From tomer.handelman at gmail.com  Sun Sep  2 06:41:34 2007
From: tomer.handelman at gmail.com (Tomer Handelman)
Date: Sun, 2 Sep 2007 13:41:34 +0300
Subject: [BiO BB] doing clustering based on similarity matrix
Message-ID: <c6cfea460709020341n1610d1c2h6226c0ed77697e3c@mail.gmail.com>

hello all,
I'm looking for a piece of software that will allow me to do clustering
based on a given similarity matrix and not on raw data from Micro arrays.
everything I found so far works only on raw data...

thanks in advance,
Tomer


From stefan.rensing at biologie.uni-freiburg.de  Sat Sep  1 08:00:40 2007
From: stefan.rensing at biologie.uni-freiburg.de (Stefan Rensing)
Date: Sat, 01 Sep 2007 14:00:40 +0200
Subject: [BiO BB] Aligning sequence from pdb to an established MSA
In-Reply-To: <61761.84.190.71.176.1188580019.squirrel@webmail.charite.de>
References: <20070829160145.EC527368498@primary.bioinformatics.org>	<002401c7eae0$40afb7a0$1a71e584@fwnc.net>	<2c8757af0708310931r751e863bj2b74acae20523b3a@mail.gmail.com>
	<61761.84.190.71.176.1188580019.squirrel@webmail.charite.de>
Message-ID: <46D95468.1040903@biologie.uni-freiburg.de>



> clustalw and Tcoffee are the two programs I knwow that
> can align a sequence to an alignment.
> But they just take the sequence and disregard 3D information.

ClustalW can make use of the structural information as present in a
swissprot format entry.


-- 
Dr. Stefan Rensing
Group Leader Computational Biology, Head Core Facility Data Management
Plant Biotechnology, Faculty of Biology, University of Freiburg
Schaenzlestr. 1, D-79104 Freiburg, Fon: +49 761 203-6974, Fax: -6945
http://www.plant-biotech.net/  http://www.cosmoss.org/
stefan.rensing at biologie.uni-freiburg.de

"You're analog players in a digital world."


From idoerg at gmail.com  Sun Sep  2 22:42:46 2007
From: idoerg at gmail.com (Iddo Friedberg)
Date: Sun, 2 Sep 2007 19:42:46 -0700
Subject: [BiO BB] doing clustering based on similarity matrix
In-Reply-To: <c6cfea460709020341n1610d1c2h6226c0ed77697e3c@mail.gmail.com>
References: <c6cfea460709020341n1610d1c2h6226c0ed77697e3c@mail.gmail.com>
Message-ID: <b5bbbc970709021942v7c508e3cj7b09f361f7c3652@mail.gmail.com>

Have you tried Michiel de Hoon's OS Cluster package?

http://bonsai.ims.u-tokyo.ac.jp/~mdehoon/software/cluster/index.html

Iddo

On 9/2/07, Tomer Handelman <tomer.handelman at gmail.com> wrote:
>
> hello all,
> I'm looking for a piece of software that will allow me to do clustering
> based on a given similarity matrix and not on raw data from Micro arrays.
> everything I found so far works only on raw data...
>
> thanks in advance,
> Tomer
> _______________________________________________
> General Forum at Bioinformatics.Org -
> BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>



-- 

I. Friedberg

"The only problem with troubleshooting is that
sometimes trouble shoots back."


From tomer.handelman at gmail.com  Mon Sep  3 04:12:32 2007
From: tomer.handelman at gmail.com (Tomer Handelman)
Date: Mon, 3 Sep 2007 11:12:32 +0300
Subject: [BiO BB] doing clustering based on similarity matrix
In-Reply-To: <b5bbbc970709021942v7c508e3cj7b09f361f7c3652@mail.gmail.com>
References: <c6cfea460709020341n1610d1c2h6226c0ed77697e3c@mail.gmail.com>
	<b5bbbc970709021942v7c508e3cj7b09f361f7c3652@mail.gmail.com>
Message-ID: <c6cfea460709030112o7a5bdccl529325c7872b6c06@mail.gmail.com>

I checked it out,
it recieves only raw data and creates the matrix by itself .
thanks anyway,
Tomer



2007/9/3, Iddo Friedberg <idoerg at gmail.com>:

> Have you tried Michiel de Hoon's OS Cluster package?
>
> http://bonsai.ims.u-tokyo.ac.jp/~mdehoon/software/cluster/index.html
>
> Iddo
>
> On 9/2/07, Tomer Handelman <tomer.handelman at gmail.com> wrote:
> >
> > hello all,
> > I'm looking for a piece of software that will allow me to do clustering
> > based on a given similarity matrix and not on raw data from Micro
> arrays.
> > everything I found so far works only on raw data...
> >
> > thanks in advance,
> > Tomer
> > _______________________________________________
> > General Forum at Bioinformatics.Org -
> > BiO_Bulletin_Board at bioinformatics.org
> > https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
> >
>
>
>
> --
>
> I. Friedberg
>
> "The only problem with troubleshooting is that
> sometimes trouble shoots back."
> _______________________________________________
> General Forum at Bioinformatics.Org -
> BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>


From marchywka at hotmail.com  Tue Sep  4 12:20:33 2007
From: marchywka at hotmail.com (Mike Marchywka)
Date: Tue, 04 Sep 2007 12:20:33 -0400
Subject: [BiO BB] doing clustering based on similarity matrix
In-Reply-To: <c6cfea460709030112o7a5bdccl529325c7872b6c06@mail.gmail.com>
Message-ID: <BAY108-F34C808EAAF0CCD09A5773FBECA0@phx.gbl>

I was going to post this earlier, essentially suggesting the same source
but also pointing out that the source code is available ( as a programmer,
that is my answer to everything, see comments below).

>From time to time, I end up reinventing a wheel ( for instance, after I
started moving clustalw to c++ the authors released their own c++ version 
and
I just wrote another xml parser... ). If you can post links to the existing 
art and an
input format, I may be able to adapt something I have and you can 
simultaneously
make your request more informative for everyone and avoid responses
regarding things you've already examined.

While I haven't looked lately, I was doing document clustering earlier and 
found many
packages available with source code ( you can adapt it as you like). Oddly 
enough,
I ended up using gene expression software to cluster documents as you
can make document properties look like expression amounts.

As I illustrated earlier, you can do proof of concept of novel clustering 
ideas in perl/bash scripts
with limited "real" code.

I think I used the treeview software related to this, as one example:

http://bonsai.ims.u-tokyo.ac.jp/~mdehoon/software/cluster/software.htm#ctv

"People that want to make use of the clustering algorithms in their own C, 
C++, or Fortran programs can download the source code of the C Clustering 
Library. "



Mike Marchywka
586 Saint James Walk
Marietta GA 30067-7165
404-788-1216 (C)<- leave message
989-348-4796 (P)<- emergency only
marchywka at hotmail.com
Note: Hotmail is blocking my mom's entire
ISP claiming it is to reduce spam but probably
to force users to use hotmail. Please DON'T
assume I am ignoring you and try
me on marchywka at yahoo.com if no reply
here. Thanks.





>From: "Tomer Handelman" <tomer.handelman at gmail.com>
>Reply-To: "General Forum at Bioinformatics.Org" 
><bio_bulletin_board at bioinformatics.org>
>To: "General Forum at Bioinformatics.Org" 
><bio_bulletin_board at bioinformatics.org>
>Subject: Re: [BiO BB] doing clustering based on similarity matrix
>Date: Mon, 3 Sep 2007 11:12:32 +0300
>
>I checked it out,
>it recieves only raw data and creates the matrix by itself .
>thanks anyway,
>Tomer
>
>
>
>2007/9/3, Iddo Friedberg <idoerg at gmail.com>:
>
> > Have you tried Michiel de Hoon's OS Cluster package?
> >
> > http://bonsai.ims.u-tokyo.ac.jp/~mdehoon/software/cluster/index.html
> >
> > Iddo
> >
> > On 9/2/07, Tomer Handelman <tomer.handelman at gmail.com> wrote:
> > >
> > > hello all,
> > > I'm looking for a piece of software that will allow me to do 
>clustering
> > > based on a given similarity matrix and not on raw data from Micro
> > arrays.
> > > everything I found so far works only on raw data...
> > >
> > > thanks in advance,
> > > Tomer
> > > _______________________________________________
> > > General Forum at Bioinformatics.Org -
> > > BiO_Bulletin_Board at bioinformatics.org
> > > https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
> > >
> >
> >
> >
> > --
> >
> > I. Friedberg
> >
> > "The only problem with troubleshooting is that
> > sometimes trouble shoots back."
> > _______________________________________________
> > General Forum at Bioinformatics.Org -
> > BiO_Bulletin_Board at bioinformatics.org
> > https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
> >
>_______________________________________________
>General Forum at Bioinformatics.Org - BiO_Bulletin_Board at bioinformatics.org
>https://bioinformatics.org/mailman/listinfo/bio_bulletin_board

_________________________________________________________________
Can you find the hidden words?? Take a break and play Seekadoo! 
http://club.live.com/seekadoo.aspx?icid=seek_hotmailtextlink1



From wangk at chgc.sh.cn  Tue Sep  4 03:37:58 2007
From: wangk at chgc.sh.cn (wangk)
Date: Tue, 4 Sep 2007 15:37:58 +0800
Subject: [BiO BB] Alternative splicing soft
In-Reply-To: <61761.84.190.71.176.1188580019.squirrel@webmail.charite.de>
Message-ID: <20070904073750.10CCD52843F@mail.chgc.sh.cn>

Dear all

    I had alignmented EST sequences against genome for alternative splicing
analysis with sim4, but I haven't known a soft for drawing the pictures of
alternative splicing result generated by sim4.

   Is there anyone can help? 

Kai Wang





From idh at poulet.org  Tue Sep  4 15:31:38 2007
From: idh at poulet.org (Yannick Wurm)
Date: Tue, 4 Sep 2007 21:31:38 +0200
Subject: [BiO BB] Re: doing clustering based on similarity matrix 
In-Reply-To: <20070904154211.73870368803@primary.bioinformatics.org>
References: <20070904154211.73870368803@primary.bioinformatics.org>
Message-ID: <F3378D71-14D4-4A65-A2D2-C6AAD75C8366@poulet.org>

Hi Tomer,
try TIGR's MEV.
http://www.tm4.org/mev.html

Cheers,
yannick

--------------------------------------------
           yannick . wurm @ unil . ch
Ant Genomics, Ecology & Evolution @ Lausanne
    http://www.unil.ch/dee/page28685_fr.html

On Sep 4, 2007, at 5:42 PM, bio_bulletin_board- 
request at bioinformatics.org wrote:

> hello all,
> I'm looking for a piece of software that will allow me to do  
> clustering
> based on a given similarity matrix and not on raw data from Micro  
> arrays.
> everything I found so far works only on raw data...
>
> thanks in advance,
> Tomer




From aloraine at gmail.com  Tue Sep  4 17:01:59 2007
From: aloraine at gmail.com (Ann Loraine)
Date: Tue, 4 Sep 2007 16:01:59 -0500
Subject: [BiO BB] Alternative splicing soft
In-Reply-To: <20070904073750.10CCD52843F@mail.chgc.sh.cn>
References: <61761.84.190.71.176.1188580019.squirrel@webmail.charite.de>
	<20070904073750.10CCD52843F@mail.chgc.sh.cn>
Message-ID: <83722dde0709041401jc062059x11cadee2cc8fe0b9@mail.gmail.com>

Hi,

Probably you would want to use a desktop genome browser.

If you write a sim4 format to bed or gffv3 converter, then you might be able
to use the Integrated Genome Browser to view the alignments.

See:

http://genoviz.sourceforge.net/

for details.

Also,

http://www.bioviz.org/plant_igb
http://www.bioviz.org

may be helpful...esp. the links describing data files & formats.

Another option would be to use Apollo. It may already have the ability to
load sim4 output.

Best,

Ann Loraine

On 9/4/07, wangk <wangk at chgc.sh.cn> wrote:
>
> Dear all
>
>     I had alignmented EST sequences against genome for alternative
> splicing
> analysis with sim4, but I haven't known a soft for drawing the pictures of
> alternative splicing result generated by sim4.
>
>    Is there anyone can help?
>
> Kai Wang
>
>
>
> _______________________________________________
> General Forum at Bioinformatics.Org -
> BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>


From wangk at chgc.sh.cn  Wed Sep  5 01:27:28 2007
From: wangk at chgc.sh.cn (wangk)
Date: Wed, 5 Sep 2007 13:27:28 +0800
Subject: =?gb2312?B?tPC4tDogW0JpTyBCQl0gQWx0ZXJuYXRpdmUgc3BsaWNpbmcgc29mdA==?=
In-Reply-To: <83722dde0709041401jc062059x11cadee2cc8fe0b9@mail.gmail.com>
Message-ID: <20070905052720.BED5952843F@mail.chgc.sh.cn>


    Thank you very much! I am trying to install Genome Browser on my
computer.


