From a.griekspoor at nki.nl Sat Apr 1 07:01:54 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Sat, 1 Apr 2006 14:01:54 +0200 Subject: [Biococoa-dev] [ANN] EnzymeX3 In-Reply-To: References: <022825CB-803D-40DC-A0B1-15BE7FDCDF86@nki.nl> Message-ID: <4203C599-DEBF-46EF-8841-4A7A8F4B2061@nki.nl> Hi Koen, No, I didn't, but are you sure there are no spaces in the sequence, in other words, is it one continuous string? I have no clue.. Alex On 31-mrt-2006, at 18:11, Koen van der Drift wrote: > Hi Alex, > > Did you make some improvements/changes in the KDTextView in > EnzymeX? I noticed that in your app the line numbers are drawn as > they should. However, in the translation demo, the linenumbers > actually draw the number of columns. Somehow the view thinks that > every column is a new line. > > I went back to the original KDTextView+ that you use in the Entrez > demo app, because I thought I had changed something while debugging > the sequenceView. However, even in that original view I get this > behaviour. I will be gone all weekend, so have no time to look into > this right now. > > cheers, > > - Koen. > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com LabAssistant - Get your life organized! http://www.mekentosj.com/labassistant ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From a.griekspoor at nki.nl Sat Apr 1 07:04:10 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Sat, 1 Apr 2006 14:04:10 +0200 Subject: [Biococoa-dev] Reading binary files on intel machine Message-ID: Hi guys, Someone reported that he couldn't read a DNA strider file with EnzymeX on his macbook, does any of you guys have an intel based mac or the possibility to test the standalone reader on such a machine. My gut feeling says I have to add some code to do some byte swapping (which I din't) and that's the reason reading binary files (strider/ gck) fails using the current code... Alex ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com Windows is a 32-bit patch to a 16-bit shell for an 8-bit operating system, written for a 4-bit processor by a 2- bit company without 1 bit of sense. ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From peter.schols at bio.kuleuven.be Sat Apr 1 07:11:09 2006 From: peter.schols at bio.kuleuven.be (Peter Schols) Date: Sat, 1 Apr 2006 14:11:09 +0200 Subject: [Biococoa-dev] Reading binary files on intel machine In-Reply-To: References: Message-ID: Hi Alex, I used to have a DTK here on my desk but I've returned it to Apple in order to participate in the exchange program and get an iMac Core Duo. Unfortunately, I haven't received the iMac yet... I'll let you know when it arrives. Peter On 01 Apr 2006, at 14:04, Alexander Griekspoor wrote: > Hi guys, > > Someone reported that he couldn't read a DNA strider file with > EnzymeX on his macbook, does any of you guys have an intel based > mac or the possibility to test the standalone reader on such a > machine. My gut feeling says I have to add some code to do some > byte swapping (which I din't) and that's the reason reading binary > files (strider/gck) fails using the current code... > Alex > > > ********************************************************* > ** Alexander Griekspoor ** > ********************************************************* > The Netherlands Cancer Institute > Department of Tumorbiology (H4) > Plesmanlaan 121, 1066 CX, Amsterdam > Tel: + 31 20 - 512 2023 > Fax: + 31 20 - 512 2029 > AIM: mekentosj at mac.com > E-mail: a.griekspoor at nki.nl > Web: http://www.mekentosj.com > > Windows is a 32-bit patch to a 16-bit shell for an 8-bit > operating system, written for a 4-bit processor by a 2- > bit company without 1 bit of sense. > > ********************************************************* > > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm From a.griekspoor at nki.nl Sat Apr 1 07:14:20 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Sat, 1 Apr 2006 14:14:20 +0200 Subject: [Biococoa-dev] Reading binary files on intel machine In-Reply-To: References: Message-ID: Great! Thanks. Alex On 1-apr-2006, at 14:11, Peter Schols wrote: > Hi Alex, > > I used to have a DTK here on my desk but I've returned it to Apple > in order to participate in the exchange program and get an iMac > Core Duo. > Unfortunately, I haven't received the iMac yet... I'll let you know > when it arrives. > > Peter > > > > On 01 Apr 2006, at 14:04, Alexander Griekspoor wrote: > >> Hi guys, >> >> Someone reported that he couldn't read a DNA strider file with >> EnzymeX on his macbook, does any of you guys have an intel based >> mac or the possibility to test the standalone reader on such a >> machine. My gut feeling says I have to add some code to do some >> byte swapping (which I din't) and that's the reason reading binary >> files (strider/gck) fails using the current code... >> Alex >> >> >> ********************************************************* >> ** Alexander Griekspoor ** >> ********************************************************* >> The Netherlands Cancer Institute >> Department of Tumorbiology (H4) >> Plesmanlaan 121, 1066 CX, Amsterdam >> Tel: + 31 20 - 512 2023 >> Fax: + 31 20 - 512 2029 >> AIM: mekentosj at mac.com >> E-mail: a.griekspoor at nki.nl >> Web: http://www.mekentosj.com >> >> Windows is a 32-bit patch to a 16-bit shell for an 8-bit >> operating system, written for a 4-bit processor by a 2- >> bit company without 1 bit of sense. >> >> ********************************************************* >> >> >> _______________________________________________ >> Biococoa-dev mailing list >> Biococoa-dev at bioinformatics.org >> https://bioinformatics.org/mailman/listinfo/biococoa-dev > > > Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > *********************************** Mek (Alexander Griekspoor) MekenTosj.com Web: http://www.mekentosj.com Mail: mek at mekentosj.com *********************************** -------------- next part -------------- An HTML attachment was scrubbed... URL: From kvddrift at earthlink.net Sat Apr 1 18:32:59 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Sat, 1 Apr 2006 18:32:59 -0500 (GMT-05:00) Subject: [Biococoa-dev] Reading binary files on intel machine Message-ID: <9854783.1143934379719.JavaMail.root@elwamui-lapwing.atl.sa.earthlink.net> That seems to be related to the little-endian and big-endian difference between intel and ppc processors. See eg this article: http://blogs.adobe.com/scottbyer/2006/03/macintosh_and_t.html. - Koen. -----Original Message----- >From: Alexander Griekspoor >Sent: Apr 1, 2006 7:04 AM >To: BioCocoa Mailinglist >Subject: [Biococoa-dev] Reading binary files on intel machine > >Hi guys, > >Someone reported that he couldn't read a DNA strider file with >EnzymeX on his macbook, does any of you guys have an intel based mac >or the possibility to test the standalone reader on such a machine. >My gut feeling says I have to add some code to do some byte swapping >(which I din't) and that's the reason reading binary files (strider/ >gck) fails using the current code... >Alex > > >********************************************************* > ** Alexander Griekspoor ** >********************************************************* > The Netherlands Cancer Institute > Department of Tumorbiology (H4) > Plesmanlaan 121, 1066 CX, Amsterdam > Tel: + 31 20 - 512 2023 > Fax: + 31 20 - 512 2029 > AIM: mekentosj at mac.com > E-mail: a.griekspoor at nki.nl > Web: http://www.mekentosj.com > >Windows is a 32-bit patch to a 16-bit shell for an 8-bit >operating system, written for a 4-bit processor by a 2- >bit company without 1 bit of sense. > >********************************************************* > > From a.griekspoor at nki.nl Sat Apr 1 18:48:24 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Sun, 2 Apr 2006 01:48:24 +0200 Subject: [Biococoa-dev] Reading binary files on intel machine In-Reply-To: <9854783.1143934379719.JavaMail.root@elwamui-lapwing.atl.sa.earthlink.net> References: <9854783.1143934379719.JavaMail.root@elwamui-lapwing.atl.sa.earthlink.net> Message-ID: <202AFD4D-3283-4A2D-83B9-D2945FE58D3A@nki.nl> Exactly, also by now the person reporting the problem verified that the same strider file could be opened on his powerpc macmini, but not on his macbook. I guess I have a reason to go the apple universal tour in amsterdam on the 11th ;-) Also, someone came up with a second bug in the reader code, one where linebreaks are not recognized correctly, I'll have to look into that as well... Cheers, Alex On 2-apr-2006, at 1:32, Koen van der Drift wrote: > That seems to be related to the little-endian and big-endian > difference between intel and ppc processors. See eg this article: > http://blogs.adobe.com/scottbyer/2006/03/macintosh_and_t.html. > > - Koen. > > > -----Original Message----- >> From: Alexander Griekspoor >> Sent: Apr 1, 2006 7:04 AM >> To: BioCocoa Mailinglist >> Subject: [Biococoa-dev] Reading binary files on intel machine >> >> Hi guys, >> >> Someone reported that he couldn't read a DNA strider file with >> EnzymeX on his macbook, does any of you guys have an intel based mac >> or the possibility to test the standalone reader on such a machine. >> My gut feeling says I have to add some code to do some byte swapping >> (which I din't) and that's the reason reading binary files (strider/ >> gck) fails using the current code... >> Alex >> >> >> ********************************************************* >> ** Alexander Griekspoor ** >> ********************************************************* >> The Netherlands Cancer Institute >> Department of Tumorbiology (H4) >> Plesmanlaan 121, 1066 CX, Amsterdam >> Tel: + 31 20 - 512 2023 >> Fax: + 31 20 - 512 2029 >> AIM: mekentosj at mac.com >> E-mail: a.griekspoor at nki.nl >> Web: http://www.mekentosj.com >> >> Windows is a 32-bit patch to a 16-bit shell for an 8-bit >> operating system, written for a 4-bit processor by a 2- >> bit company without 1 bit of sense. >> >> ********************************************************* >> >> > > > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com LabAssistant - Get your life organized! http://www.mekentosj.com/labassistant ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From kvddrift at earthlink.net Sat Apr 1 19:44:56 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Sat, 1 Apr 2006 19:44:56 -0500 (GMT-05:00) Subject: [Biococoa-dev] Reading binary files on intel machine Message-ID: <18118758.1143938697154.JavaMail.root@elwamui-chisos.atl.sa.earthlink.net> >Also, someone came up with a second bug in the reader code, one where >linebreaks are not recognized correctly, I'll have to look into that >as well... That could be an issue with the old BCReader class, which tests for linebreaks. The newer BCSequenceIO does not, as far as I can tell (I'm not at my Mac right now, so I cannot check that). - Koen. From kvddrift at earthlink.net Mon Apr 3 21:02:19 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Mon, 3 Apr 2006 21:02:19 -0400 Subject: Linenumber error (was: [Biococoa-dev] [ANN] EnzymeX3) In-Reply-To: <4203C599-DEBF-46EF-8841-4A7A8F4B2061@nki.nl> References: <022825CB-803D-40DC-A0B1-15BE7FDCDF86@nki.nl> <4203C599-DEBF-46EF-8841-4A7A8F4B2061@nki.nl> Message-ID: <39B11F89-042C-47CF-A4E6-2007FBA07F60@earthlink.net> Allright, I think I fixed it, I had to go in the repository and see which version still worked. Then I added some improvements I did remember. The only thing that doesn't work now is double-clicking, it selects sets of 10 basepairs, no matter how many there are in one column. - Koen. On Apr 1, 2006, at 7:01 AM, Alexander Griekspoor wrote: > Hi Koen, > > No, I didn't, but are you sure there are no spaces in the sequence, > in other words, is it one continuous string? > I have no clue.. > Alex > > On 31-mrt-2006, at 18:11, Koen van der Drift wrote: > >> Hi Alex, >> >> Did you make some improvements/changes in the KDTextView in >> EnzymeX? I noticed that in your app the line numbers are drawn as >> they should. However, in the translation demo, the linenumbers >> actually draw the number of columns. Somehow the view thinks that >> every column is a new line. >> >> I went back to the original KDTextView+ that you use in the Entrez >> demo app, because I thought I had changed something while >> debugging the sequenceView. However, even in that original view I >> get this behaviour. I will be gone all weekend, so have no time to >> look into this right now. >> >> cheers, >> >> - Koen. >> _______________________________________________ >> Biococoa-dev mailing list >> Biococoa-dev at bioinformatics.org >> https://bioinformatics.org/mailman/listinfo/biococoa-dev >> > > ********************************************************* > ** Alexander Griekspoor ** > ********************************************************* > The Netherlands Cancer Institute > Department of Tumorbiology (H4) > Plesmanlaan 121, 1066 CX, Amsterdam > Tel: + 31 20 - 512 2023 > Fax: + 31 20 - 512 2029 > AIM: mekentosj at mac.com > E-mail: a.griekspoor at nki.nl > Web: http://www.mekentosj.com > > LabAssistant - Get your life organized! > http://www.mekentosj.com/labassistant > > ********************************************************* > From a.griekspoor at nki.nl Tue Apr 4 05:18:17 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Tue, 4 Apr 2006 11:18:17 +0200 Subject: Linenumber error (was: [Biococoa-dev] [ANN] EnzymeX3) In-Reply-To: <39B11F89-042C-47CF-A4E6-2007FBA07F60@earthlink.net> References: <022825CB-803D-40DC-A0B1-15BE7FDCDF86@nki.nl> <4203C599-DEBF-46EF-8841-4A7A8F4B2061@nki.nl> <39B11F89-042C-47CF-A4E6-2007FBA07F60@earthlink.net> Message-ID: Yeah, because that's hardwired as well.... You have to change the hardcoded /10 by a divide by the number of characters per column... Cheers, Alex On 4-apr-2006, at 3:02, Koen van der Drift wrote: > Allright, I think I fixed it, I had to go in the repository and see > which version still worked. Then I added some improvements I did > remember. The only thing that doesn't work now is double-clicking, > it selects sets of 10 basepairs, no matter how many there are in > one column. > > - Koen. > > > > > On Apr 1, 2006, at 7:01 AM, Alexander Griekspoor wrote: > >> Hi Koen, >> >> No, I didn't, but are you sure there are no spaces in the >> sequence, in other words, is it one continuous string? >> I have no clue.. >> Alex >> >> On 31-mrt-2006, at 18:11, Koen van der Drift wrote: >> >>> Hi Alex, >>> >>> Did you make some improvements/changes in the KDTextView in >>> EnzymeX? I noticed that in your app the line numbers are drawn as >>> they should. However, in the translation demo, the linenumbers >>> actually draw the number of columns. Somehow the view thinks that >>> every column is a new line. >>> >>> I went back to the original KDTextView+ that you use in the >>> Entrez demo app, because I thought I had changed something while >>> debugging the sequenceView. However, even in that original view I >>> get this behaviour. I will be gone all weekend, so have no time >>> to look into this right now. >>> >>> cheers, >>> >>> - Koen. >>> _______________________________________________ >>> Biococoa-dev mailing list >>> Biococoa-dev at bioinformatics.org >>> https://bioinformatics.org/mailman/listinfo/biococoa-dev >>> >> >> ********************************************************* >> ** Alexander Griekspoor ** >> ********************************************************* >> The Netherlands Cancer Institute >> Department of Tumorbiology (H4) >> Plesmanlaan 121, 1066 CX, Amsterdam >> Tel: + 31 20 - 512 2023 >> Fax: + 31 20 - 512 2029 >> AIM: mekentosj at mac.com >> E-mail: a.griekspoor at nki.nl >> Web: http://www.mekentosj.com >> >> LabAssistant - Get your life organized! >> http://www.mekentosj.com/labassistant >> >> ********************************************************* >> > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com 4Peaks - For Peaks, Four Peaks. 