[BiO BB] Unigene FormatDB error on Mac OS X
Tristan Fiedler
tfiedler at rsmas.miami.edu
Thu Sep 4 17:12:39 EDT 2003
Thanks all for the hardware tips!
I am currently setting up a blast run of marine sequences against Ciona
intestinalis from Unigene. A couple of bugs, which maybe someone has
overcome :
1. In the file which I downloaded 'File: Cin.seq.uniq.Z', the various
entries in this FASTA format file have headers such as :
>gnl|UG|Cin#S6667694 Ciona intestinalis cDNA, clone:cits020m24, full
insert sequence. /gb=AK117037 /gi=23589844 /ug=Cin.3 /len=12
14
ATCAGATTAAAACATCGTCCATCGTTAGAGTTTATAATTTACATGTTTGAAAAAGTTTAA
AATGCCTTCAAATAAACCAATTGTTAAGGATATCCCAAGAAAATGTGGCGTTCCTAGAGA
A
How can I get a more descriptive/functional definition of the various
unigene clusters?
2. I used the 'formatdb -i Cin.seq.uniq -p F -o T -n unigene_ciona'
command. Is this correct? In the formatdb logfile, how can the following
errors be corrected (if necessary) :
/Users/tfiedler/Desktop/blast.darwin/UNIGENE_DOWNLOAD% more formatdb.log
========================[ Sep 4, 2003 4:53 PM ]========================
Version 2.2.6 [Apr-09-2003]
Started database file "Cin.seq.uniq"
NOTE: CoreLib [002.003]
FileOpen("/Users/tfiedler/Library/Preferences/formatdb.cnf","r") failed
NOTE: CoreLib [002.003]
FileOpen("/Users/tfiedler/Desktop/blast.darwin/Resources/formatdb.cnf","r")
failed
NOTE: CoreLib [002.003] FileOpen(".formatdbrc","r") failed
NOTE: CoreLib [002.003] FileOpen("/Users/tfiedler/.formatdbrc","r") failed
NOTE: [000.000] No number of link bits used found in config file. Ignoring
NOTE: [000.000] No number of membership bits used found in config file.
Ignoring
Formatted 13699 sequences in volume 0
Thank you all very much for the assistance!!!
Cheers,
Tristan Fiedler
More information about the BBB
mailing list