-----????-----
???: bio_bulletin_board-bounces+wangk=chgc.sh.cn at bioinformatics.org
[mailto:bio_bulletin_board-bounces+wangk=chgc.sh.cn at bioinformatics.org] ??
Ann Loraine
????: 2007?9?5? 5:02
???: General Forum at Bioinformatics.Org
??: Re: [BiO BB] Alternative splicing soft

Hi,

Probably you would want to use a desktop genome browser.

If you write a sim4 format to bed or gffv3 converter, then you might be able
to use the Integrated Genome Browser to view the alignments.

See:

http://genoviz.sourceforge.net/

for details.

Also,

http://www.bioviz.org/plant_igb
http://www.bioviz.org

may be helpful...esp. the links describing data files & formats.

Another option would be to use Apollo. It may already have the ability to
load sim4 output.

Best,

Ann Loraine

On 9/4/07, wangk <wangk at chgc.sh.cn> wrote:
>
> Dear all
>
>     I had alignmented EST sequences against genome for alternative
> splicing
> analysis with sim4, but I haven't known a soft for drawing the pictures of
> alternative splicing result generated by sim4.
>
>    Is there anyone can help?
>
> Kai Wang
>
>
>
> _______________________________________________
> General Forum at Bioinformatics.Org -
> BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>
_______________________________________________
General Forum at Bioinformatics.Org - BiO_Bulletin_Board at bioinformatics.org
https://bioinformatics.org/mailman/listinfo/bio_bulletin_board



From gopinath at cshl.edu  Tue Sep  4 19:14:29 2007
From: gopinath at cshl.edu (Gopinathrao, Gopal)
Date: Tue, 4 Sep 2007 19:14:29 -0400
Subject: [BiO BB] [Reactome-announce] Ver 22 released!
Message-ID: <BEF53CD2CD52C74990A1188012C2A5D0013D95@mailbox08.cshl.edu>


Version 22 of the Reactome Knowledgebase has been released and is accessible at   http://www.reactome.org! 

Reactome is a curated knowledgebase  developed and  maintained by the Reactome Knowledgebase team (Lincoln Stein's group at CSHL and Ewan Birney's group at  European Bioinformatics Institute). Reactome covers human biological processes ranging from basic pathways of metabolism to complex events such as hormonal signaling and apoptosis. The information in Reactome is provided by expert bench biologists, and edited and managed as a relational database by the Reactome staff. New material is peer-reviewed and revised as necessary before publication to the web. Reactome entries are linked to corresponding ones in NCBI, Entrez Gene, RefSeq, OMIM, Ensembl genome annotations, HapMap, UCSC Genome Browser, KEGG, ChEBI and Gene Ontology (GO). 

New topics released in Version 22 include  Botulinum neurotoxicity,  Membrane trafficking and  Metabolism of vitamins, pathways for HIV Nef protein interactions (HIV infection pathway),  Immunoregulatory interactions (Immune signaling pathway) and AMPK regulation of fatty acid oxidation (Integration of energy metabolism pathways). 

A new tool,  Reactome Mart, is available for comprehensive datamining. Reactome Wiki is available for editing documentation by the user community. As before, Reactome data can be exported in SMBL, Prot?g?, and BioPAX level 2 formats. 

Protein-protein interaction datasets derived from curated human and predicted non-human events are available. A SOAP based Web Services API is also available along with other resources to access the Reactome data. Links to these are on the Download page.

The standard display feature allows the user to choose the focus species annotations - curated (for human) and electronically inferred (for 22 other species).  Updated release statistics and the Editorial Calendar are available. 

Like everything in Reactome, these downloaded and exported materials can be reused and redistributed freely.  For questions and comments please reply to this message or write to help at reactome.org

_______________________________________________
Reactome-announce mailing list
Reactome-announce at reactome.org
http://mail.reactome.org/mailman/listinfo/reactome-announce


From dan.bolser at gmail.com  Wed Sep  5 02:19:48 2007
From: dan.bolser at gmail.com (Dan Bolser)
Date: Wed, 5 Sep 2007 08:19:48 +0200
Subject: [BiO BB] Re: doing clustering based on similarity matrix
In-Reply-To: <F3378D71-14D4-4A65-A2D2-C6AAD75C8366@poulet.org>
References: <20070904154211.73870368803@primary.bioinformatics.org>
	<F3378D71-14D4-4A65-A2D2-C6AAD75C8366@poulet.org>
Message-ID: <2c8757af0709042319x373f3c70lf26530c66ebe0c8c@mail.gmail.com>

For clustering from a given similarity matrix try 'R' and 'Bioconductor'.


On 04/09/07, Yannick Wurm <idh at poulet.org> wrote:
>
> Hi Tomer,
> try TIGR's MEV.
> http://www.tm4.org/mev.html
>
> Cheers,
> yannick
>
> --------------------------------------------
>            yannick . wurm @ unil . ch
> Ant Genomics, Ecology & Evolution @ Lausanne
>     http://www.unil.ch/dee/page28685_fr.html
>
> On Sep 4, 2007, at 5:42 PM, bio_bulletin_board-
> request at bioinformatics.org wrote:
>
> > hello all,
> > I'm looking for a piece of software that will allow me to do
> > clustering
> > based on a given similarity matrix and not on raw data from Micro
> > arrays.
> > everything I found so far works only on raw data...
> >
> > thanks in advance,
> > Tomer
>
>
> _______________________________________________
> General Forum at Bioinformatics.Org -
> BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>



-- 
hello


From akarger at CGR.Harvard.edu  Wed Sep  5 13:23:48 2007
From: akarger at CGR.Harvard.edu (Amir Karger)
Date: Wed, 5 Sep 2007 13:23:48 -0400
Subject: [BiO BB] Getting better assemblies from phrap
Message-ID: <B9182BFF5B004245BABC12956EA6322E05F09F00@huls5.nucleus.harvard.edu>

I've got a client who did a bunch of shotgun sequencing of a 100kb BAC
insert, and is now trying  to build an assembly with phredPhrap. He got
350 contigs. One was 12k, several were a few kb. We tried running with
-forcelevel 5, but that didn't help at all.

 

Are there other parameters that magically make phredPhrap work better?
I'm sure it depends on the quality of the reads. Many of them have at
least a region of good quality. There's a very long tail on a lot of
that, but the phred documentation says not to use the -trim option that
would remove those (and indeed phrap builds contigs even though the long
bad-quality tails don't match each other). Is there some way to tell
whether I have good enough quality? Is it not unusual to get just 12k,
and he'll just need to use primers suggested by consed to fill in gaps?

 

I'd appreciate any suggestions.

 

-Amir Karger

Research Computing Group

Life Sciences Division

Harvard University

akarger at cgr.harvard.edu



From marty.gollery at gmail.com  Wed Sep  5 17:19:39 2007
From: marty.gollery at gmail.com (Martin Gollery)
Date: Wed, 5 Sep 2007 14:19:39 -0700
Subject: [BiO BB] Getting better assemblies from phrap
In-Reply-To: <B9182BFF5B004245BABC12956EA6322E05F09F00@huls5.nucleus.harvard.edu>
References: <B9182BFF5B004245BABC12956EA6322E05F09F00@huls5.nucleus.harvard.edu>
Message-ID: <bdd10c2a0709051419g1cca03ffme954e3737574a067@mail.gmail.com>

Hi Amir,

You might investigate other basecalling software, such as KB,
PeakTrace and LongTrace.

Cheers,
Marty


On 9/5/07, Amir Karger <akarger at cgr.harvard.edu> wrote:
> I've got a client who did a bunch of shotgun sequencing of a 100kb BAC
> insert, and is now trying  to build an assembly with phredPhrap. He got
> 350 contigs. One was 12k, several were a few kb. We tried running with
> -forcelevel 5, but that didn't help at all.
>
>
>
> Are there other parameters that magically make phredPhrap work better?
> I'm sure it depends on the quality of the reads. Many of them have at
> least a region of good quality. There's a very long tail on a lot of
> that, but the phred documentation says not to use the -trim option that
> would remove those (and indeed phrap builds contigs even though the long
> bad-quality tails don't match each other). Is there some way to tell
> whether I have good enough quality? Is it not unusual to get just 12k,
> and he'll just need to use primers suggested by consed to fill in gaps?
>
>
>
> I'd appreciate any suggestions.
>
>
>
> -Amir Karger
>
> Research Computing Group
>
> Life Sciences Division
>
> Harvard University
>
> akarger at cgr.harvard.edu
>
> _______________________________________________
> General Forum at Bioinformatics.Org - BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>


-- 
-- 
Martin Gollery
Senior Bioinformatics Scientist
TimeLogic- a Division of Active Motif
775-833-9113
880 Northwood Blvd. Suite 7
Incline Village, NV 89451


From phoebe at deakin.edu.au  Thu Sep  6 05:49:42 2007
From: phoebe at deakin.edu.au (Phoebe Chen)
Date: Thu,  6 Sep 2007 19:49:42 +1000
Subject: [BiO BB] APBC2008 Call for Posters/Tutorials
Message-ID: <20070906194942.464jnk34nac4040o@mail.deakin.edu.au>

Dear Colleagues,

We apologize if you receive multiple copies of this
call for posters/tutorials.

Regards,
Organizing Committee of APBC2008
------------
CALL FOR POSTERS/TUTORIALS (APBC 2008)

The Sixth Asia Pacific Bioinformatics Conference
Kyoto, Japan, 14-17 January 2008
http://bic.kyoto-u.ac.jp/apbc2008/

Please consider to submit a poster or hold a tutorial
in the conference.
The deadline for Tutorial submission is 14 Sept, 2007.
The deadline for Posters submission is 30 Sept, 2007.

The details of the call for posters and call
for tutorials can be found here:
http://sunflower.kuicr.kyoto-u.ac.jp/apbc2008/cfposter.html
http://sunflower.kuicr.kyoto-u.ac.jp/apbc2008/cftutorial.html

We look forward to seeing you in Kyoto, Japan, an
exciting place to explore.

Organizing Committee of APBC2008




From sariego9 at yahoo.com  Wed Sep  5 17:05:41 2007
From: sariego9 at yahoo.com (Diego Martinez)
Date: Wed, 5 Sep 2007 14:05:41 -0700 (PDT)
Subject: [BiO BB] Getting better assemblies from phrap
Message-ID: <116556.50556.qm@web32509.mail.mud.yahoo.com>

Hello Amir,

what level coverage X is that at?

Diego
 
+                          +
      A----T  
   T--------A   
  G---------C
  C-------G  
   G----G   
      KiddoMics.CoM
    T--A
   G-----C    
  A--------T  
  A---------T
   T--------A 
     T-----A  
+                                      +

----- Original Message ----
From: Amir Karger <akarger at CGR.Harvard.edu>
To: bio_bulletin_board at bioinformatics.org
Sent: Wednesday, September 5, 2007 11:23:48 AM
Subject: [BiO BB] Getting better assemblies from phrap

I've got a client who did a bunch of shotgun sequencing of a 100kb BAC
insert, and is now trying  to build an assembly with phredPhrap. He got
350 contigs. One was 12k, several were a few kb. We tried running with
-forcelevel 5, but that didn't help at all.

 

Are there other parameters that magically make phredPhrap work better?
I'm sure it depends on the quality of the reads. Many of them have at
least a region of good quality. There's a very long tail on a lot of
that, but the phred documentation says not to use the -trim option that
would remove those (and indeed phrap builds contigs even though the long
bad-quality tails don't match each other). Is there some way to tell
whether I have good enough quality? Is it not unusual to get just 12k,
and he'll just need to use primers suggested by consed to fill in gaps?

 

I'd appreciate any suggestions.

