[BiO BB] question on RNA and species signatures

Mike Marchywka marchywka at hotmail.com
Thu Jul 26 10:33:03 EDT 2007



Thanks. Nothing on the one site but ensembl has some ideas, not sure
how to interpret yet. fwiw, ncbi does have several repeats databases

http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/remote_accessible_blastdblist.html

and I tried against a few of these but no low-e hits.
At higher e, there were a few suggestions in human repeats:

$ blastnew -out non_dog -nuc -hits 10 -summ 3000 -db humrep -expect 100 
TCCTGGAGTCCCAGGATCCAGTCCCACGTCGGGCTCCCT

>MER31-internal#LTR/MER4-group
          Length = 4936

Score = 26.3 bits (13), Expect = 0.22
Identities = 13/13 (100%)
Strand = Plus / Minus


Query: 12   caggatccagtcc 24
            |||||||||||||
Sbjct: 4369 caggatccagtcc 4357

I also ran against
some other wgs's and there are some lower e hits to cat but still
seems to be largely dog specific( matches 38/39 IIRC).

Thanks


Mike Marchywka
586 Saint James Walk
Marietta GA 30067-7165
404-788-1216 (C)<- leave message
989-348-4796 (P)<- emergency only
marchywka at hotmail.com





>From: "Tanney, Austin" <austin.tanney at almacgroup.com>
>Reply-To: "General Forum at Bioinformatics.Org" 
><bio_bulletin_board at bioinformatics.org>
>To: "General Forum at Bioinformatics.Org" 
><bio_bulletin_board at bioinformatics.org>
>Subject: RE: [BiO BB] question on RNA and species signatures
>Date: Thu, 26 Jul 2007 13:51:42 +0100
>
>Hi Mike,
>
>Have you tried looking at Rfam (http://www.sanger.ac.uk/Software/Rfam/)
>miRBase (http://microrna.sanger.ac.uk/sequences/) or the ensembl genome 
>browser (http://www.ensembl.org/index.html)
>
>Thanks
>
>Austin
>
>

_________________________________________________________________
http://liveearth.msn.com




More information about the BiO_Bulletin_Board mailing list