For each motif that it discovers in the training set, MEME prints the following information:
|
|
Multilevel TTATGTGAACGACGTCACACT consensus AA T A G A GA AA sequence T C TT TThis multilevel consensus sequence says several things about the motif. First, the most likely form of the motif can be read from the top line as TTATGTGAACGACGTCACACT. Second, that only letter A has probability more than 0.2 in position 3 of the motif, both T and A have probability greater than 0.2 in position 1, etc. Third, a rough approximation of the motif can be made by converting the multilevel consensus sequence into the Prosite signature
You can convert these blocks to PSSMs (position-specific scoring matrices), LOGOS (color representations of the motifs), phylogeny trees and search them against a database of other blocks by pasting everything from the "BL" line to the "//" line (inclusive) into the Multiple Alignment Processor. If you include the -print_fasta switch on the command line, MEME prints the motif sites in FASTA format instead of BLOCKS format.