 

-Amir Karger

Research Computing Group

Life Sciences Division

Harvard University

akarger at cgr.harvard.edu

_______________________________________________
General Forum at Bioinformatics.Org - BiO_Bulletin_Board at bioinformatics.org
https://bioinformatics.org/mailman/listinfo/bio_bulletin_board





       
____________________________________________________________________________________
Choose the right car based on your needs.  Check out Yahoo! Autos new Car Finder tool.
http://autos.yahoo.com/carfinder/


From skhadar at gmail.com  Fri Sep  7 09:44:56 2007
From: skhadar at gmail.com (Shameer Khadar)
Date: Fri, 7 Sep 2007 19:14:56 +0530
Subject: [BiO BB] Aligning sequence from pdb to an established MSA
In-Reply-To: <46D95468.1040903@biologie.uni-freiburg.de>
References: <20070829160145.EC527368498@primary.bioinformatics.org>
	<002401c7eae0$40afb7a0$1a71e584@fwnc.net>
	<2c8757af0708310931r751e863bj2b74acae20523b3a@mail.gmail.com>
	<61761.84.190.71.176.1188580019.squirrel@webmail.charite.de>
	<46D95468.1040903@biologie.uni-freiburg.de>
Message-ID: <b6ff81950709070644r21188e49yea702f22640af7b0@mail.gmail.com>

Please Try UCSF Chimera


From lichunjiang at sibs.ac.cn  Mon Sep 10 05:06:27 2007
From: lichunjiang at sibs.ac.cn (lichunjiang)
Date: Mon, 10 Sep 2007 17:06:27 +0800 (CST)
Subject: [BiO BB] ortholog
Message-ID: <3095.10.10.119.223.1189415187.squirrel@webmail.sibs.ac.cn>



Dear all,
I'm trying to find out thousands of genes' ortholog from
ENSEMBL. Seems hard to get a clear and direct way to achive it. Any
suggestion is invited( or you can suggest a better database for orthologs
)!
Cheers!
Lichun 


-- 
lichunjiang at sibs.ac.cn
Institute of Biochemistry and Cell
Biology,
Shanghai Institutes for Biological Sciences,
Chinese
Academy of Sciences


From daniel_ha at rosettagenomics.com  Mon Sep 10 06:56:57 2007
From: daniel_ha at rosettagenomics.com (Daniel Harari)
Date: Mon, 10 Sep 2007 13:56:57 +0300
Subject: [BiO BB] ortholog
In-Reply-To: <3095.10.10.119.223.1189415187.squirrel@webmail.sibs.ac.cn>
Message-ID: <99CB84B9C0EE844C97963D33872290CA77E118@mail.rosettagenomics.com>

Lichun, 

Should you be interested in alternatives to Ensembl, you might want to
try NCBI's homologene:
http://www.ncbi.nlm.nih.gov/sites/entrez?db=homologene


An alternative is inparanoid:
http://inparanoid.sbc.su.se/cgi-bin/index.cgi


Regards,
 
Daniel
 


-----Original Message-----
From:
bio_bulletin_board-bounces+daniel_ha=rosettagenomics.com at bioinformatics.
org
[mailto:bio_bulletin_board-bounces+daniel_ha=rosettagenomics.com at bioinfo
rmatics.org] On Behalf Of lichunjiang
Sent: Monday, September 10, 2007 12:06 PM
To: bio_bulletin_board at bioinformatics.org
Subject: [BiO BB] ortholog



Dear all,
I'm trying to find out thousands of genes' ortholog from
ENSEMBL. Seems hard to get a clear and direct way to achive it. Any
suggestion is invited( or you can suggest a better database for
orthologs
)!
Cheers!
Lichun 


-- 
lichunjiang at sibs.ac.cn
Institute of Biochemistry and Cell
Biology,
Shanghai Institutes for Biological Sciences,
Chinese
Academy of Sciences
_______________________________________________
General Forum at Bioinformatics.Org -
BiO_Bulletin_Board at bioinformatics.org
https://bioinformatics.org/mailman/listinfo/bio_bulletin_board


From Sudhindra.Gadagkar at notes.udayton.edu  Mon Sep 10 11:33:10 2007
From: Sudhindra.Gadagkar at notes.udayton.edu (Sudhindra.Gadagkar at notes.udayton.edu)
Date: Mon, 10 Sep 2007 11:33:10 -0400
Subject: [BiO BB] ortholog
In-Reply-To: <3095.10.10.119.223.1189415187.squirrel@webmail.sibs.ac.cn>
Message-ID: <OF1993E684.DD973AA6-ON85257352.00553812-85257352.00556E95@notes.udayton.edu>

Hi Lichun,

I have found Inparanoid (http://inparanoid.cgb.ki.se/ehelp.html) to be a 
good resource for getting eukaryote orthologs. 

Sudhindra Gadagkar

----------------------------------------------------------------------------
Sudhindra R. Gadagkar, Ph.D.
Department of Biology
University of Dayton
300 College Park
Dayton, OH 45469-2320

Ph: (937) 229-2410
Fax: (937) 229-2021
Email: gadagkar at notes.udayton.edu
----------------------------------------------------------------------------




"lichunjiang" <lichunjiang at sibs.ac.cn> 
Sent by: 
bio_bulletin_board-bounces+sudhindra.gadagkar=notes.udayton.edu at bioinformatics.org
09/10/2007 05:06 AM
Please respond to
"General Forum at Bioinformatics.Org" 
<bio_bulletin_board at bioinformatics.org>


To
bio_bulletin_board at bioinformatics.org
cc

Subject
[BiO BB] ortholog








Dear all,
I'm trying to find out thousands of genes' ortholog from
ENSEMBL. Seems hard to get a clear and direct way to achive it. Any
suggestion is invited( or you can suggest a better database for orthologs
)!
Cheers!
Lichun 


-- 
lichunjiang at sibs.ac.cn
Institute of Biochemistry and Cell
Biology,
Shanghai Institutes for Biological Sciences,
Chinese
Academy of Sciences
_______________________________________________
General Forum at Bioinformatics.Org - 
BiO_Bulletin_Board at bioinformatics.org
https://bioinformatics.org/mailman/listinfo/bio_bulletin_board



From skhadar at gmail.com  Wed Sep 12 12:33:32 2007
From: skhadar at gmail.com (Shameer Khadar)
Date: Wed, 12 Sep 2007 22:03:32 +0530
Subject: [BiO BB] How to download Protein complexes from PDB ?
Message-ID: <b6ff81950709120933pb906e5bh60b0e55146611f32@mail.gmail.com>

This is a simple yet a tricky issue : :)
I need to download a set of 200 complexes from PDB (they can include
dimers, trimers and tetramers). But they should only contain
proteins(no
DNA/RNA along with the protein). Is it possible get such 200
structures from PDB through web search. If yes, what search
keyword/strategy should I
use ? Or is there any other way to  get it done using SRS/BioMart ?

SK


From marchywka at hotmail.com  Wed Sep 12 13:33:06 2007
From: marchywka at hotmail.com (Mike Marchywka)
Date: Wed, 12 Sep 2007 13:33:06 -0400
Subject: [BiO BB] How to download Protein complexes from PDB ?
In-Reply-To: <b6ff81950709120933pb906e5bh60b0e55146611f32@mail.gmail.com>
Message-ID: <BAY108-F22F82BE25E770E78104224BEC20@phx.gbl>

>I need to download a set of 200 complexes from PDB (they can include
>dimers, trimers and tetramers). But they should only contain


I'm not entirely sure what you mean but I do know I've had to guess a lot
with the ncbi structure database. To test my molecule viewer, I had to write 
several
new scripts like this:

142  pdbget -out xxx -structure "gaba complex"
143  cat xxx
144  pdbget -get 29354 1sff.pdb

I've got another script that the above calls:

$ eutilsnew -v -out asdf -structure  -report docsum  -retmode text 
cytochrome

$ more asdf

1: 2HL7
Crystal Structure Of The Periplasmic Domain Of Ccmh From Pseudomonas 
Aeruginosa
[mmdbId:47389]
2: 2Z3U
Crystal Structure Of Chromopyrrolic Acid Bound Cytochrome P450 Stap 
(Cyp245a1)
[mmdbId:47341]
3: 2Z3T
Crystal Structure Of Substrate Free Cytochrome P450 Stap (Cyp245a1)
[mmdbId:47340]
4: 2V0M
Crystal Structure Of Human P450 3a4 In Complex With Ketoconazole
[mmdbId:47321]
5: 2NZA


I can't find a spec that say, "return all the matching pdb's", I just get a 
list of id's
and have to go get the ones I want. Still easy to automate however.

Search criteria are here:

http://eutils.ncbi.nlm.nih.gov/entrez/eutils/einfo.fcgi?db=structure

I generally take the "download everything close  and sort it out locally
approach" using custom scripts for one-off searches.

If anyone knows the codes to download all the pdb's at once can you please 
post.
Thanks.

_________________________________________________________________
Test your celebrity IQ.? Play Red Carpet Reveal and earn great prizes! 
http://club.live.com/red_carpet_reveal.aspx?icid=redcarpet_hotmailtextlink2



From marchywka at hotmail.com  Wed Sep 12 15:49:14 2007
From: marchywka at hotmail.com (Mike Marchywka)
Date: Wed, 12 Sep 2007 15:49:14 -0400
Subject: [BiO BB] ortholog
In-Reply-To: <OF1993E684.DD973AA6-ON85257352.00553812-85257352.00556E95@notes.udayton.edu>
Message-ID: <BAY108-F37C3998ABC360ADEDD4F0CBEC20@phx.gbl>


>I'm trying to find out thousands of genes' ortholog from
>ENSEMBL. Seems hard to get a clear and direct way to achive it. Any
>suggestion is invited( or you can suggest a better database for orthologs
>)!
>

I'm not sure if these are competitive yet with the web based tools but I'm 
developing
a bunch of scripts for automated search and analysis. If anyone cares to 
comment
on strengths or limitations of existing tools it may help me fill some voids 
( make these things
useful to others).
Essentially everything uses
the NCBI eutils facilities supplemented with some local databases or rules. 
For example,
I have a bunch of scripts to find a contig in the dog genome and put it into
something called ex_fasta. Then, I bury a bunch of blast searches and text 
formatiing
into a one-liner( the option names are a bit odd because I make them up out 
of
prior combinations as needed in a task-specific way ):

$progpath/findhomologues -de_novo_stuff ex_fasta

The above also creates a bmp file with a bunch of annotations and clustalw 
alignments between blast hits to various databases including some local 
repeat and probe collections.
Right now, I'm adding  a rule-based alignment and annotation system. I've 
got a collection of
Perl REGEX patterns in an XML file along with biblio info ( where it came 
from, etc) that
I can parse into something simple:
./yaxml -parse rule_source.xml -rules > algn_rules

$ cat algn_rules
ATG >rule|1|DNA Start Codon
(?<=TATA.*)(GT.*?AT)(?=.*ATAAA) >rule|4|DNA Composite Introns
ATG(...)*?(TAG|TAA|TGA) >rule|5|DNA Euk ORF
MGSGSSS >rule|9|PEPTIDE N-myristoylation pattern
[CA](AG|GTA|GTG)AGT >rule|10|DNA? splice donor
[CT]+[A-Z][CT]A{0,1}G >rule|11|DNA? splice acceptor
N[^P][ST][^P] >rule|14|PEPTIDE Glycosylation site
[ST].N. >rule|15|PEPTIDE Glycosylation site
Y..[LI].{6,8}Y..[LI] >rule|16|PEPTIDE ITAM,Fc cytoplasmic tail

And use for alignment cues:

$progpath/rules_annotater -clean -which 1 -fastas o2_fasta -rules 
$progpath/align_rules > r3nunu2

That then output in text or graphical bmp files either alignments of just 
stats:


$ $progpath/mm_align_tool -fastas o2_fasta -rules r3nunu -rules r3nunu2 
-use_rule 4 -stats -align -output notes
For Rules set 0:>ref|NW_876253.1|Cfa11_WGA39_2:47189155-47195387 Canis 
familiar
is chromosome 11 genomic contig, whole genome shotgun sequence
388        >rule|2|DNA Stop Codon
344        >rule|11|DNA? splice acceptor
189        >rule|4|DNA Composite Introns
128        >rule|1|DNA Start Codon
58         >rule|5|DNA Euk ORF
34         >rule|6|DNA Euk spliced ORF
15         >rule|12|DNA? polyadenlyation signal
6          >rule|3|DNA TATA box
3          >rule|10|DNA? splice donor
For Rules set 1:>gb|AACN010493556.1|:1-1146 Canis familiaris 
ctg19866850213054,
whole genome shotgun sequence
72         >rule|11|DNA? splice acceptor
60         >rule|2|DNA Stop Codon
24         >rule|1|DNA Start Codon
21         >rule|4|DNA Composite Introns
6          >rule|5|DNA Euk ORF
5          >rule|6|DNA Euk spliced ORF
1          >rule|10|DNA? splice donor
1          >rule|12|DNA? polyadenlyation signal
1          >rule|3|DNA TATA box


I'm still debugging this but initial alignment with rules was about what I 
expected, now I'm working
on automating the analysis and interpretation. I've also got a bunch of test 
scripts that, for example, grab two random and distinct pieces of dog or 
human genome and try to align or otherwise "match" them- handy for control 
and finding sequences that occur a lot.