2004 Winner of the Apple Design Awards Best Mac OS X Student Product http://www.mekentosj.com/4peaks ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From kvddrift at earthlink.net Tue Apr 4 06:54:30 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Tue, 4 Apr 2006 06:54:30 -0400 Subject: Linenumber error (was: [Biococoa-dev] [ANN] EnzymeX3) In-Reply-To: References: <022825CB-803D-40DC-A0B1-15BE7FDCDF86@nki.nl> <4203C599-DEBF-46EF-8841-4A7A8F4B2061@nki.nl> <39B11F89-042C-47CF-A4E6-2007FBA07F60@earthlink.net> Message-ID: <95E3FA7A-673A-4128-9C38-FBDA54DE8E45@earthlink.net> On Apr 4, 2006, at 5:18 AM, Alexander Griekspoor wrote: > Yeah, because that's hardwired as well.... You have to change the > hardcoded /10 by a divide by the number of characters per column... > That's what I thought. I will look into adding some code that makes the view use the actual values for the fontsize, etc, not based on hard-coded values. cheers, - Koen. From kvddrift at earthlink.net Tue Apr 4 06:57:23 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Tue, 4 Apr 2006 06:57:23 -0400 Subject: [Biococoa-dev] SVN update Message-ID: Hi, If you are already using the new svn repository (using FSFS instead of BerkeleyDB), could you please report here if everything is ok? I would like to let Jeff at bioinformatics.org know what the status is, so he can remove the old repository. If you are not using it yet, I strongly recommend that you do a fresh checkout before the old one gets removed: svn checkout svn+ssh://bioinformatics.org/svnroot/BioCocoa thanks, - Koen. From peter.schols at bio.kuleuven.be Tue Apr 4 10:30:11 2006 From: peter.schols at bio.kuleuven.be (Peter Schols) Date: Tue, 4 Apr 2006 16:30:11 +0200 Subject: [Biococoa-dev] SVN update In-Reply-To: References: Message-ID: <0EDF00B8-4918-4F94-A1BE-7CCD3182C2F9@bio.kuleuven.be> The new rep. works great here. Good idea to switch to FSFS! Peter On 04 Apr 2006, at 12:57, Koen van der Drift wrote: > svn checkout svn+ssh://bioinformatics.org/svnroot/BioCocoa Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm From kvddrift at earthlink.net Tue Apr 4 18:46:31 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Tue, 4 Apr 2006 18:46:31 -0400 Subject: Linenumber error (was: [Biococoa-dev] [ANN] EnzymeX3) In-Reply-To: <95E3FA7A-673A-4128-9C38-FBDA54DE8E45@earthlink.net> References: <022825CB-803D-40DC-A0B1-15BE7FDCDF86@nki.nl> <4203C599-DEBF-46EF-8841-4A7A8F4B2061@nki.nl> <39B11F89-042C-47CF-A4E6-2007FBA07F60@earthlink.net> <95E3FA7A-673A-4128-9C38-FBDA54DE8E45@earthlink.net> Message-ID: <83018F6C-BD0B-49E2-A07C-74889FA0D1C3@earthlink.net> On Apr 4, 2006, at 6:54 AM, Koen van der Drift wrote: > I will look into adding some code that makes the view use the > actual values for the fontsize, etc, not based on hard-coded values. Ok, fixed :) I have added a method that calculates the number of characters per column. But ideally, we should have a method that calculates the column width based on the font size, and the user defined characters per column. Looking ahead, I could imagine a sequenceView where some of the symbols are in boldface, or italicized, etc. That could make things more complicated. Looking even further ahead, a general sequence editor would be a great BioCocoa showcase ;-) cheers, - Koen. From kvddrift at earthlink.net Thu Apr 6 19:06:40 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Thu, 6 Apr 2006 19:06:40 -0400 Subject: [Biococoa-dev] SVN update In-Reply-To: <0EDF00B8-4918-4F94-A1BE-7CCD3182C2F9@bio.kuleuven.be> References: <0EDF00B8-4918-4F94-A1BE-7CCD3182C2F9@bio.kuleuven.be> Message-ID: <3D944CAE-AE04-46F6-B3DB-E14811642BCF@earthlink.net> On Apr 4, 2006, at 10:30 AM, Peter Schols wrote: > The new rep. works great here. Good idea to switch to FSFS! > Thanks - the old one has now been removed, and is no longer accessible. - Koen., From kvddrift at earthlink.net Thu Apr 6 19:48:43 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Thu, 6 Apr 2006 19:48:43 -0400 Subject: [Biococoa-dev] GDE format Message-ID: Hi, I am now working on moving some more formats from BCReader to BCSequenceReader. For the GDE format, I looked on the web, and found actually two different possibilities. The first one: { name "Short name for sequence" longname "Long (more descriptive) name for sequence" sequence-ID "Unique ID number" creation-date "mm/dd/yy hh:mm:ss" direction [-1|1] strandedness [1|2] type [DNA|RNA||PROTEIN|TEXT|MASK] offset (-999999,999999) group-ID (0,999) creator "Author's name" descrip "Verbose description" comments "Lines of comments that can be fairly arbitrary text about a sequence. Return characters are allowed, but no internal double quotes or brace characters. Remember to close with a double quote" sequence "gctagctagctagctagctcttagctgtagtcgtagctgatgctagct gatgctagctagctagctagctgatcgatgctagctgatcgtagctgacg gactgatgctagctagctagctagctgtctagtgtcgtagtgcttattgc" } but also: #sf170-A3 atgggaccagagtctaaagccatgtgtaaagttaacccctctctgcgttactttaaattgtagccat--- aa catcaccacc--------------------------------- #br20-B1 atgggatcaaagcctaaagccttgtgtaaagttaaccccactctgtgttactttaaattgcattgatttgaa t------------------------------------ aatagtactaacaacaataatagtagtggggtaaa The second one seems to be what Peter added to BCReader. I am not familiar with that format, so just wanted to check which one to use. cheers, - Koen. From peter.schols at bio.kuleuven.be Fri Apr 7 05:34:45 2006 From: peter.schols at bio.kuleuven.be (Peter Schols) Date: Fri, 7 Apr 2006 11:34:45 +0200 Subject: [Biococoa-dev] Re: GDE format In-Reply-To: References: Message-ID: <7A578A39-3F2D-4C75-9AFC-E9347B5F3FA7@bio.kuleuven.be> Hi Koen, I implemented the second format indeed, because that is the format most people in the lab (and on the net) seemed to use. I haven't used the format myself though, so I don't know much more about these two subformats. best wishes, Peter On 07 Apr 2006, at 01:48, Koen van der Drift wrote: > Hi, > > I am now working on moving some more formats from BCReader to > BCSequenceReader. For the GDE format, I looked on the web, and > found actually two different possibilities. The first one: > > { > name "Short name for sequence" > longname "Long (more descriptive) name for sequence" > sequence-ID "Unique ID number" > creation-date "mm/dd/yy hh:mm:ss" > direction [-1|1] > strandedness [1|2] > type [DNA|RNA||PROTEIN|TEXT|MASK] > offset (-999999,999999) > group-ID (0,999) > creator "Author's name" > descrip "Verbose description" > comments "Lines of comments that can be fairly arbitrary text about > a sequence. Return characters are allowed, but no internal double > quotes or brace characters. Remember to close with a double quote" > sequence "gctagctagctagctagctcttagctgtagtcgtagctgatgctagct > gatgctagctagctagctagctgatcgatgctagctgatcgtagctgacg > gactgatgctagctagctagctagctgtctagtgtcgtagtgcttattgc" > } > > > but also: > #sf170-A3 > > atgggaccagagtctaaagccatgtgtaaagttaacccctctctgcgttactttaaattgtagccat--- > aa catcaccacc--------------------------------- > > #br20-B1 > > atgggatcaaagcctaaagccttgtgtaaagttaaccccactctgtgttactttaaattgcattgatttg > aa t------------------------------------ > aatagtactaacaacaataatagtagtggggtaaa > > > > The second one seems to be what Peter added to BCReader. I am not > familiar with that format, so just wanted to check which one to use. > > cheers, > > > > - Koen. > Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm From kvddrift at earthlink.net Fri Apr 7 20:00:49 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Fri, 7 Apr 2006 20:00:49 -0400 Subject: [Biococoa-dev] Re: GDE format In-Reply-To: <7A578A39-3F2D-4C75-9AFC-E9347B5F3FA7@bio.kuleuven.be> References: <7A578A39-3F2D-4C75-9AFC-E9347B5F3FA7@bio.kuleuven.be> Message-ID: <861FB27F-8205-43A6-BB88-F7D99CEAE368@earthlink.net> On Apr 7, 2006, at 5:34 AM, Peter Schols wrote: > I implemented the second format