[BiO BB] Blast Output statistics - xml vs plain text

Stefan Schuster sschuster at clcbio.com
Fri Nov 3 06:23:05 EST 2006


Hello,

performing a blastx search against RefSeq using the NCBI webblast 
(details below), the statistics section of the text output  contains 
amongst others following lines:

Length of database: 926984281
Length adjustment: 36
Effective length of query: 157
Effective length of database: 834733201
Effective search space: 23372529628
Effective search space used: 23372529628

The statics section of the xml output for exactly the same search (same RID) contains amongst others follwing entries:


<Statistics_db-len>926984281</Statistics_db-len>
<Statistics_hsp-len>0</Statistics_hsp-len>
<Statistics_eff-space>0</Statistics_eff-space>

How can the difference between "Effective search space" in the text 
output and "Statistics_eff-space" int the xml output be explained?
Which field in the xml output reffers to which field in the html output?
Is there a detailed description for all values of the statistics section 
available?

thanks in advance for helping

Stefan

details for blast query:
RID: 1162550444-15189-25311546969.BLASTQ2
Programm: blastx
database: refseq
all other parameters have default settings.
used query sequence:
 >testsequence1
CCGCCCGCCCGCCCGCAGGGACCACGCGCGGGGAAACCCGGAGCTGGCGCGGCTTCGTCC
CGGGCTGGCGGTGCTGGGCGCGGACGAGCGCATCTTCTCGCTGACGCGCAGGCTGGCGCA
CGGCGAGGAGCTGCGGGTGAGCGCGCGCTCCCGGGAGGGGCGGGGAGGGCGCCCCGGGTC
CACCCGCCCTCAC




More information about the BiO_Bulletin_Board mailing list