_________________________________________________________________
Can you find the hidden words?? Take a break and play Seekadoo! 
http://club.live.com/seekadoo.aspx?icid=seek_hotmailtextlink1



From dan.bolser at gmail.com  Thu Sep 13 01:21:47 2007
From: dan.bolser at gmail.com (Dan Bolser)
Date: Thu, 13 Sep 2007 07:21:47 +0200
Subject: [BiO BB] How to download Protein complexes from PDB ?
In-Reply-To: <b6ff81950709120933pb906e5bh60b0e55146611f32@mail.gmail.com>
References: <b6ff81950709120933pb906e5bh60b0e55146611f32@mail.gmail.com>
Message-ID: <2c8757af0709122221p120e4936pc14a2436f41500d3@mail.gmail.com>

On 12/09/2007, Shameer Khadar <skhadar at gmail.com> wrote:
> This is a simple yet a tricky issue : :)
> I need to download a set of 200 complexes from PDB (they can include
> dimers, trimers and tetramers). But they should only contain
> proteins(no
> DNA/RNA along with the protein). Is it possible get such 200
> structures from PDB through web search. If yes, what search
> keyword/strategy should I
> use ? Or is there any other way to  get it done using SRS/BioMart ?

The best place to ask this question is on the pdb-l mailing list.

I have a list of ~300 protein complexes that I use in my studies that
I can put somewhere if you like... they are not DNA / RNA / Ligand
free, but they contain less than 5% of these types of atoms by
molecular weight.


Dan.


>
> SK
> _______________________________________________
> General Forum at Bioinformatics.Org - BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>


-- 
hello


From skhadar at gmail.com  Thu Sep 13 07:34:03 2007
From: skhadar at gmail.com (Shameer Khadar)
Date: Thu, 13 Sep 2007 17:04:03 +0530
Subject: [BiO BB] How to download Protein complexes from PDB ?
In-Reply-To: <2c8757af0709122221p120e4936pc14a2436f41500d3@mail.gmail.com>
References: <b6ff81950709120933pb906e5bh60b0e55146611f32@mail.gmail.com>
	<2c8757af0709122221p120e4936pc14a2436f41500d3@mail.gmail.com>
Message-ID: <b6ff81950709130434y6ddd8585jade48a791b610d2f@mail.gmail.com>

Dear Dan,

Thanks for your reply. I am interested to have a look at your data. It will
be great if you can upload it as a single .tar.gz / zip file, so that i can
download it.

Once again thanks for the reply

On 9/13/07, Dan Bolser <dan.bolser at gmail.com> wrote:
>
> On 12/09/2007, Shameer Khadar <skhadar at gmail.com> wrote:
> > This is a simple yet a tricky issue : :)
> > I need to download a set of 200 complexes from PDB (they can include
> > dimers, trimers and tetramers). But they should only contain
> > proteins(no
> > DNA/RNA along with the protein). Is it possible get such 200
> > structures from PDB through web search. If yes, what search
> > keyword/strategy should I
> > use ? Or is there any other way to  get it done using SRS/BioMart ?
>
> The best place to ask this question is on the pdb-l mailing list.
>
> I have a list of ~300 protein complexes that I use in my studies that
> I can put somewhere if you like... they are not DNA / RNA / Ligand
> free, but they contain less than 5% of these types of atoms by
> molecular weight.
>
>
> Dan.
>
>
> >
> > SK
> > _______________________________________________
> > General Forum at Bioinformatics.Org -
> BiO_Bulletin_Board at bioinformatics.org
> > https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
> >
>
>
> --
> hello
> _______________________________________________
> General Forum at Bioinformatics.Org -
> BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>


From skhadar at gmail.com  Thu Sep 13 07:38:37 2007
From: skhadar at gmail.com (Shameer Khadar)
Date: Thu, 13 Sep 2007 17:08:37 +0530
Subject: [BiO BB] How to download Protein complexes from PDB ?
In-Reply-To: <BAY108-F22F82BE25E770E78104224BEC20@phx.gbl>
References: <b6ff81950709120933pb906e5bh60b0e55146611f32@mail.gmail.com>
	<BAY108-F22F82BE25E770E78104224BEC20@phx.gbl>
Message-ID: <b6ff81950709130438x6b1a60eekeb21366d383aa6d0@mail.gmail.com>

Dear Mike,
Thanks for your reply.


> I'm not entirely sure what you mean but I do know I've had to guess a lot
> with the ncbi structure database. To test my molecule viewer, I had to
> write
> several new scripts like this:
>
> 142  pdbget -out xxx -structure "gaba complex"
> 143  cat xxx
> 144  pdbget -get 29354 1sff.pdb
>
> I've got another script that the above calls:
>
> $ eutilsnew -v -out asdf -structure  -report docsum  -retmode text
> cytochrome
>
> $ more asdf
>
> 1: 2HL7
> Crystal Structure Of The Periplasmic Domain Of Ccmh From Pseudomonas
> Aeruginosa
> [mmdbId:47389]
> 2: 2Z3U
> Crystal Structure Of Chromopyrrolic Acid Bound Cytochrome P450 Stap
> (Cyp245a1)
> [mmdbId:47341]
> 3: 2Z3T
> Crystal Structure Of Substrate Free Cytochrome P450 Stap (Cyp245a1)
> [mmdbId:47340]
> 4: 2V0M
> Crystal Structure Of Human P450 3a4 In Complex With Ketoconazole
> [mmdbId:47321]
> 5: 2NZA
>
>
> I can't find a spec that say, "return all the matching pdb's", I just get
> a
> list of id's
> and have to go get the ones I want. Still easy to automate however.
>
> Search criteria are here:
>
> http://eutils.ncbi.nlm.nih.gov/entrez/eutils/einfo.fcgi?db=structure
>
> I generally take the "download everything close  and sort it out locally
> approach" using custom scripts for one-off searches.
>
> If anyone knows the codes to download all the pdb's at once can you please
> post.


You can download whole PDB from RCSB. Goto
http://www.rcsb.org/pdb/home/home.do
Click on Download, you can go with FTP download to download the full pdb.
seperate dirs are avaialable. you can write a wget based script to get the
full download.
--
Shameer


From lichunjiang at sibs.ac.cn  Thu Sep 13 07:57:10 2007
From: lichunjiang at sibs.ac.cn (lichunjiang)
Date: Thu, 13 Sep 2007 19:57:10 +0800
Subject: [BiO BB] ortholog
References: <3095.10.10.119.223.1189415187.squirrel@webmail.sibs.ac.cn>
Message-ID: <200709131957107508498@sibs.ac.cn>


Thanks for your suggestions.I will follow your then and find my way out! It's great for 
Mike to share your script one day!

Best regards!
Lichun




>Dear all,
>I'm trying to find out thousands of genes' ortholog from
>ENSEMBL. Seems hard to get a clear and direct way to achive it. Any
>suggestion is invited( or you can suggest a better database for orthologs
>)!
>Cheers!
>Lichun 
>
>
>-- 
>lichunjiang at sibs.ac.cn
>Institute of Biochemistry and Cell
>Biology,
>Shanghai Institutes for Biological Sciences,
>Chinese
>Academy of Sciences
>_______________________________________________
>General Forum at Bioinformatics.Org - BiO_Bulletin_Board at bioinformatics.org
>https://bioinformatics.org/mailman/listinfo/bio_bulletin_board

= = = = = = = = = = = = = = = = = = = =
			

??????????????????
????
 
				 
????????????????lichunjiang
????????????????lichunjiang at sibs.ac.cn
????????????????????2007-09-13





From marchywka at hotmail.com  Thu Sep 13 08:26:42 2007
From: marchywka at hotmail.com (Mike Marchywka)
Date: Thu, 13 Sep 2007 08:26:42 -0400
Subject: [BiO BB] How to download Protein complexes from PDB ?
In-Reply-To: <b6ff81950709130438x6b1a60eekeb21366d383aa6d0@mail.gmail.com>
Message-ID: <BAY108-F25AC9FF8690AEC6AD5BB5EBEC30@phx.gbl>


>
>You can download whole PDB from RCSB. Goto
>http://www.rcsb.org/pdb/home/home.do
>Click on Download, you can go with FTP download to download the full pdb.
>seperate dirs are avaialable. you can write a wget based script to get the
>full download.
>--

Thanks but that is essentially what I have now using the NCBI tools but I 
don't think
they have a search API. All I was after was a way to avoid returning the 
list of hits
or having to reformat it for serial file transfer requests. The other eutils 
databases
usually have some option that just returns all the results with just
one request ( I think it is efectch but I'd have to look).

_________________________________________________________________
Can you find the hidden words?? Take a break and play Seekadoo! 
http://club.live.com/seekadoo.aspx?icid=seek_hotmailtextlink1



From skhadar at gmail.com  Thu Sep 13 09:50:07 2007
From: skhadar at gmail.com (Shameer Khadar)
Date: Thu, 13 Sep 2007 19:20:07 +0530
Subject: [BiO BB] How to download Protein complexes from PDB ?
In-Reply-To: <BAY108-F25AC9FF8690AEC6AD5BB5EBEC30@phx.gbl>
References: <b6ff81950709130438x6b1a60eekeb21366d383aa6d0@mail.gmail.com>
	<BAY108-F25AC9FF8690AEC6AD5BB5EBEC30@phx.gbl>
Message-ID: <b6ff81950709130650l31a70beej1f5894dadc0b2664@mail.gmail.com>

Dear Mike

I havent use efetch before. Anyway I will look in to that.

Separately RCSB is providing WebServices and its clients in Java and Perl, I
think here you will get a programmatic access to the database. But due to
some strange security reasons my sysadmin people are not allowing me to
access the webservices.


http://www.rcsb.org/robohelp/site_navigation/reengeneered_site_features.htm#Web%20Services
http://www.rcsb.org/robohelp/webservices/summary.htm -> Exact URL
I hope this will help.
-- 


On 9/13/07, Mike Marchywka <marchywka at hotmail.com> wrote:
>
>
> >
> >You can download whole PDB from RCSB. Goto
> >http://www.rcsb.org/pdb/home/home.do
> >Click on Download, you can go with FTP download to download the full pdb.
> >seperate dirs are avaialable. you can write a wget based script to get
> the
> >full download.
> >--
>
> Thanks but that is essentially what I have now using the NCBI tools but I
> don't think
> they have a search API. All I was after was a way to avoid returning the
> list of hits
> or having to reformat it for serial file transfer requests. The other
> eutils
> databases
> usually have some option that just returns all the results with just
> one request ( I think it is efectch but I'd have to look).
>
> _________________________________________________________________
> Can you find the hidden words? Take a break and play Seekadoo!
> http://club.live.com/seekadoo.aspx?icid=seek_hotmailtextlink1
>
> _______________________________________________
> General Forum at Bioinformatics.Org -
> BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>


From tcan at ceng.metu.edu.tr  Wed Sep 12 13:13:24 2007
From: tcan at ceng.metu.edu.tr (tcan at ceng.metu.edu.tr)
Date: Wed, 12 Sep 2007 20:13:24 +0300 (EEST)
Subject: [BiO BB] How to download Protein complexes from PDB ?
In-Reply-To: <b6ff81950709120933pb906e5bh60b0e55146611f32@mail.gmail.com>
References: <b6ff81950709120933pb906e5bh60b0e55146611f32@mail.gmail.com>
Message-ID: <2645.144.122.42.57.1189617204.squirrel@webmail.ceng.metu.edu.tr>


You may use the "Advanced Search" utility of PDB to get the complexes you
need.

1) Click on the Advanced Search link at the top of the PDB web page at
www.rcsb.org/pdb

2) Click on the "Choose a query type" pull-down option menu and choose
"Number of Chains" under "Sequence Features". Specify chain length as:
between 2 and 4

3) Click on the "plus" button on the right to add another sub query

4) Click on the second "Choose a query type" pull-down option menu and
choose "Molecule/Chain Type" under "Structure Summary". Specify "Contains
Protein: Yes", "Contains DNA: No", and "Contains RNA: No".

5) If you want to remove redundant sequences check the "remove similar
sequences at 90% identity" check-box.

6) Click on the "Evaluate Query" button to get the structures you are
looking for.

There are about 6K of such complexes. Good luck.

