Hi Bonnie: Could you share the sequence and one of the lines in the DB that matches? Joe BHurwitz@twt.com wrote: >Hi, > >I just updated my blast from 2.2.6 to 2.2.9 and am suddenly getting very >strange results. Sequences are appearing to have the same expect value >although the matches in the hsp are very different. I am wondering if any >one has seen a similar issue. I am also finding that if I set the -e >option to be higher, I can even get matches with just four bases, although >I have a word size of seven. Something is going very wrong! > >Here are the stats on my machine and blast command + example output: > >dual xeon 2.8 GHz, 4GB RAM, OS, RH linux: enterprise 3.0, kernel 2.4.21-9 > >options on the blast command line: -W 7, -e 1, -i input, -o output , -d >myinternalblastdb, --p blastn > >I'm using precompliled 2.2.9 from the NCBI. > > >>From blast: > > > >>5846704 >> >> > Length = 177 > > Score = 24.3 bits (12), Expect = 0.16 > Identities = 18/20 (90%) > Strand = Plus / Minus > >Query: 13 ctccagacattgggcgggtt 32 > |||||| ||||| ||||||| >Sbjct: 127 ctccaggcattgagcgggtt 108 > > > > >>5714596 >> >> > Length = 9401 > > Score = 24.3 bits (12), Expect = 0.16 > Identities = 8/20 (40%) > Strand = Plus / Minus > > >Query: 13 ctccagacattgggcgggtt 32 > | ||| | ||| >Sbjct: 202 tccaagaaaggacccggtcg 183 > >-Bonnie > > > >_______________________________________________ >Bioclusters maillist - Bioclusters@bioinformatics.org >https://bioinformatics.org/mailman/listinfo/bioclusters > > -- Joseph Landman, Ph.D Scalable Informatics LLC, email: landman@scalableinformatics.com web : http://scalableinformatics.com phone: +1 734 612 4615