indeed, because that is the format > most people in the lab (and on the net) seemed to use. I haven't > used the format myself though, so I don't know much more about > these two subformats. Neither do, I so I will stick with what you already had. It's also much easier ;-) - Koen. From service at paypal.com Sun Apr 9 13:48:19 2006 From: service at paypal.com (service at paypal.com) Date: Sun, 9 Apr 2006 13:48:19 -0400 (EDT) Subject: [Biococoa-dev] Notification of limited account acces Message-ID: <1144604899.59959.qmail@eBay.com> An HTML attachment was scrubbed... URL: From kvddrift at earthlink.net Sun Apr 9 21:12:47 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Sun, 9 Apr 2006 21:12:47 -0400 Subject: [Biococoa-dev] More on sequence formats Message-ID: <5B9BF2B3-9FD5-4A6F-8A64-3349D6721E8D@earthlink.net> Hi, This weekend I have been doing some more work on converting reading formats to the new BCSequence structure. For many of the formats, I have included a comment in the method about the structure of the format and a simple example. This not only for documentation, but also to help with the coding ;-) I have a couple of more questions before I can continue 1. What's the difference between Nexus and Nexusfileandblocks ? 2. How is the nona format defined, I couldn't find anything about this? 3. The MSF file now uses the string "Pileup" as a selector. However, when searching for the format definition, I found that this format uses a '!!NA' or '!!AA' instead. But I may have found the wrong info, so if anyone knows which is correct, please let me know. 4. I am thinking about adding a plist file to the framework that contains all the file extensions of possible sequence files. This can then be used in openPanel (see the code that Alex supplied). The nice thing about this is, is that we can synchronize the entries with the methods in BCSequenceReader. Any reason I should not do this? For those who feel like helping out, the way to implement the code is: - remove white lines (optional) - get each line - extract annotations into a BCAnnotationsArray - extract the sequence(s) into an NSString - once done with all the sequences, create a BCSequence from each sequenceString - add the annotations to each BCSequence - add the new BCSequence(s) to the BCSequenceArray - return the BCSequenceArray cheers, - Koen. From a.griekspoor at nki.nl Tue Apr 11 05:45:31 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Tue, 11 Apr 2006 11:45:31 +0200 Subject: [Biococoa-dev] Even more on sequence formats References: Message-ID: <42E81331-EABE-47ED-ACD6-B57EF899C2B5@nki.nl> Hi Koen, Good work on the sequence reader! > > I have a couple of more questions before I can continue > > 1. What's the difference between Nexus and Nexusfileandblocks ? > > 2. How is the nona format defined, I couldn't find anything about > this? > > 3. The MSF file now uses the string "Pileup" as a selector. > However, when searching for the format definition, I found that > this format uses a '!!NA' or '!!AA' instead. But I may have found > the wrong info, so if anyone knows which is correct, please let me > know. > On 1-3 Peter should know most questions I guess, he wrote the original stuff ;-). > 4. I am thinking about adding a plist file to the framework that > contains all the file extensions of possible sequence files. This > can then be used in openPanel (see the code that Alex supplied). > The nice thing about this is, is that we can synchronize the > entries with the methods in BCSequenceReader. Any reason I should > not do this? Sounds great, that allows us also to update BioCocoa with new read methods and existing programs can just change the framework and new support is added to their program. I'm also fixing some stuff for EnzymeX in the reader classes, the moment it's done I'll post you (koen) the changes and you can sync them with your work: - I've added support for reading sequence files that weren't saved as plain-text but as rtf, basically adding a check and converting the file to plain text before continuing with the normal format determination - I've changed the raw reading method such that it becomes more greedy. Peter's variant reads in all lines as separate entries in the matrix dictionary (which is probably what you want in aligned phylogenetic sequence files, but not in EnzymeX where people usually read in a single sequence file. So I remove all return characters first. I had one person complaining that EnzX only read the first line when he tried to open his nicely in 80 char columns formatted text file. Now the question is what the difference - I am fixing the binary file format reading (Strider/GCK) to make them universal compatible, currently they fail on an Intel based macs due to endian-issues Finally, to come back to the question on the formats, perhaps we can learn from a classic sequence reader package called ReadSeq by d.g.gilbert. It reads the following formats, which are outlined in the Formats textfile inside the src folder: 1. IG/Stanford 10. Olsen (in-only) 2. GenBank/GB 11. Phylip3.2 3. NBRF 12. Phylip 4. EMBL 13. Plain/Raw 5. GCG 14. PIR/CODATA 6. DNAStrider 15. MSF 7. Fitch 16. ASN.1 8. Pearson/Fasta 17. PAUP 9. Zuker (in-only) 18. Pretty (out-only) Some of them we support, but some not, so we can even add a few formats, plus the source code nicely shows how to discriminate them. The latest version switched from c to java and added even a few more formats, so there's plenty to add ;-) The source also contains many sample files for testing purposes. I'm not sure where it can be found nowadays, so I put it temporarily on our server for you guys to download: http://www.mekentosj.com/temporary/readseq.zip Have a look at it and tell me what you think. Cheers, Alex > For those who feel like helping out, the way to implement the code is: > > - remove white lines (optional) > - get each line > - extract annotations into a BCAnnotationsArray > - extract the sequence(s) into an NSString > - once done with all the sequences, create a BCSequence from each > sequenceString > - add the annotations to each BCSequence > - add the new BCSequence(s) to the BCSequenceArray > - return the BCSequenceArray > > > cheers, > > - Koen. > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > ************************************************************** ** Alexander Griekspoor ** ************************************************************** The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com MacOS X: The power of UNIX with the simplicity of the Mac *************************************************************** ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com iRNAi, do you? http://www.mekentosj.com/irnai ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From kvddrift at earthlink.net Tue Apr 11 06:08:27 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Tue, 11 Apr 2006 06:08:27 -0400 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: References: <5B9BF2B3-9FD5-4A6F-8A64-3349D6721E8D@earthlink.net> Message-ID: On Apr 11, 2006, at 5:44 AM, Alexander Griekspoor wrote: > - I've added support for reading sequence files that weren't saved > as plain-text but as rtf, basically adding a check and converting > the file to plain text before continuing with the normal format > determination That would be great addition. > - I've changed the raw reading method such that it becomes more > greedy. Peter's variant reads in all lines as separate entries in > the matrix dictionary (which is probably what you want in aligned > phylogenetic sequence files, but not in EnzymeX where people > usually read in a single sequence file. So I remove all return > characters first. I had one person complaining that EnzX only read > the first line when he tried to open his nicely in 80 char columns > formatted text file. > BCSequenceReader now works very different from the way BCReader does. I am