[BiO BB] question on RNA and species signatures
Tanney, Austin
austin.tanney at almacgroup.com
Thu Jul 26 10:59:05 EDT 2007
Mike,
For short BLASTs, the e-vlaue is generally not that usefull.
Often the recommended expect for short BLASTs is 1000.
In this case its % identiy and coverage you should look for.. Realistically 100% coverage should be what you expect.
-----Original Message-----
From:
bio_bulletin_board-bounces+austin.tanney=almacgroup.com at bioinformatics.o
rg
[mailto:bio_bulletin_board-bounces+austin.tanney=almacgroup.com at bioinfor
matics.org]On Behalf Of Mike Marchywka
Sent: 26 July 2007 15:33
To: bio_bulletin_board at bioinformatics.org
Subject: RE: [BiO BB] question on RNA and species signatures
Thanks. Nothing on the one site but ensembl has some ideas, not sure
how to interpret yet. fwiw, ncbi does have several repeats databases
http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/remote_accessible_blastdblist.html
and I tried against a few of these but no low-e hits.
At higher e, there were a few suggestions in human repeats:
$ blastnew -out non_dog -nuc -hits 10 -summ 3000 -db humrep -expect 100
TCCTGGAGTCCCAGGATCCAGTCCCACGTCGGGCTCCCT
>MER31-internal#LTR/MER4-group
Length = 4936
Score = 26.3 bits (13), Expect = 0.22
Identities = 13/13 (100%)
Strand = Plus / Minus
Query: 12 caggatccagtcc 24
|||||||||||||
Sbjct: 4369 caggatccagtcc 4357
I also ran against
some other wgs's and there are some lower e hits to cat but still
seems to be largely dog specific( matches 38/39 IIRC).
Thanks
Mike Marchywka
586 Saint James Walk
Marietta GA 30067-7165
404-788-1216 (C)<- leave message
989-348-4796 (P)<- emergency only
marchywka at hotmail.com
>From: "Tanney, Austin" <austin.tanney at almacgroup.com>
>Reply-To: "General Forum at Bioinformatics.Org"
><bio_bulletin_board at bioinformatics.org>
>To: "General Forum at Bioinformatics.Org"
><bio_bulletin_board at bioinformatics.org>
>Subject: RE: [BiO BB] question on RNA and species signatures
>Date: Thu, 26 Jul 2007 13:51:42 +0100
>
>Hi Mike,
>
>Have you tried looking at Rfam (http://www.sanger.ac.uk/Software/Rfam/)
>miRBase (http://microrna.sanger.ac.uk/sequences/) or the ensembl genome
>browser (http://www.ensembl.org/index.html)
>
>Thanks
>
>Austin
>
>
_________________________________________________________________
http://liveearth.msn.com
_______________________________________________
General Forum at Bioinformatics.Org - BiO_Bulletin_Board at bioinformatics.org
https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
Proprietary or confidential information belonging to Almac Group Limited or to one of its affiliated companies may be contained in this message. The e-mail and any files transmitted with it are confidential and privileged and intended solely for the use of the individual or entity to whom they are addressed.
Any unauthorised direct or indirect dissemination, distribution or copying of this message and any attachments is strictly prohibited.
If you have received the e-mail in error please notify helpdesk at almacgroup.com and delete the e-mail from your system.
E-mail and other communications sent to this company may be reviewed or read by persons other than the intended recipient.
Viruses : although we have taken steps to ensure that this e-mail and any attachments are free from any virus, you should, in keeping with good practice, ensure that they are actually virus free.
More information about the BiO_Bulletin_Board
mailing list