Tolga Can

> This is a simple yet a tricky issue : :)
> I need to download a set of 200 complexes from PDB (they can include
> dimers, trimers and tetramers). But they should only contain
> proteins(no
> DNA/RNA along with the protein). Is it possible get such 200
> structures from PDB through web search. If yes, what search
> keyword/strategy should I
> use ? Or is there any other way to  get it done using SRS/BioMart ?
>
> SK
> _______________________________________________
> General Forum at Bioinformatics.Org -
> BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>




From me.lixue at gmail.com  Wed Sep 12 17:17:56 2007
From: me.lixue at gmail.com (Xue Li)
Date: Wed, 12 Sep 2007 16:17:56 -0500
Subject: [BiO BB] doing clustering based on similarity matrix
In-Reply-To: <c6cfea460709020341n1610d1c2h6226c0ed77697e3c@mail.gmail.com>
References: <c6cfea460709020341n1610d1c2h6226c0ed77697e3c@mail.gmail.com>
Message-ID: <62ed16460709121417m4646642wd1f18209bee70995@mail.gmail.com>

You could use MATLAB software package to do clustering on a given similarity
matrix.

Li

On 9/2/07, Tomer Handelman <tomer.handelman at gmail.com> wrote:
>
> hello all,
> I'm looking for a piece of software that will allow me to do clustering
> based on a given similarity matrix and not on raw data from Micro arrays.
> everything I found so far works only on raw data...
>
> thanks in advance,
> Tomer
> _______________________________________________
> General Forum at Bioinformatics.Org -
> BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>



-- 
Xue, Li
Bioinformatics and Computational Biology program @ ISU
Ames, IA 50010
515-450-7183


From narcis at fiserlab.org  Wed Sep 12 13:44:18 2007
From: narcis at fiserlab.org (Narcis Fernandez-Fuentes)
Date: Wed, 12 Sep 2007 13:44:18 -0400
Subject: [BiO BB] How to download Protein complexes from PDB ?
In-Reply-To: <BAY108-F22F82BE25E770E78104224BEC20@phx.gbl>
References: <BAY108-F22F82BE25E770E78104224BEC20@phx.gbl>
Message-ID: <46E82572.7010407@fiserlab.org>

just use pdb advanced search engine

Mike Marchywka wrote:
>> I need to download a set of 200 complexes from PDB (they can include
>> dimers, trimers and tetramers). But they should only contain
> 
> 
> 
> I'm not entirely sure what you mean but I do know I've had to guess a lot
> with the ncbi structure database. To test my molecule viewer, I had to 
> write several
> new scripts like this:
> 
> 142  pdbget -out xxx -structure "gaba complex"
> 143  cat xxx
> 144  pdbget -get 29354 1sff.pdb
> 
> I've got another script that the above calls:
> 
> $ eutilsnew -v -out asdf -structure  -report docsum  -retmode text 
> cytochrome
> 
> $ more asdf
> 
> 1: 2HL7
> Crystal Structure Of The Periplasmic Domain Of Ccmh From Pseudomonas 
> Aeruginosa
> [mmdbId:47389]
> 2: 2Z3U
> Crystal Structure Of Chromopyrrolic Acid Bound Cytochrome P450 Stap 
> (Cyp245a1)
> [mmdbId:47341]
> 3: 2Z3T
> Crystal Structure Of Substrate Free Cytochrome P450 Stap (Cyp245a1)
> [mmdbId:47340]
> 4: 2V0M
> Crystal Structure Of Human P450 3a4 In Complex With Ketoconazole
> [mmdbId:47321]
> 5: 2NZA
> 
> 
> I can't find a spec that say, "return all the matching pdb's", I just 
> get a list of id's
> and have to go get the ones I want. Still easy to automate however.
> 
> Search criteria are here:
> 
> http://eutils.ncbi.nlm.nih.gov/entrez/eutils/einfo.fcgi?db=structure
> 
> I generally take the "download everything close  and sort it out locally
> approach" using custom scripts for one-off searches.
> 
> If anyone knows the codes to download all the pdb's at once can you 
> please post.
> Thanks.
> 
> _________________________________________________________________
> Test your celebrity IQ.  Play Red Carpet Reveal and earn great prizes! 
> http://club.live.com/red_carpet_reveal.aspx?icid=redcarpet_hotmailtextlink2
> 
> _______________________________________________
> General Forum at Bioinformatics.Org - BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
> 

-- 
Narcis Fernandez-Fuentes, phD
Seaver Center for Bioinformatics
Albert Einstein College of Medicine
1300 Morris Park Ave, Bronx, NY 10461, USA
phone: (718)430-8564    fax: (718) 430-8565
mailto:narcis at fiserlab.org  (http://www.fiserlab.org)


From me.lixue at gmail.com  Thu Sep 13 11:10:31 2007
From: me.lixue at gmail.com (Xue Li)
Date: Thu, 13 Sep 2007 10:10:31 -0500
Subject: [BiO BB] anyone uses MATLAB or R or SAS to analyze microarray?
Message-ID: <62ed16460709130810n4563df04tb11ae8706e3ee6fe@mail.gmail.com>

Hello all,

Would someone please tell me which is better to analyze microarray data,
MATLAB or R or SAS?

I am a student, so I have access to these three softwares for free.

-- 
Xue, Li
Bioinformatics and Computational Biology program @ ISU
Ames, IA 50010
515-450-7183


From skhadar at gmail.com  Thu Sep 13 13:55:42 2007
From: skhadar at gmail.com (Shameer Khadar)
Date: Thu, 13 Sep 2007 23:25:42 +0530
Subject: [BiO BB] How to download Protein complexes from PDB ?
In-Reply-To: <46E82572.7010407@fiserlab.org>
References: <BAY108-F22F82BE25E770E78104224BEC20@phx.gbl>
	<46E82572.7010407@fiserlab.org>
Message-ID: <b6ff81950709131055n40cf5d04wb10b0c3a76bab955@mail.gmail.com>

Dear Narcis,

You are right, But here also the problem is I need to either check/uncheck
200/5800 structures. Thats quite a boring job.

PS. This is my personal comment on the problem:
Bioinformatics is all about biological data, but simple tasks like these
requires manual intervention. This scenario should change.  Large scale
database designers should take these kind of requirements while developing
the database-design. There should always be a survey/feedback from users
regarding various aspects of database design for bioinformatics community.

I am looking forward for your feedback/resopnse.
--
SK


On 9/12/07, Narcis Fernandez-Fuentes <narcis at fiserlab.org> wrote:
>
> just use pdb advanced search engine


From marchywka at hotmail.com  Thu Sep 13 11:40:58 2007
From: marchywka at hotmail.com (Mike Marchywka)
Date: Thu, 13 Sep 2007 11:40:58 -0400
Subject: [BiO BB] How to download Protein complexes from PDB ?
In-Reply-To: <b6ff81950709130650l31a70beej1f5894dadc0b2664@mail.gmail.com>
Message-ID: <BAY108-F2086BD23D1ABD8EA3C07A3BEC30@phx.gbl>

Thanks.  Can you point to something that just returns a single file 
containing
all the matching PDB's as this was the feature at issue?   It looks like 
their java classes
anyway only return hit lists, not a single file containing all the relevant 
pdb entries.
They seem to have an applet but you need to enter a file list,
http://www.rcsb.org/robohelp/data_download/structure_download.htm

It looks like it is a bit more complicated than
it really needs to be for what I"m after. I don't have any SOAP code yet but 
I guess it would
be nice eventually. The eutils stuff is here and you can specify most stuff 
with
simple POST or GET and get back text as one option:

http://www.ncbi.nlm.nih.gov/entrez/query/static/efetch_help.html

XML and SOAP may seem like universal alternatives to straight text download
but in many cases it is nice to just get text back.
With the straight text, I can more or grep it- may not make sense for many 
things
but if you've ever tried browsing XML you can appreciate the problem :)



>From: "Shameer Khadar" <skhadar at gmail.com>
>Reply-To: "General Forum at Bioinformatics.Org" 
><bio_bulletin_board at bioinformatics.org>
>To: "General Forum at Bioinformatics.Org" 
><bio_bulletin_board at bioinformatics.org>
>Subject: Re: [BiO BB] How to download Protein complexes from PDB ?
>Date: Thu, 13 Sep 2007 19:20:07 +0530
>
>Dear Mike
>
>I havent use efetch before. Anyway I will look in to that.
>
>Separately RCSB is providing WebServices and its clients in Java and Perl, 
>I
>think here you will get a programmatic access to the database. But due to
>some strange security reasons my sysadmin people are not allowing me to
>access the webservices.
>
>
>http://www.rcsb.org/robohelp/site_navigation/reengeneered_site_features.htm#Web%20Services
>http://www.rcsb.org/robohelp/webservices/summary.htm -> Exact URL
>I hope this will help.
>--
>
>

_________________________________________________________________
More photos; more messages; more whatever. Windows Live Hotmail - NOW with 
5GB storage. 
http://imagine-windowslive.com/hotmail/?locale=en-us&ocid=TXT_TAGHM_migration_HM_mini_5G_0907



From skhadar at gmail.com  Thu Sep 13 14:08:43 2007
From: skhadar at gmail.com (Shameer Khadar)
Date: Thu, 13 Sep 2007 23:38:43 +0530
Subject: [BiO BB] anyone uses MATLAB or R or SAS to analyze microarray?
In-Reply-To: <62ed16460709130810n4563df04tb11ae8706e3ee6fe@mail.gmail.com>
References: <62ed16460709130810n4563df04tb11ae8706e3ee6fe@mail.gmail.com>
Message-ID: <b6ff81950709131108wa5823cem29c3aca031a1df12@mail.gmail.com>

Why dont u try R / Bioconductor -

On 9/13/07, Xue Li <me.lixue at gmail.com> wrote:
>
> Hello all,
>
> Would someone please tell me which is better to analyze microarray data,
> MATLAB or R or SAS?
>
> I am a student, so I have access to these three softwares for free.
>
> --
> Xue, Li
> Bioinformatics and Computational Biology program @ ISU
> Ames, IA 50010
> 515-450-7183
> _______________________________________________
> General Forum at Bioinformatics.Org -
> BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>


From marchywka at hotmail.com  Thu Sep 13 15:04:09 2007
From: marchywka at hotmail.com (Mike Marchywka)
Date: Thu, 13 Sep 2007 15:04:09 -0400
Subject: [BiO BB] How to download Protein complexes from PDB ?
In-Reply-To: <b6ff81950709131055n40cf5d04wb10b0c3a76bab955@mail.gmail.com>
Message-ID: <BAY108-F36881351BD117573754A4FBEC30@phx.gbl>

>You are right, But here also the problem is I need to either check/uncheck
>200/5800 structures. Thats quite a boring job.
>


This is why my answer to everything is, "download globally, select locally."
You can't make a menu based web interface which is easy for a casual user 
and
yet comprehensive. I can sed, grep, awk, and c++ my way out of most problems
with only a few swear words and incorrect results ( you need to calculate
and verify sanity checks at every step).
The other topic, being able to download every candidate pdb file at once, it
not a major issue as you can issue 200 serial get requests without any 
pipelining
but it takes forever. With the other NCBI databases, I never even need a hit
list, just a massive hit result download, exept for the mmdb/structures 
thing AFAIK.

