Type: miRNA | miRNA Accession Number:MI0000077 |
Description: Homo sapiens miR-21 stemp-loop |
Sequence (length:72) |
Comments: |
"Mature sequence Accession:MIMAT0000076;ID:hsa-miR-21 Sequence(8-29) 5'-uagcuuaucagacugauguuga-3'" |
Antisense ID | Antisense Type | (Strand):Length:Position | Sequence Type | Sequence Hairpin Sequence | Source
| Reference IDs |
AOs000001 | (-) : 22 : 8-29 | DNA | TCAACATCAGTCTGATAAGCTA | synthenticOligo
| ref000001 | |
AOs000002 | (-) : 22 : 8-29 | DNA | TCAACATCAGTCTGATAAGCTA | synthenticOligo
| ref000001 | |
AOs000003 | (-) : 22 : 8-29 | DNA | TCAACATCAGTCTGATAAGCTA | synthenticOligo
| ref000001 | |
AOs000004 | (-) : 22 : 8-29 | DNA | TCAACATCAGTCTGATAAGCTA | synthenticOligo
| ref000001 | |
AOs000005 | (-) : 22 : 8-29 | DNA | TCAACATCAGTCTGATAAGCTA | synthenticOligo
| ref000001 | |
AOs000006 | (-) : 22 : 8-29 | DNA | TCAACATCAGTCTGATAAGCTA | synthenticOligo
| ref000001 | |
AOs000007 | (-) : 22 : 8-29 | DNA | TCAACATCAGTCTGATAAGCTA | synthenticOligo
| ref000001 | |
AOs000008 | (-) : 22 : 8-29 | DNA | TCAACATCAGTCTGATAAGCTA | synthenticOligo
| ref000001 | |
AOs000009 | (-) : 22 : 8-29 | DNA | TCAACATCAGTCTGATAAGCTA | synthenticOligo
| ref000001 | |
AOs000010 | (-) : 21 : 8-29 | RNA | ucaacacagucugauaagcua | synthenticOligo
| ref000002 |
Series ID | sid200634 | sid200533 |
Assay Type | InVitro | InVitro |
RefIDs | ref000001 | ref000002 |
Transfection Method | Lipofectin | lipofectamine 2000 |
Comments | dididd |
Antisense ID | Control IDs | Cell Line | Assay Level | Assay Method | Concentration | Efficacy | Reference ID |
AOs000001 | ctr000001 | Hela | miRNA | luciferase reporter assay | 33 nM | ++++ | ref000001 |
AOs000002 | ctr000001 | Hela | miRNA | luciferase reporter assay | 33 nM | +++ | ref000001 |
AOs000003 | ctr000001 | Hela | miRNA | luciferase reporter assay | 33 nM | +++ | ref000001 |
AOs000004 | ctr000001 | Hela | miRNA | luciferase reporter assay | 33 nM | + | ref000001 |
AOs000005 | ctr000001 | Hela | miRNA | luciferase reporter assay | 33 nM | + | ref000001 |
AOs000006 | ctr000001 | Hela | miRNA | luciferase reporter assay | 33 nM | + | ref000001 |
AOs000007 | ctr000001 | Hela | miRNA | luciferase reporter assay | 33 nM | + | ref000001 |
AOs000008 | ctr000001 | Hela | miRNA | luciferase reporter assay | 33 nM | - | ref000001 |
AOs000009 | ctr000001 | Hela | miRNA | luciferase reporter assay | 33 nM | - | ref000001 |
Control ID | Control Type | Control Sequence | Assay Level | Assay Method | Control Concentration | Control Efficacy |
ctr000001 | NC | Unrated sequence | miRNA | luciferase reporter assay | 33 nM |
Figure ID | Figure | Control IDs | Antisense IDs | Annotation |
n/a |
Antisense ID | Control IDs | Cell Line | Assay Level | Assay Method | Concentration | Efficacy | Reference ID |
AOs000010 | ctr000002 | Hela | miRNA | miRNA array | 10-30 pmol | +++ | ref000002 |
AOs000010 | ctr000002 | A549 | miRNA | miRNA array | 10-30 pmol | ++++ | ref000002 |
Control ID | Control Type | Control Sequence | Assay Level | Assay Method | Control Concentration | Control Efficacy |
ctr000002 | NC | guggauauuguugccauca | miRNA | miRNA array | 10-30 pmol |
Figure ID | Figure | Control IDs | Antisense IDs | Annotation |
n/a |
Reference ID | PubMed ID | Author | Title | Journal | Book | Date | Volumn | Issue | Pages |
ref000001 | n/a | Scott Davis, Bridget Lollo, Susan Freier and Christine Esau | "Improved targeting of miRNA with antisense oligonucleotides" | Nucleic Acids Research | n/a | 2006 | 34 | 8 | 2294-2304 |
ref000002 | n/a | Angie M. Cheng, Mike W. Byrom, Jeffrey Shelton and Lance P. Ford | Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis | Nucleic Acids Research | n/a | 2005 | 33 | 4 | 1290-1297 |
--------------------------------------------------------------