[BiO BB] question on RNA and species signatures
Mike Marchywka
marchywka at hotmail.com
Thu Jul 26 11:23:32 EDT 2007
That's why I posted the alignment :)
For a length ca. 40 bases it isn't too bad but, sure for
some really short things it has been a problem. Normally I just
collect a bunch of hits and sort the alignments with
text processing, grep "[A-Z]\{10\}" , once I have
some idea what the background looks like.
Since I'm guessing here, good matches to shorter sequences could help
isolate
important parts of the longer sequence.
>From: "Tanney, Austin" <austin.tanney at almacgroup.com>
>Reply-To: "General Forum at Bioinformatics.Org"
><bio_bulletin_board at bioinformatics.org>
>To: "General Forum at Bioinformatics.Org"
><bio_bulletin_board at bioinformatics.org>
>Subject: RE: [BiO BB] question on RNA and species signatures
>Date: Thu, 26 Jul 2007 15:59:05 +0100
>
>Mike,
>
>For short BLASTs, the e-vlaue is generally not that usefull.
>Often the recommended expect for short BLASTs is 1000.
>In this case its % identiy and coverage you should look for.. Realistically
>100% coverage should be what you expect.
>
>-----Original Message-----
>From:
>bio_bulletin_board-bounces+austin.tanney=almacgroup.com at bioinformatics.o
>rg
>[mailto:bio_bulletin_board-bounces+austin.tanney=almacgroup.com at bioinfor
>matics.org]On Behalf Of Mike Marchywka
>Sent: 26 July 2007 15:33
>To: bio_bulletin_board at bioinformatics.org
>Subject: RE: [BiO BB] question on RNA and species signatures
>
>
>
>
>Thanks. Nothing on the one site but ensembl has some ideas, not sure
>how to interpret yet. fwiw, ncbi does have several repeats databases
>
>http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/remote_accessible_blastdblist.html
>
>and I tried against a few of these but no low-e hits.
>At higher e, there were a few suggestions in human repeats:
>
>$ blastnew -out non_dog -nuc -hits 10 -summ 3000 -db humrep -expect 100
>TCCTGGAGTCCCAGGATCCAGTCCCACGTCGGGCTCCCT
>
> >MER31-internal#LTR/MER4-group
> Length = 4936
>
>Score = 26.3 bits (13), Expect = 0.22
>Identities = 13/13 (100%)
>Strand = Plus / Minus
>
>
>Query: 12 caggatccagtcc 24
> |||||||||||||
>Sbjct: 4369 caggatccagtcc 4357
>
>I also ran against
>some other wgs's and there are some lower e hits to cat but still
>seems to be largely dog specific( matches 38/39 IIRC).
>
>Thanks
>
>
>Mike Marchywka
>586 Saint James Walk
>Marietta GA 30067-7165
>404-788-1216 (C)<- leave message
>989-348-4796 (P)<- emergency only
>marchywka at hotmail.com
>
>
>
>
>
> >From: "Tanney, Austin" <austin.tanney at almacgroup.com>
> >Reply-To: "General Forum at Bioinformatics.Org"
> ><bio_bulletin_board at bioinformatics.org>
> >To: "General Forum at Bioinformatics.Org"
> ><bio_bulletin_board at bioinformatics.org>
> >Subject: RE: [BiO BB] question on RNA and species signatures
> >Date: Thu, 26 Jul 2007 13:51:42 +0100
> >
> >Hi Mike,
> >
> >Have you tried looking at Rfam (http://www.sanger.ac.uk/Software/Rfam/)
> >miRBase (http://microrna.sanger.ac.uk/sequences/) or the ensembl genome
> >browser (http://www.ensembl.org/index.html)
> >
> >Thanks
> >
> >Austin
> >
> >
>
>_________________________________________________________________
>http://liveearth.msn.com
>
>_______________________________________________
>General Forum at Bioinformatics.Org - BiO_Bulletin_Board at bioinformatics.org
>https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>
>Proprietary or confidential information belonging to Almac Group Limited or
>to one of its affiliated companies may be contained in this message. The
>e-mail and any files transmitted with it are confidential and privileged
>and intended solely for the use of the individual or entity to whom they
>are addressed.
>
>Any unauthorised direct or indirect dissemination, distribution or copying
>of this message and any attachments is strictly prohibited.
>
>If you have received the e-mail in error please notify
>helpdesk at almacgroup.com and delete the e-mail from your system.
>
>E-mail and other communications sent to this company may be reviewed or
>read by persons other than the intended recipient.
>
>Viruses : although we have taken steps to ensure that this e-mail and any
>attachments are free from any virus, you should, in keeping with good
>practice, ensure that they are actually virus free.
>
>
>_______________________________________________
>General Forum at Bioinformatics.Org - BiO_Bulletin_Board at bioinformatics.org
>https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
_________________________________________________________________
http://im.live.com/messenger/im/home/?source=hmtextlinkjuly07
More information about the BiO_Bulletin_Board
mailing list