_________________________________________________________________
Discover sweet stuff waiting for you at the Messenger Cafe.? Claim your 
treat today! 
http://www.cafemessenger.com/info/info_sweetstuff.html?ocid=TXT_TAGHM_SeptHMtagline2



From marchywka at hotmail.com  Thu Sep 13 17:37:48 2007
From: marchywka at hotmail.com (Mike Marchywka)
Date: Thu, 13 Sep 2007 17:37:48 -0400
Subject: [BiO BB] ortholog
In-Reply-To: <OF1993E684.DD973AA6-ON85257352.00553812-85257352.00556E95@notes.udayton.edu>
Message-ID: <BAY108-F38EC51418DA57444E63DB6BEC30@phx.gbl>


If you are interested in doing custom comparisons or looking for differences 
by functional area,
it turns out that the prosite rules seem to be downloadable , they sent me
a link today:

ftp://ftp.expasy.org/databases/prosite/prosite.dat

I had to ignore their matrix data but their pattern library was easily 
convertible
into PERL ( as far as I have looked, obvious caveats for bugs etc- the 
canned
c++ regex code I lifted from Microsoft may not be bug free etc) and
it gave me quick graphical and textual compare results on 1000+ rules.
The point here is that you can make your own rules as you read the 
literature
( that is my plan anyway ) and implement ad hoc splicing or translation 
schemes
( pretend you want to model flakey ribosomes).
Anyway, I get stuff like this:

Translated rule matches generates rule hit files:

$ $progpath/rules_annotater -clean -which 1 -fastas o2_fasta -xrules 
$progpath/prosite_rules > pro1

$ $progpath/mm_align_tool -fastas o2_fasta -rules pro0 -rules pro1 -stats
For Rules set 0:>ref|NW_876253.1|Cfa11_WGA39_2:47189155-47195387 Canis 
familiar
is chromosome 11 genomic contig, whole genome shotgun sequence
97         >rule|13|PEPDTIDE Prosite MICROBODIES_CTER
68         >rule|3|PEPDTIDE Prosite PKC_PHOSPHO_SITE
64         >rule|6|PEPDTIDE Prosite MYRISTYL
47         >rule|4|PEPDTIDE Prosite CK2_PHOSPHO_SITE
46         >rule|11|PEPDTIDE Prosite PRENYLATION
30         >rule|1|PEPDTIDE Prosite ASN_GLYCOSYLATION
10         >rule|2|PEPDTIDE Prosite CAMP_PHOSPHO_SITE
10         >rule|5|PEPDTIDE Prosite TYR_PHOSPHO_SITE
6          >rule|7|PEPDTIDE Prosite AMIDATION
3          >rule|87|PEPDTIDE Prosite LEUCINE_ZIPPER
2          >rule|12|PEPDTIDE Prosite ER_TARGET
1          >rule|1087|PEPDTIDE Prosite THIONIN
1          >rule|973|PEPDTIDE Prosite TUBULIN_B_AUTOREG
For Rules set 1:>gb|AACN010493556.1|:1-1146 Canis familiaris 
ctg19866850213054,
whole genome shotgun sequence
23         >rule|13|PEPDTIDE Prosite MICROBODIES_CTER
9          >rule|1|PEPDTIDE Prosite ASN_GLYCOSYLATION
8          >rule|11|PEPDTIDE Prosite PRENYLATION
8          >rule|3|PEPDTIDE Prosite PKC_PHOSPHO_SITE
8          >rule|6|PEPDTIDE Prosite MYRISTYL
7          >rule|4|PEPDTIDE Prosite CK2_PHOSPHO_SITE
2          >rule|5|PEPDTIDE Prosite TYR_PHOSPHO_SITE
1          >rule|12|PEPDTIDE Prosite ER_TARGET
1          >rule|7|PEPDTIDE Prosite AMIDATION
1          >rule|87|PEPDTIDE Prosite LEUCINE_ZIPPER


This turned out to be easyto align as the sequences are largely identical ( 
the lone "G" is
the mismatch in this excerpt ) but you get the idea:

$ $progpath/mm_align_tool -fastas o2_fasta -rules pro0 -rules pro1 -use_rule 
13
-align -output text
[...]
Start at 696 and 2373:
          GGCCATTTTGCAACTCATGCATGAGCTACCTTTAGTTCCCCTTCTACATCTGAGAACTGT

          CCCATATAGAATATTTTATAAAACAAGATGGCATTGTGCTAAGTAAAATGCAGAACAAAA
                                     G
          TCAGTATCCCATTAGACATGTCATATTCAGAGTTTATTTTTATCCTTGCACTGAAAGAAT

          GATTGTAAATCAATGGTTTCTTTTTGTTTCTTGACTGTGGCAGTGTTCTGGCTCCAAATG

          ATGGAGATTCCAAATAAGCATTACAGCTTGGCAGGAAATGCCAGTTCAGATATTTGTGAG

          ATCCTAAAGAATAGATCTGGACACATAT

_________________________________________________________________
More photos; more messages; more whatever. Windows Live Hotmail - NOW with 
5GB storage. 
http://imagine-windowslive.com/hotmail/?locale=en-us&ocid=TXT_TAGHM_migration_HM_mini_5G_0907



From me.lixue at gmail.com  Thu Sep 13 19:04:28 2007
From: me.lixue at gmail.com (Xue Li)
Date: Thu, 13 Sep 2007 18:04:28 -0500
Subject: [BiO BB] anyone uses MATLAB or R or SAS to analyze microarray?
In-Reply-To: <b6ff81950709131108wa5823cem29c3aca031a1df12@mail.gmail.com>
References: <62ed16460709130810n4563df04tb11ae8706e3ee6fe@mail.gmail.com>
	<b6ff81950709131108wa5823cem29c3aca031a1df12@mail.gmail.com>
Message-ID: <62ed16460709131604t5169fc62u61459e276a913a91@mail.gmail.com>

I am familar with MATLAB and have never done with R/Bioconductor. So I want
to know which is better.

Li

On 9/13/07, Shameer Khadar <skhadar at gmail.com> wrote:
>
> Why dont u try R / Bioconductor -
>
> On 9/13/07, Xue Li <me.lixue at gmail.com> wrote:
> >
> > Hello all,
> >
> > Would someone please tell me which is better to analyze microarray data,
> > MATLAB or R or SAS?
> >
> > I am a student, so I have access to these three softwares for free.
> >
> > --
> > Xue, Li
> > Bioinformatics and Computational Biology program @ ISU
> > Ames, IA 50010
> > 515-450-7183
> > _______________________________________________
> > General Forum at Bioinformatics.Org -
> > BiO_Bulletin_Board at bioinformatics.org
> > https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
> >
> _______________________________________________
> General Forum at Bioinformatics.Org -
> BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>



-- 
Xue, Li
Bioinformatics and Computational Biology program @ ISU
Ames, IA 50010
515-450-7183


From dafniosn at post.tau.ac.il  Fri Sep 14 08:56:28 2007
From: dafniosn at post.tau.ac.il (Osnat Dafni)
Date: Fri, 14 Sep 2007 15:56:28 +0300
Subject: [BiO BB] doing clustering based on similarity matrix
In-Reply-To: <62ed16460709121417m4646642wd1f18209bee70995@mail.gmail.com>
References: <c6cfea460709020341n1610d1c2h6226c0ed77697e3c@mail.gmail.com>
	<62ed16460709121417m4646642wd1f18209bee70995@mail.gmail.com>
Message-ID: <1189774588.46ea84fcc2076@webmail.tau.ac.il>

Hi Li,

Do you know of any specific package or function to do this?

Thanks,
Osnat


Quoting Xue Li <me.lixue at gmail.com>:

> You could use MATLAB software package to do clustering on a given similarity
> matrix.
>
> Li
>
> On 9/2/07, Tomer Handelman <tomer.handelman at gmail.com> wrote:
> >
> > hello all,
> > I'm looking for a piece of software that will allow me to do clustering
> > based on a given similarity matrix and not on raw data from Micro arrays.
> > everything I found so far works only on raw data...
> >
> > thanks in advance,
> > Tomer
> > _______________________________________________
> > General Forum at Bioinformatics.Org -
> > BiO_Bulletin_Board at bioinformatics.org
> > https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
> >
>
>
>
> --
> Xue, Li
> Bioinformatics and Computational Biology program @ ISU
> Ames, IA 50010
> 515-450-7183
> _______________________________________________
> General Forum at Bioinformatics.Org - BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>




----------------------------------------------------------------
This message was sent using IMP, the Internet Messaging Program.



From marcel at vdbosch.com  Thu Sep 13 14:41:04 2007
From: marcel at vdbosch.com (Marcel van den Bosch)
Date: Thu, 13 Sep 2007 20:41:04 +0200
Subject: [BiO BB] anyone uses MATLAB or R or SAS to analyze microarray?
In-Reply-To: <62ed16460709130810n4563df04tb11ae8706e3ee6fe@mail.gmail.com>
Message-ID: <200709131841.l8DIfOF7043939@smtp-vbr9.xs4all.nl>

Hi Li,

I am using R for data analysis and sometimes Perl scripts. You should
also take a look at bioconductor. I don't know which is best, but there it
works good enough for me.

Good luck!

Marcel
-----Oorspronkelijk bericht-----
Van: bio_bulletin_board-bounces+marcel=vdbosch.com at bioinformatics.org
[mailto:bio_bulletin_board-bounces+marcel=vdbosch.com at bioinformatics.org]
Namens Xue Li
Verzonden: donderdag 13 september 2007 17:11
Aan: bio_bulletin_board at bioinformatics.org
Onderwerp: [BiO BB] anyone uses MATLAB or R or SAS to analyze microarray?

Hello all,

Would someone please tell me which is better to analyze microarray data,
MATLAB or R or SAS?

I am a student, so I have access to these three softwares for free.

-- 
Xue, Li
Bioinformatics and Computational Biology program @ ISU
Ames, IA 50010
515-450-7183
_______________________________________________
General Forum at Bioinformatics.Org - BiO_Bulletin_Board at bioinformatics.org
https://bioinformatics.org/mailman/listinfo/bio_bulletin_board



From skhadar at gmail.com  Thu Sep 13 12:01:13 2007
From: skhadar at gmail.com (Shameer Khadar)
Date: Thu, 13 Sep 2007 21:31:13 +0530
Subject: [BiO BB] How to download Protein complexes from PDB ?
In-Reply-To: <2645.144.122.42.57.1189617204.squirrel@webmail.ceng.metu.edu.tr>
References: <b6ff81950709120933pb906e5bh60b0e55146611f32@mail.gmail.com>
	<2645.144.122.42.57.1189617204.squirrel@webmail.ceng.metu.edu.tr>
Message-ID: <b6ff81950709130901i1c8b9db8x51136bae5c5a6a21@mail.gmail.com>

Hi Tolga,

Thanks for your detailed mail. But here also the problem is I need to either
check/uncheck 200/5800 structures.
Thats quite a boring job. Anyway right I am working around the Advanced
Search page of RCSB.
PS. I enquired about this at info at rcsb.org and Dr. Catherine explained about
the option that u explained.
--
Shameer


On 9/12/07, tcan at ceng.metu.edu.tr <tcan at ceng.metu.edu.tr> wrote:
>
>
> You may use the "Advanced Search" utility of PDB to get the complexes you
> need.
>
> 1) Click on the Advanced Search link at the top of the PDB web page at
> www.rcsb.org/pdb
>
> 2) Click on the "Choose a query type" pull-down option menu and choose
> "Number of Chains" under "Sequence Features". Specify chain length as:
> between 2 and 4
>
> 3) Click on the "plus" button on the right to add another sub query
>
> 4) Click on the second "Choose a query type" pull-down option menu and
> choose "Molecule/Chain Type" under "Structure Summary". Specify "Contains
> Protein: Yes", "Contains DNA: No", and "Contains RNA: No".
>
> 5) If you want to remove redundant sequences check the "remove similar
> sequences at 90% identity" check-box.
>
> 6) Click on the "Evaluate Query" button to get the structures you are
> looking for.
>
> There are about 6K of such complexes. Good luck.
>
> Tolga Can
>
> > This is a simple yet a tricky issue : :)
> > I need to download a set of 200 complexes from PDB (they can include
> > dimers, trimers and tetramers). But they should only contain
> > proteins(no
> > DNA/RNA along with the protein). Is it possible get such 200
> > structures from PDB through web search. If yes, what search
> > keyword/strategy should I
> > use ? Or is there any other way to  get it done using SRS/BioMart ?
> >
> > SK
> > _______________________________________________
> > General Forum at Bioinformatics.Org -
> > BiO_Bulletin_Board at bioinformatics.org
> > https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
> >
>
>
> _______________________________________________
> General Forum at Bioinformatics.Org -
> BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>


From ybolo001 at student.ucr.edu  Thu Sep 13 14:40:06 2007
From: ybolo001 at student.ucr.edu (Eugene Bolotin)
Date: Thu, 13 Sep 2007 11:40:06 -0700
Subject: [BiO BB] anyone uses MATLAB or R or SAS to analyze microarray?
In-Reply-To: <62ed16460709130810n4563df04tb11ae8706e3ee6fe@mail.gmail.com>
References: <62ed16460709130810n4563df04tb11ae8706e3ee6fe@mail.gmail.com>
Message-ID: <941fcc750709131140u49925e3cw271bee7f29278670@mail.gmail.com>

R would be easier because of bioconductor package. Look up bioconductor.

