAACAGCATACTTTATCTTAAAATTAGCAGGAAGATGGCCAGTAACAACAATACATACAGACAATGGCACCAATTTCACCAGCACTACGGTTAAGGCCGCCTGTTGGTGGGCAGGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAGTCAAGGGGTAGTAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACAGGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGATACAGTGCAGGGGAAAGAATAGTAGACATGATAGCAACAGACCTACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATCCACTTTGGAAAGGACCAGCAAAGCTTCTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGATAATAGTGACATAAAAGTAGTGCCAAGAAGAAAAGCAAAAATCATTAGGGATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGATTAGAACATGGAAAAGTTTAGTAAAACACCATATGTATATTTCAGGGAAAGCTAAGAAATGGGTTTATAAACATCACTATGAAAGCATGAATCCAAGAACAAGTTCAGAAGTACACATCCCACTAGGGGACGCTAGATTGGTAATAAAAACATATTGGGGTCTGCATACAGGAGAAAGAGACTGGCATTTGGGTCAGGGAGTCTCCATAGAATGGAGGAAAAAGAGATATAGCACACAAGTAGACCCTGGCCTAGCAGACCAACTAATTCATATATATTATTTTGATTGTTTTTCAGAATCTGCTATAAGAAATGCCATATTAGGATACAGAGTTAGTCCTAGGTGTGAATATCAAGCAGGACATAGCAAGGTAGGATCTCTACAATACCTGGCACTAACAGCATTAATAACACCAAGAAAGATAAAGCCACCTTTGCCCAGTGTTACAAAACTGACAGAGGATAGATGGAACAAGCCCCAGAAGATCAAGGGCCACAGAGGGAGCCATACAATGAGTGGACACTAGAACTTTTAGAAGAACTTAAGAGTGAAGCTGTTAGACATTTTCCTAGGCCATGGCTCCATGGCTTAGGACAACATATCTATGAAACTTATGGGGATACTTGGGCAGGAGTGGAAGCCATAATAAGAATTCTGCAACAACTGCTGTTTATTCATTT*CAGAATTGGGTGTCAACAATGGAGCCAGTAGATCCTAGACTAGAGCCCTGGAAGCATCCAGGAAGCCAGCCTAGGACTGCTTGTAATAATTGCTATTGTAAAAAGTGTTGCTTTCATTGCCAAGTTTGCTTCACAAGAAAAGGCTTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAACTCCTCAAGACAGTCAGACTCATCAACTTTCTCTATCAAAGCAACCCACCTCCCAGCCCCGAGGGGACCCGACAGGCCCGAAGGAAATGGCAGGAAGAAGCGGAGACAGCGACGAAGAACTCCTCAAGACAGTCAGACTCATCAACTTTCTCTATCAAAGCAATGCAACCTTTACAAATATTAGCAATAGTAGCATTAGTAGTAGCAGCAATAATAGCAATAGTTGTGTGGACCATAGTATTCATAGAATATAGGAAAATATTAAGACAAAGAAAAATAGACAGGTTAATTGATAGGATAACAGAAAGAGCAGAAGACAGTGGCAATGAAAGTGAAGGGGATCAGGAAGAATTATCAGCACTTGGGGTGGAAATGGGGCATCATGCTCCTTGGGATGTTGATGATCTGTAGTGCTGTAGAAAATTTGTGGGTCACAGTTTATTATGGGGTACCTGTGTGGAAAGAAGCAACCACCACTCTATTTTGTGCATCAGATGCTAAAGCATATGATACAGAGGTACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGACCCCAACCCACAAGAAGTAGTATTGGAAAATGTGACAGAAAATTTTAACATGTGGAAAAATAACATGGTAGAACAGATGCATGAGGATATAATCAGTTTATGGGATCAAAGCCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTACTTTAAATTGCACTGATTTGAGG******AATGTTACTAATATCAATAAT************ATGAGAGGA***GAAATAAAAAACTGCTCTTTCAATATCACCACAAGCATAAGAGATAAGGTGAAGAAAGACTATGCACTTTTTTATAGACTTGATGTAGTACCAATAGATAATGATAATACTAGCTATAGGTTGATAAATTGTAATACCTCAACCATTACACAGGCCTGTCCAAAGGTATCCTTTGAGCCAATTCCCATACATTATTGTACCCCGGCTGGTTTTGCGATTCTAAAGTGTAAAGATAAGAAGTTCAATGGAACAGGGCCATGTAAAAATGTCAGCACAGTACAATGTACACATGGAATTAGGCCAGTAGTGTCAACTCAACTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTAGTAATTTCACAGACAATGCAAAAAACATAATAGTACAGTTGAAAGAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACA******AGGAAAAGTATACATATAGGACCAGGAAGAGCATTTTATACAACAGGAATAATAGGAGATATAAGACAAGCACATTGCAACATTAGTAGAACAAAATGGAATAACACTTTAAATCAAATAGCTACAAAATTAAAAGAACAATTTGGGAATAATAAAACAATAGTCTTTAATCAATCCTCAGGAGGGGACCCAGAAATTGTAATGCACAGTTTTAATTGTGGAGGGGAATTTTTCTACTGTAATTCAACACAACTGTTTAATAGTACTTGGAATTTTACACAATCGAATGGTACTGAAGGAAATGAC***************ACTATCACACTCCCATGTAGAATAAAACAAATTATAAACATGTGGCAAGAAGTAGGAAAAGCAATGTATGCCCCTCCCATCAGAGGACAAATTAGATGTTCATCAAATATTACAGGGCTGATATTAACAAGAGATGGTGGA***AACCACAATAATGAGACCTTTAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCA******ATAGGAGCTATGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATAACGCTGACGGTACAGGCCAGACTATTATTGTCTGGTATAGTGCAACAGCAGAACAACTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATACCTAAGGGATCAACAGCTCCTAGGGATTTGGGGTTGCTCTGGAAAACTCATCTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAAACTCTGGATATGATTTGGAATAACATGACCTGGATGGAGTGGGAAAGAGAAATCGACAACTACACAGGCTTAATATACACATTAATTGAAGAATCGCAGAACCAGCAAGAAAAGAATGAACAAGAATTATTAGAATTAGATAAGTGGGCAAGTTTGTGGAATTGGTTTGACATAACAAATTGGCTGTGGTATATAAAAATATTCATAATGATAGTAGGAGGCTTGATAGGTTTAAGAATAGTTTTTACTGTACTTTCTATAGTAAATAGAGTTAGGCAGGGATACTCACCATTGTCATTTCAGACCCACCTCCCAGCCCCGAGGGGACCCGACAGGCCCGAAGGAATCGAAGAAGAAGGTGGAGACAGAGACAGAGACAGATCCGTGCGATTAGTGGATGGATTCTTAGCACTTTTCTGGGACGACCTGCGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTTGATTGTAGCGAGGATTGTGGAACTTCTGGGACGCAGGGGGTGGGAAGCCCTCAAGTATTGGTGGAATCTCCTGCAGTATTGGAGTCAGGAACTAAGGAATAGTGCTGTTAGCTTGCTTAATGCCACAGCTATAGCAGTAGCTGAGGGGACAGATAGGGTTATAGAAATAGTACAAAGAATTTATAGGGCTATTCTCCACATACCTACAAGAATAAGACAGGGCTTGGAAAGGCTTTTGCTAATGGGTGGCAAGTGGTCAAAACGTAGTATGGCTGGATGGCCTACTGTAAGGGAAAGAATGACACGA*********GCAGCAGATGGGGTGGGAGCAGCATCTCGGGACCTGGAGAAACATGGAGCACTCACAAGTAGCAATACAGCAACTAATAATGCTGCTTGTGCCTGGCTAGAAGCACAAGAGGAA***GAGGTGGGTTTTCCAGTCAGACCTCAGGTACCTTTAAGACCAATGACTTACAAGGCAGCAGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCATTCCCAGAAAAGACAAGAGATCCTTGATCTGTGGGTTTACCACACACAAGGCTACTTCCCTGAT HIV047 ATGGGCGCGAGAGCGTCAGTATTAAGCGGGGGACAATTAGATAGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAGATTAAAACATCTAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGAACAGCTACAACCAGCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATTCAATACAGTAGCAACCCTCTATTGTGTGCATCTAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGAGAAGATAGAGGAAGAGCAAAACAAAAGTAAGAAAAAGGCACAGCAAACAGCAGCTGGCACAGGAAACAACAGCCAGGCCAGCCAAAATTACCCTATAGTGCAAAACCTCCAGGGGCAAATGGTACATCAGCCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAAGCTTTTAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCAATGCAAATGTTAAAAGAAACCATCAATGAAGAAGCTGCAGAATGGGATAGATTGCATCCAGTGCATGCAGGGCCAGTTGCACCAGGCCAGATGAGAGAACCAAGAGGAAGTGACATAGCAGGAACTACTAGTACTCTTCAGGAGCAAATAGGATGGATGACAAATAATCCACCTATCCCAGTAGGAGAAATCTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTACCTGCATTCTGGACATAAGACAAGGACCAAAGGAACCCTTTAGAGACTATGTAGACCGGTTCTATAAGACTCTAAGAGCCGAGCAAGCTTCACAAGATGTAAAAAATTGGATGACAGAAACCTTGTTGGTCCAAAATGCGAACCCAGATTGTAAGACTATTCTAAAAGCATTGGGACCAGCAGCTACACTAGAAGAAATGATGACAGCATGTCAGGGAGTGGGGGGACCCAGCCATAAAGCAAGAATTTTGGCTGAAGCAATGAGCCAAGTAACAAATTCAGCCACTATAATGATGCAGAGAGGCAATTTTAGGAACCAAAGAAAGATTGTCAAGTGTTTCAATTGTGGCAAAGAAGGGCACATAGCCAAAAATTGCAGGGCCCCTAGGAAAAAGGGCTGTTGGAAATGTGGAAAGGAAGGACACCTAATGAAAGATTGTACTGAGAGACAGGCTAATTTTTTAGGGAAGATCTGGCCTTCCCACAAGGGAAGGCCAGGGAACTTTCTTCAGAGCAGACCAGAGCCAACAGCCCCACCAGAGGAGAGCTTCAGGTTTGGGGAAGAGACAACAACTCCATCTCAGAAGCAGGAGCCGATAGACAAGGAATATCCTCCTTTAGCTTCCCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGGTAGGAGGGCAATTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACATGAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACCCATAGAAATCTGCGGACACAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTAAAACTGTACCAGTAAAATTAAAACCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATCGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGGGAACTTAATAAAAGAACTCAAGACTTCTGGGAAGCTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCCGTAACAGTCCTGGATGTGGGTGATGCATATTTCTCAGTTCCTTTAGATAAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTGTAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAATGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAGCAAAAATAGAGGAACTGAGACAACATCTGTTGAGGTGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCTTGATAAATGGACAGTGCAGCCTATAATGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGAAAGTTGAATTGGGCAAGTCAGATTTATGCAGGGATTAAGGTAAAGGAATTATGTAAACTCCTTAGGGGAACCAAAGCACTAACAGAAGTAATACCACTAACAGAAGAAGCAGAGCTAGAACTGGCGGAAAACAGGGAAATTCTGAAAGAATCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAGCAGGGGCTAGGCCAATGGACATACCAAATTTATCAAGAGCCATATAAAAATCTGAAAACAGGAAAGTATGCAAGAATGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAGCCACAGAAAGCATAGTAATATGGGGGAAGACTCCTAAATTTAAACTACCCATACAAAAGGAAACATGGGAAGCATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTATCAATACCTCTCCCTTAGTGAAATTATGGTATCAGTTAGAGAAAGAACCCATAGAAGAAGCAGAAACTTTCTATGTAGATGGGGCAGCTAATAGGGAGACTAAATTAGGAAAAGCAGGATACGTTACTAACAAAGGAAGACAAAAAGTTGTCACCTTAACTGACACAACAAATCAGAAGACTGAGTTACAAGCAATTTATTTAGCTTTACAGGATTCAGGAGTAGAAGTAAACATAGTAACAGACTCACAATATGCATTAGGAATCATTCAAGCACAACCAGATAAGAGTGAATCAGAGTTAGTTAGTCAAATAATAGAGCAGTTAATAAAAAAGGAAAAAGTCTACCTGGCATGGGTGCCAGCACACAAAGGAATTGGAGGGAATGAACAAATAGATAAATTAGTCAGTGCTGGAATCAGGAAAGTACTATTTTTAGATGGAATAGATAAGGCCCAAGAAGAACATGAGAAATATCACTGTAACTGGAGAGCAATGGCTAGTGATTTTAACCTACCACCTGTAGTAGCAAAAGAAATAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGCCCAGGAATATGGCAATTAGATTGTACACATTTAGAAGGAAAAATTATCCTAGTAGCAGTTCATGTAGCCAGTGGATATATAGAAGCAGAAGTTATTCCAGCAGAGACAGGGCAGGAAACAGCATACTTTCTCCTAAAATTAGCAGGAAGATGGCCAGTGAAAACAATACATACAGACAATGGCAGAAATTTCACCAGTAATTCGGTTAAGGCCGCCTGTTGGTGGGCGGGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAGTCAAGGCGTAGTAGAATCTATGGATAAAGAATTAAAGAAAATTATAGGACAGGTAAGAGATCAAGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAGAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGGCAGCAGAGATCCACTTTGGAAAGGACCAGCAAAGCTCCTTTGGAAAGGTGAGGGGGCAGTAGTAATACAAGATAATAGTGACATAAAAGTAGTGCCAAGAAGAAAGGTAAAGATCATTAGGGACTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGATTAAAACATGGAAAAGTCTAGTAAAACACCATATGTATATTTCAAGGAAAGCTAAGGGATGGTTTTATAAACATCACTATGATAGCACTCATCCAAAAATAAGTTCGGAAGTACACATCCCACTAGGGGATGCTAGATTGGTAATAACAACATATTGGGGTCTGCATACAGGAGAAAGAGACTGGCATTTGGGCCAGGGAGTCTCCATAGAATGGAGGAAAAAGAGATATAGCACACAAGTAGACCCTGGCCTAGCAGACCAACTAATTCATCTGTATTATTTTGATTGTTTTTCAGAATCTGCTATAAGAAATGCCATTTTAGGACGTGTAGTTAGTCCTAGTTGTGATTATCAAGCAGGACATAACAAGGTAGGGTCTCTACAGTACTTGGCACTAACAGCATTAACAACACCAAAAAACAGAAAGCCACCTTTGCCTAGTGTTACGAAACTGACAGAGGATAGATGGAACAAGCCCCAGAGGACCAAGGGCCACAGAGGGAGCCATACAATGAGTGGACACTAGAGCTTTTAGAGGAGCTTAAGAGAGAAGCTGTTAGACATTTTCCTAGGATATGGCTCCATGGATTGGGACAACATATCTATGAAACATATGGGGATACTTGGGCAGGAGTGGAAGCCATAATAAGAACTCTGCAACAACTGCTGTTTATTCATTT*CAGAATTGGGTGTCAACAATGGAGCCAGTAGATCCTAGATTAGAGCCTTGGAAGCATCCAGGAAGTCAGCCTAAGACTGCTTGTAACAATTGCTATTGTAAAAAGTGCTGCCTTCATTGCCAAGTTTGTTTCATGAAAAAAGGCTTAGGCATCTTCTATGGCAGGAAGAAGCGAAGACAGCGACGAAGAGCTCCTCAAGACAGTCAGACTCATCAAGCTTCTCTATCAAAGCAACCCGCTTCCCAGCCCAGAGGGGACCCGGCAGGCCCGAAGGAAATGGCAGGAAGAAGCGAAGACAGCGACGAAGAGCTCCTCAAGACAGTCAGACTCATCAAGCTTCTCTATCAAAGCAATGCAAGCTTTAACCATTTTAGCAATAGTAGCCTTAGTAGTAGTAGCAATAATAGCAATAGTTGTGTGGACCATAGTACTCCTAGAATATAGGAAAATATTAAGACAGAGAAAAATAGACAGGTTAATTGATAGAATAAGAGAAAGAGCAGAAGACAGTGGCAATGAGAGTGACGGGGATCAGGAAGAATTATCAGCATTTGGGATGGAGATGGGGCACCATGCTCCTTGGGATGTTGATGATCTGTAATGCTGCAGAAAACTTGTGGGTCACAGTCTATTATGGGGTACCTGTATGGAAAGAAGCAACCACCACTCTATTTTGTGCATCAGATGCTAAAGCATATGATACAGAGGTACATAATGTTTGGGCCACACATGCTTGTGTACCCACAGACCCCAACCCACAAGAAGTAGTCTTGGGAAACGTGACAGAAAACTTTAACATGTGGAAAAATAACATGGTAGAACAGATGCATGAAGATATAATCAGTTTATGGGATCAAAGTCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTACTTTAAATTGCACTAATTTGAAG******AATGCTACTAATACCAGTAGT*********ATGGAGGGAGGA***GAAATAAAAAACTGCTCTTTCAATATCACCACAAGCATAAAAACTAAGGTGAAA***GACTATGCACTTTTTTATAAAGTTGATGTAGTACCAATAGGTAATGATAGTACCAGCTATAGGTTGATAAATTGTAACACCTCAGTCATTACACAAGCTTGTCCAAAGGTATCCTTTGAGCCAATTCCTATACATTATTGTACCCCGGCTGGTTTTGCGATTATAAAGTGTAACAATAAAAAGTTCAATGGAACAGGACCATGTACAAATGTCAGTACAGTACAATGTACACATGGAATTAGGCCAGTAGTATCAA
    Project HIV-1
    Submitted by Nobody; posted on Monday, May 05, 2003
    If you need distributed coputing for your project, then i sugest you make a short and easy to understand summary of your work. Including a download link for the software required. If not then why on earth was i linked here in the first place ;-).
    Project HIV-1 - Still alive?
    Submitted by Nobody; posted on Sunday, October 06, 2002
    Hello, I just came upon this project, and was wondering if anyone was still interested in doing this... I have a large array of hardware and programming skills that I would be willing to put to use in this project. dh003i - Let me know if you're still interested by posting to the thread. Thanks

     

    Copyright © 2016 · Scilico, LLC