not using a matrixDictionary anymore (see my comments in the previous mail, and the actual code). The current BCSequenceReader already reads a raw file in as one whole. BTW, be careful with what you put in your README for EnzymeX. I noticed you wrote that it supports BEAST and TNT formats, but I don't see those in BCReader. Unless you have a local version that does, of course ;-) I'll have a look at the readseq code later. cheers, - Koen. From mek at mekentosj.com Tue Apr 11 06:17:09 2006 From: mek at mekentosj.com (Alexander Griekspoor) Date: Tue, 11 Apr 2006 12:17:09 +0200 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: References: <5B9BF2B3-9FD5-4A6F-8A64-3349D6721E8D@earthlink.net> Message-ID: <2FB99B57-87E8-41A3-B098-349884426AE1@mekentosj.com> > BTW, be careful with what you put in your README for EnzymeX. I > noticed you wrote that it supports BEAST and TNT formats, but I > don't see those in BCReader. Unless you have a local version that > does, of course ;-) I'll have a look at the readseq code later. Please don't sue me! I just copied what Peter wrote, anything you will try to get from me in court, I will redeem from him ;-) Cheers, Alex ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com Windows vs Mac 65 million years ago, there were more dinosaurs than humans. Where are the dinosaurs now? ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From kvddrift at earthlink.net Tue Apr 11 06:39:00 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Tue, 11 Apr 2006 06:39:00 -0400 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: <2FB99B57-87E8-41A3-B098-349884426AE1@mekentosj.com> References: <5B9BF2B3-9FD5-4A6F-8A64-3349D6721E8D@earthlink.net> <2FB99B57-87E8-41A3-B098-349884426AE1@mekentosj.com> Message-ID: On Apr 11, 2006, at 6:17 AM, Alexander Griekspoor wrote: > Please don't sue me! I just copied what Peter wrote, anything you > will try to get from me in court, I will redeem from him ;-) > Sounds like a good plan :D - Koen. From mek at mekentosj.com Tue Apr 11 06:46:10 2006 From: mek at mekentosj.com (Alexander Griekspoor) Date: Tue, 11 Apr 2006 12:46:10 +0200 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: References: <5B9BF2B3-9FD5-4A6F-8A64-3349D6721E8D@earthlink.net> <2FB99B57-87E8-41A3-B098-349884426AE1@mekentosj.com> Message-ID: By the way I just found out that A Plasmid Editor (APE) files are also supported already by our framework, so you can add "ape" and "APE" to the list of supported file extensions. This is the one I use now: NSArray *fileTypes = [NSArray arrayWithObjects: @"text", @"TEXT", @"txt", @"TXT", @"fasta", @"FASTA", @"seq", @"SEQ", @"html", @"HTML", @"htm", @"HTM", @"rtf", @"RTF", @"rtfd", @"RTFD", @"gde", @"fas", @"nessig", @"pir", @"nona", @"phylip", @"nexus", @"GDE", @"FAS", @"NESSIG", @"PIR", @"NONA", @"PHYLIP", @"NEXUS", @"raw", @"clustal", @"pdb", @"embl", @"swissprot", @"NCBI", @"GCK", @"RAW", @"CLUSTAL", @"PDB", @"EMBL", @"SWISSPROT", @"ncbi", @"gck", @"aln", @"hen", @"fst", @"msf", @"nxs", @"non", @"phy", @"tnt", @"ape", @"ALN", @"HEN", @"FST", @"MSF", @"NXS", @"NON", @"PHY", @"TNT", @"APE", @"exdna", NSFileTypeForHFSTypeCode('TEXT'), NSFileTypeForHFSTypeCode('TXT '), NSFileTypeForHFSTypeCode('text'), NSFileTypeForHFSTypeCode('xDNA'), NSFileTypeForHFSTypeCode('DNA '), NSFileTypeForHFSTypeCode('GCKc'), NSFileTypeForHFSTypeCode('GCKs'), NSFileTypeForHFSTypeCode('NUCL'), nil]; And here is the modified readFile method thus far (so except for the binary fixes and the unnecessary raw fix): - (NSDictionary *)readFile:(NSString *)textFile { NSMutableDictionary *theContents; NSString *lineBreak; // BINARY // Strider? if([NSHFSTypeOfFile(textFile) isEqualToString: @"'xDNA'"]){ theContents = (NSMutableDictionary*) [self readStriderFile:textFile]; // GCK? }else if([NSHFSTypeOfFile(textFile) isEqualToString: @"'GCKc'"] || [NSHFSTypeOfFile(textFile) isEqualToString: @"'GCKs'"]){ theContents = (NSMutableDictionary*) [self readGCKFile:textFile]; // TEXT }else { NSMutableString *sequenceFile; // EXDNA if([[textFile pathExtension]isEqualToString:@"exdna"]) sequenceFile = [NSMutableString stringWithContentsOfFile: [textFile stringByAppendingPathComponent: @"sequence.txt"]]; else sequenceFile = [NSMutableString stringWithContentsOfFile:textFile]; lineBreak = [self detectLineBreak:sequenceFile]; //RTF? if ([sequenceFile hasCaseInsensitivePrefix: @"{\\rtf1"]) { NSAttributedString *rtfstring = [[NSAttributedString alloc] initWithRTF: [NSData dataWithContentsOfFile: textFile] documentAttributes: nil]; [sequenceFile setString: [rtfstring string]]; [rtfstring release]; } //DETERMINE TYPE if ([sequenceFile hasCaseInsensitivePrefix:@"#NEXUS"] || [textFile hasCaseInsensitivePrefix:@"#PAUP"]) { theContents = (NSMutableDictionary*) [self readNexusFileAndBlocks:sequenceFile]; } else if ([sequenceFile hasCaseInsensitivePrefix:@"CLUSTAL"]) { theContents = (NSMutableDictionary*) [self readClustalFile:sequenceFile]; } else if ([sequenceFile hasCaseInsensitivePrefix:@"Pileup"]) { theContents = (NSMutableDictionary*) [self readMSFFile:sequenceFile]; } else if ([sequenceFile hasCaseInsensitivePrefix:@">DL"]) { theContents = (NSMutableDictionary*) [self readPirFile:sequenceFile]; } else if ([sequenceFile hasPrefix:@">"]) { theContents = (NSMutableDictionary*) [self readFastaFile:sequenceFile]; } else if ([sequenceFile hasPrefix:@"HEADER"]) { theContents = (NSMutableDictionary*) [self readPDBFile:sequenceFile]; } else if ([sequenceFile hasPrefix:@"LOCUS"]) { theContents = (NSMutableDictionary*) [self readNCBIFile:sequenceFile]; } else if ([sequenceFile stringContains:@"proc/"]) { theContents = (NSMutableDictionary*) [self readNonaFile:sequenceFile]; } else if ([sequenceFile stringContains:@"xread"]) { theContents = (NSMutableDictionary*) [self readHennigFile:sequenceFile]; } else if ([sequenceFile hasPrefix:@"#"]) { theContents = (NSMutableDictionary*) [self readGDEFile:sequenceFile]; } else if ([sequenceFile hasPrefix:@"ID"]) // also works for EMBL files, both have the same prefix in the first line { theContents = (NSMutableDictionary*) [self readSwissProtFile:sequenceFile]; } else if ([sequenceFile stringBeginsWithTwoNumbers]) { theContents = (NSMutableDictionary*) [self readPhylipFile:sequenceFile]; } else { theContents = (NSMutableDictionary*) [self readRawFile:sequenceFile]; // Assume sequences are in Plain format } [theContents setObject:lineBreak forKey:@"lineBreak"]; } return theContents; } Those who pay attention see another format I would like to see supported ;-) Cheers, Alex On 11-apr-2006, at 12:39, Koen van der Drift wrote: > > On Apr 11, 2006, at 6:17 AM, Alexander Griekspoor wrote: > >> Please don't sue me! I just copied what Peter wrote, anything you >> will try to get from me in court, I will redeem from him ;-) >> > > Sounds like a good plan :D > > - Koen. > ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com Windows is a 32-bit patch to a 16-bit shell for an 8-bit operating system, written for a 4-bit processor by a 2- bit company without 1 bit of sense. ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From peter.schols at bio.kuleuven.be Tue Apr 11 08:58:43 2006 From: peter.schols at bio.kuleuven.be (Peter Schols) Date: Tue, 11 Apr 2006 14:58:43 +0200 Subject: [Biococoa-dev] More on sequence formats In-Reply-To: <5B9BF2B3-9FD5-4A6F-8A64-3349D6721E8D@earthlink.net> References: <5B9BF2B3-9FD5-4A6F-8A64-3349D6721E8D@earthlink.net> Message-ID: <9E192165-2EFD-41A2-9DCF-8B2E86BD02C7@bio.kuleuven.be> Hi guys, We have been victim of a burglary on Sunday (quite ironically), so apologies for the delay in getting back. Congratulations to Koen, I have had a look at the latest rev. and it's looking very good already! I'll try to answer your questions, although it has been almost 3 years since l wrote most of the I/O code. > 1. What's the difference between Nexus and Nexusfileandblocks ? The Nexus method only returns the 'taxa' (= names) and the sequences themselves. Because the Nexus format has a very rich vocabulary (organized in blocks), there is also the Nexusfileandblocks method that not only returns the above information but also returns a list of the blocks. These blocks are simply returned as strings (exactly as they are found in the file format). This should enable other developers to look for specific blocks and handle them appropriately. > 2. How is the nona format defined, I couldn't find anything about > this? Tough answer because there is no real definition. The nona format (much like the TNT format) sometimes starts with proc/ although this is not always the case. > 3. The MSF file now uses the string "Pileup" as a selector. > However, when searching for the format definition, I found that > this format uses a '!!NA' or '!!AA' instead. But I may have found > the wrong info, so if anyone knows which is correct, please let me > know. That's right, '!!NA' or '!!AA' are indeed the format identifiers. See also: http://www.compbio.ox.ac.uk/faq/format_examples.shtml So it would be better to replace the Pileup check as I have implemented with the '!!NA' or '!!AA' checks indeed. > 4. I am thinking about adding a plist file to the framework that > contains all the file extensions of possible sequence files. This > can then be used in openPanel (see the code that Alex supplied). > The nice thing about this is, is that we can synchronize the > entries with the methods in BCSequenceReader. Any reason I should > not do this? Great idea. Although it should complement - and not replace - the format checks in the files themselves, at least for the text based files. Not all files use (the correct) extensions. > For those who feel like helping out, the way to implement the code is: > > - remove white lines (optional) > - get each line > - extract annotations into a BCAnnotationsArray > - extract the sequence(s) into an NSString > - once done with all the sequences, create a BCSequence from each > sequenceString > - add the annotations to each BCSequence > - add the new BCSequence(s) to the BCSequenceArray > - return the BCSequenceArray I would love to help out when I'm done with the insurance forms and other paperwork... Peter Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm From peter.schols at bio.kuleuven.be Tue Apr 11 09:08:40 2006 From: peter.schols at bio.kuleuven.be (Peter Schols) Date: Tue, 11 Apr 2006 15:08:40 +0200 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: <42E81331-EABE-47ED-ACD6-B57EF899C2B5@nki.nl> References: <42E81331-EABE-47ED-ACD6-B57EF899C2B5@nki.nl> Message-ID: ReadSeq could be a good example indeed. I guess we have most of them, except for IG, NBRF, Fitch, Zuker, Olsen, ASN.1. We do have Clustal, Nona, TNT, Hennig, PDB however ;-) (PAUP == Nexus). Peter > Finally, to come back to the question on the formats, perhaps we > can learn from a classic sequence reader package called ReadSeq by > d.g.gilbert. > It reads the following formats, which are outlined in the Formats > textfile inside the src folder: > 1. IG/Stanford 10. Olsen (in-only) > 2. GenBank/GB 11. Phylip3.2 > 3. NBRF 12. Phylip > 4. EMBL 13. Plain/Raw > 5. GCG 14. PIR/CODATA > 6. DNAStrider 15. MSF > 7. Fitch 16. ASN.1 > 8. Pearson/Fasta 17. PAUP > 9. Zuker (in-only) 18. Pretty (out-only) > > Some of them we support, but some not, so we can even add a few > formats, plus the source code nicely shows how to discriminate them. > The latest version switched from c to java and added even a few > more formats, so there's plenty to add ;-) The source also contains > many sample files for testing purposes. > I'm not sure where it can be found nowadays, so I put it > temporarily on our server for you guys to download: > http://www.mekentosj.com/temporary/readseq.zip > Have a look at it and tell me what you think. > Cheers, > Alex > > >> For those who feel like helping out, the way to implement the code >> is: >> >> - remove white lines (optional) >> - get each line >> - extract annotations into a BCAnnotationsArray >> - extract the sequence(s) into an NSString >> - once done with all the sequences, create a BCSequence from each >> sequenceString >> - add the annotations to each BCSequence >> - add the new BCSequence(s) to the BCSequenceArray >> - return the BCSequenceArray >> >> >> cheers, >> >> - Koen. >> _______________________________________________ >> Biococoa-dev mailing list >> Biococoa-dev at bioinformatics.org >> https://bioinformatics.org/mailman/listinfo/biococoa-dev >> > > ************************************************************** > ** Alexander Griekspoor ** > ************************************************************** > The Netherlands Cancer Institute > Department of Tumorbiology (H4) > Plesmanlaan 121, 1066 CX, Amsterdam > Tel: + 31 20 - 512 2023 > Fax: + 31 20 - 512 2029 > AIM: mekentosj at mac.com > E-mail: a.griekspoor at nki.nl > Web: http://www.mekentosj.com > > MacOS X: The power of UNIX with the simplicity of the Mac > > *************************************************************** > > > ********************************************************* > ** Alexander Griekspoor ** > ********************************************************* > The Netherlands Cancer Institute > Department of Tumorbiology (H4) > Plesmanlaan 121, 1066 CX, Amsterdam > Tel: + 31 20 - 512 2023 > Fax: + 31 20 - 512 2029 > AIM: mekentosj at mac.com > E-mail: a.griekspoor at nki.nl > Web: http://www.mekentosj.com > > iRNAi, do you? > http://www.mekentosj.com/irnai > > ********************************************************* > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm From a.griekspoor at nki.nl Tue Apr 11 09:11:17 2006 From: a.griekspoor at nki.nl (a.griekspoor at nki.nl) Date: Tue, 11 Apr 2006 15:11:17 +0200 Subject: [Biococoa-dev] Even more on sequence formats Message-ID: <667464FDA2C81D4CA79D7F3B728D10E75A86A3@adsrv100.nki.nl> See Koen, there's the TNT already ;-) Peter any change the beast is also in there, that would alleviate you from any claims coming from Koen.. Cheers, Alex Ps. Peter good luck dealing with the burglary, sorry to hear that. -----Original Message----- From: Peter Schols [mailto:peter.schols at bio.kuleuven.be] Sent: Tue 4/11/2006 3:08 PM To: Alexander Griekspoor Cc: biococoa-dev at bioinformatics.org Subject: Re: [Biococoa-dev] Even more on sequence formats ReadSeq could be a good example indeed. I guess we have most of them, except for IG, NBRF, Fitch, Zuker, Olsen, ASN.1. We do have Clustal, Nona, TNT, Hennig, PDB however ;-) (PAUP == Nexus). Peter > Finally, to come back to the question on the formats, perhaps we > can learn from a classic sequence reader package called ReadSeq by > d.g.gilbert. > It reads the following formats, which are outlined in the Formats > textfile inside the src folder: > 1. IG/Stanford 10. Olsen (in-only) > 2. GenBank/GB 11. Phylip3.2 > 3. NBRF 12. Phylip > 4. EMBL 13. Plain/Raw > 5. GCG 14. PIR/CODATA > 6. DNAStrider 15. MSF > 7. Fitch 16. ASN.1 > 8. Pearson/Fasta 17. PAUP > 9. Zuker (in-only) 18. Pretty (out-only) > > Some of them we support, but some not, so we can even add a few > formats, plus the source code nicely shows how to discriminate them. > The latest version switched from c to java and added even a few > more formats, so there's plenty to add ;-) The source also contains > many sample files for testing purposes. > I'm not sure where it can be found nowadays, so I put it > temporarily on our server for you guys to download: > http://www.mekentosj.com/temporary/readseq.zip > Have a look at it and tell me what you think. > Cheers, > Alex > > >> For those who feel like helping out, the way to implement the code >> is: >> >> - remove white lines (optional) >> - get each line >> - extract annotations into a BCAnnotationsArray >> - extract the sequence(s) into an NSString >> - once done with all the sequences, create a BCSequence from