On 9/13/07, Xue Li <me.lixue at gmail.com> wrote:
>
> Hello all,
>
> Would someone please tell me which is better to analyze microarray data,
> MATLAB or R or SAS?
>
> I am a student, so I have access to these three softwares for free.
>
> --
> Xue, Li
> Bioinformatics and Computational Biology program @ ISU
> Ames, IA 50010
> 515-450-7183
> _______________________________________________
> General Forum at Bioinformatics.Org -
> BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>



-- 
Eugene Bolotin
Ph.D. candidate
Genetics Genomics and Bioinformatics
University of California Riverside
ybolo001 at student.ucr.edu
Dr. Frances Sladek Lab


From abhishek.vit at gmail.com  Thu Sep 13 16:20:10 2007
From: abhishek.vit at gmail.com (Abhishek Pratap)
Date: Fri, 14 Sep 2007 01:50:10 +0530
Subject: [BiO BB] anyone uses MATLAB or R or SAS to analyze microarray?
In-Reply-To: <62ed16460709130810n4563df04tb11ae8706e3ee6fe@mail.gmail.com>
References: <62ed16460709130810n4563df04tb11ae8706e3ee6fe@mail.gmail.com>
Message-ID: <be9b52410709131320r7eb0dfees15a1d1716903b2f1@mail.gmail.com>

Hi

I think the your best pick for open source access should be
R/Bioinconductor. I dont think you can free access to MATLAB / SAS.

R could be a bit tricky to start but then has a huge support from open
source community.

Good Luck


Cheers
-Abhishek

On 9/13/07, Xue Li <me.lixue at gmail.com> wrote:
>
> Hello all,
>
> Would someone please tell me which is better to analyze microarray data,
> MATLAB or R or SAS?
>
> I am a student, so I have access to these three softwares for free.
>
> --
> Xue, Li
> Bioinformatics and Computational Biology program @ ISU
> Ames, IA 50010
> 515-450-7183
> _______________________________________________
> General Forum at Bioinformatics.Org -
> BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>



-- 
-----------------------------
Abhishek Pratap
FinalYear Bioinformatics
School of Biotechnology,Chemical and BioMedical Engineering
VIT University
UK    (44)-7925527281
Ph:   (91)-416-3206020
Mob: (91)-9944807494
www.bioinfosolutions.com


From abhishek.vit at gmail.com  Fri Sep 14 02:04:51 2007
From: abhishek.vit at gmail.com (Abhishek Pratap)
Date: Fri, 14 Sep 2007 11:34:51 +0530
Subject: [BiO BB] anyone uses MATLAB or R or SAS to analyze microarray?
In-Reply-To: <62ed16460709131604t5169fc62u61459e276a913a91@mail.gmail.com>
References: <62ed16460709130810n4563df04tb11ae8706e3ee6fe@mail.gmail.com>
	<b6ff81950709131108wa5823cem29c3aca031a1df12@mail.gmail.com>
	<62ed16460709131604t5169fc62u61459e276a913a91@mail.gmail.com>
Message-ID: <be9b52410709132304w5f4f613fg3ce94afca8564415@mail.gmail.com>

Definitely MATLAB has a easy access user interface but then R/
Bioinconductor has their own charm. I would say if you fancy programming go
for R. You might just feel too much of command line work with it.


Cheers
-Abhi


On 9/14/07, Xue Li <me.lixue at gmail.com> wrote:
>
> I am familar with MATLAB and have never done with R/Bioconductor. So I
> want
> to know which is better.
>
> Li
>
> On 9/13/07, Shameer Khadar <skhadar at gmail.com> wrote:
> >
> > Why dont u try R / Bioconductor -
> >
> > On 9/13/07, Xue Li <me.lixue at gmail.com> wrote:
> > >
> > > Hello all,
> > >
> > > Would someone please tell me which is better to analyze microarray
> data,
> > > MATLAB or R or SAS?
> > >
> > > I am a student, so I have access to these three softwares for free.
> > >
> > > --
> > > Xue, Li
> > > Bioinformatics and Computational Biology program @ ISU
> > > Ames, IA 50010
> > > 515-450-7183
> > > _______________________________________________
> > > General Forum at Bioinformatics.Org -
> > > BiO_Bulletin_Board at bioinformatics.org
> > > https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
> > >
> > _______________________________________________
> > General Forum at Bioinformatics.Org -
> > BiO_Bulletin_Board at bioinformatics.org
> > https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
> >
>
>
>
> --
> Xue, Li
> Bioinformatics and Computational Biology program @ ISU
> Ames, IA 50010
> 515-450-7183
> _______________________________________________
> General Forum at Bioinformatics.Org -
> BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>



-- 
-----------------------------
Abhishek Pratap
FinalYear Bioinformatics
School of Biotechnology,Chemical and BioMedical Engineering
VIT University
UK    (44)-7925527281
Ph:   (91)-416-3206020
Mob: (91)-9944807494
www.bioinfosolutions.com


From maximilianh at gmail.com  Sat Sep 22 14:44:48 2007
From: maximilianh at gmail.com (Maximilian Haeussler)
Date: Sat, 22 Sep 2007 20:44:48 +0200
Subject: [BiO BB] Enhancer databases
In-Reply-To: <a479e2050708210219n259940c3i5af5431c0235043a@mail.gmail.com>
References: <a479e2050708210219n259940c3i5af5431c0235043a@mail.gmail.com>
Message-ID: <76f031ae0709221144s7d7e0ef8v7c458707de503fb9@mail.gmail.com>

There are some:
oreganno (mostly mammals), cisred, flyreg (flies), dbtgr (ciona)...

depends on what you want to do...

max


On 21/08/2007, soorya kiran <kiran.soorya at gmail.com> wrote:
>
> *Hi all,*
> **
> *It will be appreciable if any one guide me, to find enhancer databases or
> related algorithams *
> *Thanks in advance*
> **
> *Sri*
> _______________________________________________
> General Forum at Bioinformatics.Org -
> BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>



-- 
Maximilian Haeussler,
skype: maximilianhaeussler
office: +33 1 69 82 41 29


From jing.cheng.2006 at gmail.com  Sat Sep 22 07:51:26 2007
From: jing.cheng.2006 at gmail.com (Jing cheng)
Date: Sat, 22 Sep 2007 19:51:26 +0800
Subject: [BiO BB] =?windows-1252?q?BMEI_2008_=96_Sanya=2C_China=3A_Deadli?=
	=?windows-1252?q?ne_10_November?=
Message-ID: <45a1ae00709220451v3203897fs57407033ce8cd551@mail.gmail.com>

** Our apologies if you receive multiple copies of this announcement *

    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
     2008 International Conference on BioMedical Engineering
                  and Informatics (BMEI 2008)
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

             28 - 30 May 2008, Sanya, Hainan, China

             Submission Deadline: 10 November 2007

              http://www.hainu.edu.cn/BMEI2008

        Call for Papers, Invited Sessions & Sponsorship

BioMedical engineering and informatics are two important and comple-
mentary disciplines that hold great promise for the advancement of
biological, medical, pharmaceutical, and environmental research and
development. Bridging these two disciplines enables us to improve
our understanding of living organisms and develop innovative tech-
niques towards personalized and predictive healthcare, such as real-
time monitoring of health and detection, prevention and optimal
treatment of complex diseases.

The purpose of the 2008 International Conference on BioMedical
Engineering and Informatics (BMEI 2008) is to bring together world-
wide researchers and scientists from these two disciplines to present
and discuss state-of-the-art of engineering and informatics for
biomedicine, and to foster international collaborations. The
Conference calls for research papers that report original approaches,
new results, and system developments in real biomedical applications.

The BMEI 2008 conference proceedings will be published by the IEEE
and will be indexed in both EI and ISTP. Selected good papers will be
recommended for publication in SCI/SCI-E indexed international
journals.

The BMEI 2008 will be co-located with the 2008 Congress on Image and
Signal Processing (CISP 2008: http://www.hainu.edu.cn/CISP2008), in
order to promote cross-fertilization between the broad areas of
biomedical engineering and signal processing.

ABOUT SANYA

Sanya is one of China premier tourist destinations, with white-sand
beaches, charming scenery, hot-springs, and popular activities such as
scuba-diving and rafting.  More than 20 ethnic groups, including Han,
Li, Miao, and Hui, inhabit Sanya and make Sanya a wonderful place to
appreciate the various cultures of China.

For more information, visit the conference web page or email the
secretariat at bmei2008 at hainu.edu.cn

Join us at this major event in scenic Hainan !!!


From samantha.jia at gmail.com  Sun Sep 23 08:00:06 2007
From: samantha.jia at gmail.com (Samantha Jia)
Date: Sun, 23 Sep 2007 20:00:06 +0800
Subject: [BiO BB] CISP 2008, Sanya, China: Deadline 10 November
Message-ID: <18627be60709230500j5c43dedds4487aac3b77d641e@mail.gmail.com>

** Our apologies if you receive multiple copies of this announcement *

    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    2008 International Congress on Image and Signal Processing
                          (CISP 2008)
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

             28 - 30 May 2008, Sanya, Hainan, China

             Submission Deadline: 10 November 2007

              http://www.hainu.edu.cn/CISP2008

        Call for Papers, Invited Sessions & Sponsorship

The aim of CISP 2008 is to bring together researchers working in many
different areas of image and signal processing to foster exchange of
new ideas.

The CISP 2008 proceedings will be published by the IEEE and will be
indexed in both EI and ISTP. Selected good papers will be recommended
for publication in SCI/SCI-E indexed international journals.

CISP 2008 will be co-located with the 2008 International Conference on
BioMedical Engineering and Informatics (BMEI 2008: http://www.
hainu.edu.cn/BMEI2008), in order to promote cross-fertilization
between the broad areas of biomedical engineering and signal
processing.

ABOUT SANYA

Sanya is one of China's premier tourist destinations, with white-sand
beaches, charming scenery, hot-springs, and popular activities such as
scuba-diving and rafting.  More than 20 ethnic groups, including Han,
Li, Miao, and Hui, inhabit Sanya and make Sanya a wonderful place to
appreciate the various cultures of China.

For more information, visit the conference web page or email the
secretariat at cisp2008 at hainu.edu.cn

Join us at this major event in scenic Hainan !!!


From hiekeen at gmail.com  Mon Sep 24 04:51:32 2007
From: hiekeen at gmail.com (Jinyan Huang)
Date: Mon, 24 Sep 2007 16:51:32 +0800
Subject: [BiO BB] How to human genome-wide prediction of epigenetic
	modification production?
Message-ID: <fb5dae380709240151k7b4eb672s93816a5df8256fcf@mail.gmail.com>

hi, all

I am interesting to epigenetic modification and liver cancer.

How to human genome-wide predicting epigenetic modification production?

like DNA methylation modification, histone acetylation modification.

thanks.

-- 
Best regards,
Jinyan Huang (ekeen)
School of Life Sciences and Technology, 1302 Room
Tongji University
Siping Road 1239, Shanghai  200092
P.R. China
Tel :0086-21-65983987-8007
eMail: hiekeen at gmail.com


From dan.bolser at gmail.com  Tue Sep 25 05:43:29 2007
From: dan.bolser at gmail.com (Dan Bolser)
Date: Tue, 25 Sep 2007 11:43:29 +0200
Subject: [BiO BB] Enhancer databases
In-Reply-To: <76f031ae0709221144s7d7e0ef8v7c458707de503fb9@mail.gmail.com>
References: <a479e2050708210219n259940c3i5af5431c0235043a@mail.gmail.com>
	<76f031ae0709221144s7d7e0ef8v7c458707de503fb9@mail.gmail.com>
Message-ID: <2c8757af0709250243t2b31f50ew7b0f89378f4fad03@mail.gmail.com>

I think I spammed this once already, but here goes anyway,

Here are some hits to the search 'Enhancers' on the MetaBase database;

http://biodatabase.org/index.php/Special:Search?search=enhancers&go=Go


MetaBase is a database of databases - any feedback is welcome!

Dan.


On 22/09/2007, Maximilian Haeussler <maximilianh at gmail.com> wrote:
> There are some:
> oreganno (mostly mammals), cisred, flyreg (flies), dbtgr (ciona)...
>
> depends on what you want to do...
>
> max
>
>
> On 21/08/2007, soorya kiran <kiran.soorya at gmail.com> wrote:
> >
> > *Hi all,*
> > **
> > *It will be appreciable if any one guide me, to find enhancer databases or
> > related algorithams *
> > *Thanks in advance*
> > **
> > *Sri*
> > _______________________________________________
> > General Forum at Bioinformatics.Org -
> > BiO_Bulletin_Board at bioinformatics.org
> > https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
> >
>
>
>
> --
> Maximilian Haeussler,
> skype: maximilianhaeussler
> office: +33 1 69 82 41 29
> _______________________________________________
> General Forum at Bioinformatics.Org - BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>


-- 
hello


From bhanupvsr at gmail.com  Tue Sep 25 17:14:34 2007
From: bhanupvsr at gmail.com (Bhanu Prasad)
Date: Tue, 25 Sep 2007 17:14:34 -0400
Subject: [BiO BB] AIPR-08: Call for papers
Message-ID: <621812f80709251414q7bfbbf5cpc79a6bd5a7e385f9@mail.gmail.com>

*Apologies for cross-posting. Please forward to interested people*



The 2008 International Conference on Artificial Intelligence and Pattern
Recognition (AIPR-08) will be held during July 7-10 2008 in Orlando, FL, USA.
You can see more details about the conference (and some other conferences
that will be held at the same place and time) at the website:
www.PromoteResearch.org <http://www.promoteresearch.org/>





Please feel free to contact me.



