Type: mRNA | GenBank: NM_001168 |
Description: Homo sapiens baculoviral IAP repeat-containing 5 (survivin)(BIRC5), mRNA |
Sequence (length:1619) |
Comments: |
anything about the target can be wrote here |
Antisense ID | Antisense Type | (Strand):Length:Position | Sequence Type | Sequence | Source
| Reference IDs |
AOs000001 | (-) : 20 : 39-58 | n/a | GGCACCCATGCCGCCGCCGC
| synthenticOligo
| ref000001 | |
AOs000002 | (-) : 20 : 97-116 | n/a | TGAATGTAGAGATGCGGTGG
| synthenticOligo
| ref000001 | |
AOs000003 | (-) : 20 : 232-251 | n/a | CCCAGCCTTCCAGCTCCTTG
| synthenticOligo
| ref000001 | |
AOs000004 | (-) : 20 : 861-880 | n/a | CTGTGACAGCCTCAACAACA
| synthenticOligo
| ref000001 | |
AOs000005 | (-) : 20 : 1501-1520 | n/a | GAGGGCGAATCAAATCCATC
| synthenticOligo
| ref000001 | |
AOs000006 | (-) : 20 : 329-348 | n/a | TCACCAAGGGTTAATTCTTC
| synthenticOligo
| ref000001 |
Series ID | sid000001 |
Assay Type | In Vitro |
RefIDs | ref000001 |
Transfection Method | Lipofectin |
Comments |
Antisense ID | Control IDs | Cell Line | Assay Level | Assay Method | Concentration | Efficacy | Reference ID |
AOs000001 | ctr000001 | A549 | mRNA | Real-Time PCR | 600nM | 0.50 | ref000001 |
AOs000002 | ctr000001 | A549 | mRNA | Real-Time PCR | 600nM | 0.20 | ref000001 |
AOs000003 | ctr000001 | A549 | mRNA | Real-Time PCR | 600nM | 0.70 | ref000001 |
AOs000004 | ctr000001 | A549 | mRNA | Real-Time PCR | 600nM | 0.30 | ref000001 |
AOs000005 | ctr000001 | A549 | mRNA | Real-Time PCR | 600nM | 0.45 | ref000001 |
AOs000006 | ctr000001 | A549 | mRNA | Real-Time PCR | 600nM | 0.18 | ref000001 |
Control ID | Control Type | Control Sequence | Assay Level | Assay Method | Control Concentration | Control Efficacy |
ctr000001 | NC | 3-base mismatch | mRNA | Real-Time PCR | 600nM | 0.00 |
Figure ID | Figure | Control IDs | Antisense IDs | Annotation |
fig000001 | fig1 | AOs000001 AOs000002 AOs000003 AOs000004 AOs000005 AOs000006 | ||
fig000002 | fig2 | AOs000001 AOs000002 AOs000003 AOs000004 AOs000005 AOs000006 |
Reference ID | PubMed ID | Author | Title | Journal | Book | Date | Volumn | Issue | Pages |
ref000001 | n/a | Olie RA, Simoes-Wust AP, Baumann B, Leech SH, Fabbro D, Stahel RA, Zangemeister-Wittke U | A novel antisense oligonucleotide targeting survivin expression induces apoptosis and sensitizes lung cancer cells to chemotherapy | Cancer Res. | n/a | 2000 Jun 1 | 60 | 11 | 2805-2809 |
--------------------------------------------------------------