Best regards



B. Prasad

Program Committee Co-Chair of AIPR-08


From letondal at pasteur.Fr  Wed Sep 26 06:06:50 2007
From: letondal at pasteur.Fr (Catherine Letondal)
Date: Wed, 26 Sep 2007 12:06:50 +0200
Subject: [BiO BB] Course in informatics for biology 2008 at Institut Pasteur
Message-ID: <2DBC722D-9A6F-492F-94B6-1470D64DDE1B@pasteur.Fr>

Hi,

   
************************************************************************ 
*
     Course in informatics for biology 2008 at Institut Pasteur
        http://www.pasteur.fr/formation/infobio-en.html
   
************************************************************************ 
*

     In the series of courses offered at the Pasteur Institute, a  
course will be offered in informatics in biology. The next session  
will take place from January to end of April 2008.

     The main goal of this course is to provide researchers in  
biology an initial exposure to informatics. Admitance in the course  
is reserved for those with a degree in biology or a related discipline.

     With more and more bioinformatics tools available, it becomes  
increasingly important for researchers in biology to be able both to  
manage their data, implement their ideas, and judge for themselves  
the usefulness of new algorithms and software.

     This course will emphasize fundamental aspects of computer  
science and apply them to biological examples. Theoretical aspects  
(algorithm development, logic, problem modeling and design methods),  
and technical applications (databases and web technologies) that are  
relevant for biologists will be thoroughly discussed.


     Programming is presented through the object-oriented paradigm,  
using a modern high-level language, Python, provided with tools for  
biology and enabling both prototyping or scripting and the building  
of important software systems. Learning of an additional language (C)  
will be available for interested students.

     Learning during the course will be reinforced with computing  
exercises, and effective training will be provided by a 2 month  
research project.

     The working language of the course is French.

For further information, please consult:

     http://www.pasteur.fr/formation/infobio-en.html

  *** Registration will be closed on October 15 2007. ***

Sincerely,

-- 
Benno Schwikowski & Catherine Letondal, Institut Pasteur
Course informatics for biology



From phoebe at deakin.edu.au  Wed Sep 26 23:55:41 2007
From: phoebe at deakin.edu.au (Phoebe Chen)
Date: Thu, 27 Sep 2007 13:55:41 +1000
Subject: [BiO BB] APBC2008 Call for Posters - Sunday 30 Sep 2007
Message-ID: <5.0.1.4.2.20070927135149.050ccd90@mail.deakin.edu.au>

Dear Colleagues,

We apologize if you receive multiple copies of this
call for posters.

Regards,
Organizing Committee of APBC2008
------------
CALL FOR POSTERS (APBC 2008)
The Sixth Asia Pacific Bioinformatics Conference
Kyoto, Japan, 14-17 January 2008
http://bic.kyoto-u.ac.jp/apbc2008/

Please consider to submit a poster
in the conference.

The deadline for Posters submission is this Sunday 30 Sept, 2007.

The details of the call for posters can be found here:
http://sunflower.kuicr.kyoto-u.ac.jp/apbc2008/cfposter.html

We look forward to seeing you in Kyoto, Japan, an
exciting place to explore.

Organizing Committee of APBC2008


From marchywka at hotmail.com  Thu Sep 27 07:50:38 2007
From: marchywka at hotmail.com (Mike Marchywka)
Date: Thu, 27 Sep 2007 07:50:38 -0400
Subject: [BiO BB] Enhancer databases
In-Reply-To: <2c8757af0709250243t2b31f50ew7b0f89378f4fad03@mail.gmail.com>
Message-ID: <BAY108-F3393CFF3B88223182F4BAABEB10@phx.gbl>

Thanks but the as-posted link failed for me. In any case, the SNP database
was listed as most-popular at the time I hit the site.
One point I would make in favor of my prosite annotations versus
3D "things" would depend on how well these things can highlight important
post-translational modifications. The thing I ran into recently was
gain-of-glycosylation site as a disease mechanism
( Current Opinion in Genetics & Development 2007, 17:245?251 ).

http://biodatabase.org/index.php/SNP%40Domain

Does anyone have comments on the SNP explorer tools or a good tutorial link?
Offhand, 3D seems like a complicated way to go and there may be simpler ways
to screen things.

In any case, if you have interesting peptide or base sequences that can be
expressed as PERL regex's I'll be happy to add them, as I'm sure prosite 
would be too.











>From: "Dan Bolser" <dan.bolser at gmail.com>
>Reply-To: "General Forum at Bioinformatics.Org" 
><bio_bulletin_board at bioinformatics.org>
>To: "General Forum at Bioinformatics.Org" 
><bio_bulletin_board at bioinformatics.org>
>Subject: Re: [BiO BB] Enhancer databases
>Date: Tue, 25 Sep 2007 11:43:29 +0200
>
>I think I spammed this once already, but here goes anyway,
>
>Here are some hits to the search 'Enhancers' on the MetaBase database;
>
>http://biodatabase.org/index.php/Special:Search?search=enhancers&go=Go
>
>
>MetaBase is a database of databases - any feedback is welcome!
>
>Dan.
>
>
>On 22/09/2007, Maximilian Haeussler <maximilianh at gmail.com> wrote:
> > There are some:
> > oreganno (mostly mammals), cisred, flyreg (flies), dbtgr (ciona)...
> >
> > depends on what you want to do...
> >
> > max
> >
> >
> > On 21/08/2007, soorya kiran <kiran.soorya at gmail.com> wrote:
> > >
> > > *Hi all,*
> > > **
> > > *It will be appreciable if any one guide me, to find enhancer 
>databases or
> > > related algorithams *
> > > *Thanks in advance*
> > > **
> > > *Sri*
> > > _______________________________________________
> > > General Forum at Bioinformatics.Org -
> > > BiO_Bulletin_Board at bioinformatics.org
> > > https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
> > >
> >
> >
> >
> > --
> > Maximilian Haeussler,
> > skype: maximilianhaeussler
> > office: +33 1 69 82 41 29
> > _______________________________________________
> > General Forum at Bioinformatics.Org - 
>BiO_Bulletin_Board at bioinformatics.org
> > https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
> >
>
>
>--
>hello
>_______________________________________________
>General Forum at Bioinformatics.Org - BiO_Bulletin_Board at bioinformatics.org
>https://bioinformatics.org/mailman/listinfo/bio_bulletin_board

_________________________________________________________________
It?s the Windows Live? Hotmail? you love ? on your phone! 
http://www.microsoft.com/windowsmobile/mobilehotmail/default.mspx?WT.mc_ID=MobileHMTagline2



From jforment at ibmcp.upv.es  Fri Sep 28 03:28:35 2007
From: jforment at ibmcp.upv.es (Javier Forment Millet)
Date: Fri, 28 Sep 2007 09:28:35 +0200
Subject: [BiO BB] protein visualization tool
Message-ID: <1190964515.46fcad23260af@webmail.upv.es>

Hi all,...

Could anyone tell me about a protein 3D visualization tool capable of showing
the conformational changes induced by metal ion binding to different residues?

Thank you very much,

Javier.

-- 
Javier Forment Millet
Instituto de Biolog?a Celular y Molecular de Plantas (IBMCP) CSIC-UPV
 Ciudad Polit?cnica de la Innovaci?n (CPI) Edificio 8 E, Escalera 7 Puerta E
 Calle Ing. Fausto Elio s/n. 46022 Valencia, Spain
Tlf.:+34-96-3877858
FAX: +34-96-3877859
jforment at ibmcp.upv.es



From jrwagner at sfu.ca  Thu Sep 27 16:44:18 2007
From: jrwagner at sfu.ca (James Wagner)
Date: Thu, 27 Sep 2007 13:44:18 -0700
Subject: [BiO BB] Obtaining lineage information from an NCBI taxId
Message-ID: <ca4169bd0709271344o41f18f94l5d2c871dd77bf1e1@mail.gmail.com>

Hello, I was just trying to obtain the full phylogenetic lineage from a
given NCBI taxonomy ID using BioPerl. What i am discovering is that some of
these ids are missing names at certain levels. For example, for ID 1166 at
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=1128&lvl=3&keep=1&srchmode=1&unlock&lin=s

the lineage
Bacteria<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=2&lvl=3&keep=1&srchmode=1&unlock>;
Cyanobacteria<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=1117&lvl=3&keep=1&srchmode=1&unlock>;
Chroococcales<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=1118&lvl=3&keep=1&srchmode=1&unlock>;
Microcystis<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=1125&lvl=3&keep=1&srchmode=1&unlock>is
obtained

from the tooltips one can see that this is information for the Kingdom,
Phylum, Order, and Genus respectively, but Family and Class are missing.
While I can get this lineage from BioPerl, I cannot figure out how to find
out specifically that Family and Class are missing, and I was wondering if
there was some way to script NCBI (or anywhere else) to retrieve this
without resorting to screen scraping, as these tool-tips are the only place
that I can seem to find this information. Or is there some sort of rule in
bacterial taxonomy that I can apply to make this easier?
Thanks,

James


From gary at primary.bioinformatics.org  Fri Sep 28 13:39:08 2007
From: gary at primary.bioinformatics.org (Gary Van Domselaar)
Date: Fri, 28 Sep 2007 13:39:08 -0400 (EDT)
Subject: [BiO BB] Obtaining lineage information from an NCBI taxId
In-Reply-To: <ca4169bd0709271344o41f18f94l5d2c871dd77bf1e1@mail.gmail.com>
References: <ca4169bd0709271344o41f18f94l5d2c871dd77bf1e1@mail.gmail.com>
Message-ID: <Pine.LNX.4.63.0709281325490.14735@primary.bioinformatics.org>


Hi James,


It sounds like you want a local copy of the NCBI taxonomy database:
ftp://ftp.ncbi.nih.gov/pub/taxonomy/

the taxdump.tar.gz file, and corresponding readme will give you the 
information you need to traverse the ncbi taxonomy tree.  We have this 
parsed into a mysql database, with some perl and java code to extract 
lineages, we can send your way, if you are interested, there is also a 
good python / turbogears tutorial from andrew dalke for making a taxonomy 
server, you  could adapt the methodology to your application pretty 
quickly I think:

http://www.dalkescientific.com/writings/NBN/

Regards,

g.
--
Gary Van Domselaar, PhD
Head, Bioinformatics
National Microbiology Laboratory
Public Health Agency of Canada
820 Elgin St., Winnipeg, MB, Canada R3E 3R2

Suite E-006
Phone:  +1 204 784 5994
Mobile: +1 204 230 1338
Fax:    +1 204 789 2018
gary_van_domselaar [at] phac-aspc.gc.ca
gary.vandomselaar [at] gmail.com







On Thu, 27 Sep 2007, James Wagner wrote:

> Hello, I was just trying to obtain the full phylogenetic lineage from a
> given NCBI taxonomy ID using BioPerl. What i am discovering is that some of
> these ids are missing names at certain levels. For example, for ID 1166 at
> http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=1128&lvl=3&keep=1&srchmode=1&unlock&lin=s
>
> the lineage
> Bacteria<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=2&lvl=3&keep=1&srchmode=1&unlock>;
> Cyanobacteria<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=1117&lvl=3&keep=1&srchmode=1&unlock>;
> Chroococcales<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=1118&lvl=3&keep=1&srchmode=1&unlock>;
> Microcystis<http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Undef&id=1125&lvl=3&keep=1&srchmode=1&unlock>is
> obtained
>
> from the tooltips one can see that this is information for the Kingdom,
> Phylum, Order, and Genus respectively, but Family and Class are missing.
> While I can get this lineage from BioPerl, I cannot figure out how to find
> out specifically that Family and Class are missing, and I was wondering if
> there was some way to script NCBI (or anywhere else) to retrieve this
> without resorting to screen scraping, as these tool-tips are the only place
> that I can seem to find this information. Or is there some sort of rule in
> bacterial taxonomy that I can apply to make this easier?
> Thanks,
>
> James
> _______________________________________________
> General Forum at Bioinformatics.Org - BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>

-- 
Gary Van Domselaar, PhD
Associate Director, Bioinformatics.Org
gary at bioinformatics.org