each >> sequenceString >> - add the annotations to each BCSequence >> - add the new BCSequence(s) to the BCSequenceArray >> - return the BCSequenceArray >> >> >> cheers, >> >> - Koen. >> _______________________________________________ >> Biococoa-dev mailing list >> Biococoa-dev at bioinformatics.org >> https://bioinformatics.org/mailman/listinfo/biococoa-dev >> > > ************************************************************** > ** Alexander Griekspoor ** > ************************************************************** > The Netherlands Cancer Institute > Department of Tumorbiology (H4) > Plesmanlaan 121, 1066 CX, Amsterdam > Tel: + 31 20 - 512 2023 > Fax: + 31 20 - 512 2029 > AIM: mekentosj at mac.com > E-mail: a.griekspoor at nki.nl > Web: http://www.mekentosj.com > > MacOS X: The power of UNIX with the simplicity of the Mac > > *************************************************************** > > > ********************************************************* > ** Alexander Griekspoor ** > ********************************************************* > The Netherlands Cancer Institute > Department of Tumorbiology (H4) > Plesmanlaan 121, 1066 CX, Amsterdam > Tel: + 31 20 - 512 2023 > Fax: + 31 20 - 512 2029 > AIM: mekentosj at mac.com > E-mail: a.griekspoor at nki.nl > Web: http://www.mekentosj.com > > iRNAi, do you? > http://www.mekentosj.com/irnai > > ********************************************************* > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm From peter.schols at bio.kuleuven.be Tue Apr 11 09:45:13 2006 From: peter.schols at bio.kuleuven.be (Peter Schols) Date: Tue, 11 Apr 2006 15:45:13 +0200 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: References: <5B9BF2B3-9FD5-4A6F-8A64-3349D6721E8D@earthlink.net> Message-ID: <31588875-26B4-4938-B272-A3840BFB8DEC@bio.kuleuven.be> >> - I've added support for reading sequence files that weren't saved >> as plain-text but as rtf, basically adding a check and converting >> the file to plain text before continuing with the normal format >> determination > > That would be great addition. Agreed!!! > BCSequenceReader now works very different from the way BCReader > does. I am not using a matrixDictionary anymore (see my comments in > the previous mail, and the actual code). The current > BCSequenceReader already reads a raw file in as one whole. > > BTW, be careful with what you put in your README for EnzymeX. I > noticed you wrote that it supports BEAST and TNT formats, but I > don't see those in BCReader. Unless you have a local version that > does, of course ;-) I'll have a look at the readseq code later. Maybe Alex got confused when reading our website: the BioCocoa site mentions these formats indeed, but keep in mind that this description still only applies to the GNUStep compatible version I created for a paper (which has become the 1.6). Please also note that the support for the Beast format is write-only (no reading) as is also mentioned on the BioCocoa website. Conclusion: I'm in no way liable for any financial claims from Mekentosj or their respective customers, I'm just a poor developer ;-))) (and getting poorer...) Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm From peter.schols at bio.kuleuven.be Tue Apr 11 09:45:37 2006 From: peter.schols at bio.kuleuven.be (Peter Schols) Date: Tue, 11 Apr 2006 15:45:37 +0200 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: <2FB99B57-87E8-41A3-B098-349884426AE1@mekentosj.com> References: <5B9BF2B3-9FD5-4A6F-8A64-3349D6721E8D@earthlink.net> <2FB99B57-87E8-41A3-B098-349884426AE1@mekentosj.com> Message-ID: <0BC3CCC9-E52C-47A8-B8AB-45A859E34FFF@bio.kuleuven.be> I think it's time to add a disclaimer to the BioCocoa website ;-) On 11 Apr 2006, at 12:17, Alexander Griekspoor wrote: >> BTW, be careful with what you put in your README for EnzymeX. I >> noticed you wrote that it supports BEAST and TNT formats, but I >> don't see those in BCReader. Unless you have a local version that >> does, of course ;-) I'll have a look at the readseq code later. > > Please don't sue me! I just copied what Peter wrote, anything you > will try to get from me in court, I will redeem from him ;-) > Cheers, > Alex > > ********************************************************* > ** Alexander Griekspoor ** > ********************************************************* > The Netherlands Cancer Institute > Department of Tumorbiology (H4) > Plesmanlaan 121, 1066 CX, Amsterdam > Tel: + 31 20 - 512 2023 > Fax: + 31 20 - 512 2029 > AIM: mekentosj at mac.com > E-mail: a.griekspoor at nki.nl > Web: http://www.mekentosj.com > > Windows vs Mac > 65 million years ago, there were more > dinosaurs than humans. > Where are the dinosaurs now? > > ********************************************************* > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm From mek at mekentosj.com Tue Apr 11 09:49:01 2006 From: mek at mekentosj.com (Alexander Griekspoor) Date: Tue, 11 Apr 2006 15:49:01 +0200 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: <31588875-26B4-4938-B272-A3840BFB8DEC@bio.kuleuven.be> References: <5B9BF2B3-9FD5-4A6F-8A64-3349D6721E8D@earthlink.net> <31588875-26B4-4938-B272-A3840BFB8DEC@bio.kuleuven.be> Message-ID: hmm, who is poor now huh, after Koen sends his men in black and I can't forward them to you because I'm a poor reader of your website... ;-( Cheers ;-) Alex On 11-apr-2006, at 15:45, Peter Schols wrote: >>> - I've added support for reading sequence files that weren't >>> saved as plain-text but as rtf, basically adding a check and >>> converting the file to plain text before continuing with the >>> normal format determination >> >> That would be great addition. > > Agreed!!! > > >> BCSequenceReader now works very different from the way BCReader >> does. I am not using a matrixDictionary anymore (see my comments >> in the previous mail, and the actual code). The current >> BCSequenceReader already reads a raw file in as one whole. >> >> BTW, be careful with what you put in your README for EnzymeX. I >> noticed you wrote that it supports BEAST and TNT formats, but I >> don't see those in BCReader. Unless you have a local version that >> does, of course ;-) I'll have a look at the readseq code later. > > Maybe Alex got confused when reading our website: the BioCocoa site > mentions these formats indeed, but keep in mind that this > description still only applies to the GNUStep compatible version I > created for a paper (which has become the 1.6). Please also note > that the support for the Beast format is write-only (no reading) as > is also mentioned on the BioCocoa website. > > Conclusion: I'm in no way liable for any financial claims from > Mekentosj or their respective customers, I'm just a poor > developer ;-))) > (and getting poorer...) > > Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com The requirements said: Windows 2000 or better. So I got a Macintosh. ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From mek at mekentosj.com Tue Apr 11 09:51:04 2006 From: mek at mekentosj.com (Alexander Griekspoor) Date: Tue, 11 Apr 2006 15:51:04 +0200 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: <0BC3CCC9-E52C-47A8-B8AB-45A859E34FFF@bio.kuleuven.be> References: <5B9BF2B3-9FD5-4A6F-8A64-3349D6721E8D@earthlink.net> <2FB99B57-87E8-41A3-B098-349884426AE1@mekentosj.com> <0BC3CCC9-E52C-47A8-B8AB-45A859E34FFF@bio.kuleuven.be> Message-ID: Like the one I have in the read me file of EnzymeX: Disclaimer: Distribution of EnzymeX is allowed and encouraged, but only as a complete package (including the read-me files). Use and enjoy EnzymeX at your own risk. The authors can never be kept responsible for any possible damage, waste of time or materials, resulting from the use of EnzymeX or wrong information provided by EnzymeX. and the one Koen agreed to when he opened the EnzymeX disk image ;-) Well enough already.. Cheers, Alex On 11-apr-2006, at 15:45, Peter Schols wrote: > I think it's time to add a disclaimer to the BioCocoa website ;-) > > On 11 Apr 2006, at 12:17, Alexander Griekspoor wrote: > >>> BTW, be careful with what you put in your README for EnzymeX. I >>> noticed you wrote that it supports BEAST and TNT formats, but I >>> don't see those in BCReader. Unless you have a local version >>> that does, of course ;-) I'll have a look at the readseq code >>> later. >> >> Please don't sue me! I just copied what Peter wrote, anything you >> will try to get from me in court, I will redeem from him ;-) >> Cheers, >> Alex >> >> ********************************************************* >> ** Alexander Griekspoor ** >> ********************************************************* >> The Netherlands Cancer Institute >> Department of Tumorbiology (H4) >> Plesmanlaan 121, 1066 CX, Amsterdam >> Tel: + 31 20 - 512 2023 >> Fax: + 31 20 - 512 2029 >> AIM: mekentosj at mac.com >> E-mail: a.griekspoor at nki.nl >> Web: http://www.mekentosj.com >> >> Windows vs Mac >> 65 million years ago, there were more >> dinosaurs than humans. >> Where are the dinosaurs now? >> >> ********************************************************* >> >> _______________________________________________ >> Biococoa-dev mailing list >> Biococoa-dev at bioinformatics.org >> https://bioinformatics.org/mailman/listinfo/biococoa-dev > > > Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > *********************************** Mek (Alexander Griekspoor) MekenTosj.com Web: http://www.mekentosj.com Mail: mek at mekentosj.com *********************************** -------------- next part -------------- An HTML attachment was scrubbed... URL: From peter.schols at bio.kuleuven.be Tue Apr 11 09:51:55 2006 From: peter.schols at bio.kuleuven.be (Peter Schols) Date: Tue, 11 Apr 2006 15:51:55 +0200 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: <667464FDA2C81D4CA79D7F3B728D10E75A86A3@adsrv100.nki.nl> References: <667464FDA2C81D4CA79D7F3B728D10E75A86A3@adsrv100.nki.nl> Message-ID: <84D6F60C-9344-4E82-85DE-D8D2CE8FF91A@bio.kuleuven.be> > See Koen, there's the TNT already ;-) > Peter any change the beast is also in there, that would alleviate > you from any claims coming from Koen.. Beast (an XML based format) is only supported by BCCreator right now.... see: - (NSString *)createBeastFile:(NSDictionary *)matrix > Ps. Peter good luck dealing with the burglary, sorry to hear that. Thanks! Peter Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm From peter.schols at bio.kuleuven.be Tue Apr 11 09:56:51 2006 From: peter.schols at bio.kuleuven.be (Peter Schols) Date: Tue, 11 Apr 2006 15:56:51 +0200 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: References: <5B9BF2B3-9FD5-4A6F-8A64-3349D6721E8D@earthlink.net> <31588875-26B4-4938-B272-A3840BFB8DEC@bio.kuleuven.be> Message-ID: <96CF6685-F3C3-4B6D-AA25-8F3EA0C95179@bio.kuleuven.be> C'mon Alex, we all know you'll never have to work again (or write any line of code) once you start selling EnzymeX and 4Peaks ;-) On 11 Apr 2006, at 15:49, Alexander Griekspoor wrote: > hmm, who is poor now huh, after Koen sends his men in black and I > can't forward them to you because I'm a poor reader of your > website... ;-( > Cheers ;-) > Alex > > On 11-apr-2006, at 15:45, Peter Schols wrote: > >>>> - I've added support for reading sequence files that weren't >>>> saved as plain-text but as rtf, basically adding a check and >>>> converting the file to plain text before continuing with the >>>> normal format determination >>> >>> That would be great addition. >> >> Agreed!!! >> >> >>> BCSequenceReader now works very different from the way BCReader >>> does. I am not using a matrixDictionary anymore (see my comments >>> in the previous mail, and the actual code). The current >>> BCSequenceReader already reads a raw file in as one whole. >>> >>> BTW, be careful with what you put in your README for EnzymeX. I >>> noticed you wrote that it supports BEAST and TNT formats, but I >>> don't see those in BCReader. Unless you have a local version >>> that does, of course ;-) I'll have a look at the readseq code >>> later. >> >> Maybe Alex got confused when reading our website: the BioCocoa >> site mentions these formats indeed, but keep in mind that this >> description still only applies to the GNUStep compatible version I >> created for a paper (which has become the 1.6). Please also note >> that the support for the Beast format is write-only (no reading) >> as is also mentioned on the BioCocoa website. >> >> Conclusion: I'm in no way liable for any financial claims from >> Mekentosj or their respective customers, I'm just a poor >> developer ;-))) >> (and getting poorer...) >> >> Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm >> >> _______________________________________________ >> Biococoa-dev mailing list >> Biococoa-dev at bioinformatics.org >> https://bioinformatics.org/mailman/listinfo/biococoa-dev >> > > ********************************************************* > ** Alexander Griekspoor ** > ********************************************************* > The Netherlands Cancer Institute > Department of Tumorbiology (H4) > Plesmanlaan 121, 1066 CX, Amsterdam > Tel: + 31 20 - 512 2023 > Fax: + 31 20 - 512 2029 > AIM: mekentosj at mac.com > E-mail: a.griekspoor at nki.nl > Web: http://www.mekentosj.com > > The requirements said: Windows 2000 or better. > So I got a Macintosh. > > ********************************************************* > Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm From charles.parnot at gmail.com Tue Apr 11 13:04:08 2006 From: charles.parnot at gmail.com (Charles Parnot) Date: Tue, 11 Apr 2006 10:04:08 -0700 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: <42E81331-EABE-47ED-ACD6-B57EF899C2B5@nki.nl> References: <42E81331-EABE-47ED-ACD6-B57EF899C2B5@nki.nl> Message-ID: Just a quick email to remind you guys that BioCocoa should support all formats, even the most obscure, and this is why it should also be able to read "exdna" files. I don't know if you heard of that format? charles -- Xgrid-at-Stanford Help science move fast forward: http://cmgm.stanford.edu/~cparnot/xgrid-stanford Charles Parnot charles.parnot at gmail.com From kvddrift at earthlink.net Tue Apr 11 18:09:47 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Tue, 11 Apr 2006 18:09:47 -0400 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: References: <42E81331-EABE-47ED-ACD6-B57EF899C2B5@nki.nl> Message-ID: On Apr 11, 2006, at 1:04 PM, Charles Parnot wrote: > Just a quick email to remind you guys that BioCocoa should support > all formats, even the most obscure, and this is why it should also > be able to read "exdna" files. I don't know if you heard of that > format? Can you point me to a site where that format is explained? Alex already provided some code to deal with such files, but I couldn't find any format info. thanks, - Koen. From kvddrift at earthlink.net Tue Apr 11 18:08:37 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Tue, 11 Apr 2006 18:08:37 -0400 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: References: <5B9BF2B3-9FD5-4A6F-8A64-3349D6721E8D@earthlink.net> <2FB99B57-87E8-41A3-B098-349884426AE1@mekentosj.com> <0BC3CCC9-E52C-47A8-B8AB-45A859E34FFF@bio.kuleuven.be> Message-ID: <86C46F8D-D530-4A81-BCBF-3A10D610D05A@earthlink.net> On Apr 11, 2006, at 9:51 AM, Alexander Griekspoor wrote: > Like the one I have in the read me file of EnzymeX: > > Disclaimer: > Distribution of EnzymeX is allowed and encouraged, but > only as a complete package (including the read-me files). Use and > enjoy EnzymeX at your own risk. The authors can never be kept > responsible for any possible damage, waste of time or materials, > resulting from the use of EnzymeX or wrong information provided by > EnzymeX. > > and the one Koen agreed to when he opened the EnzymeX disk image ;-) > I don't use EnzymeX ;-) - Koen. From kvddrift at earthlink.net Tue Apr 11 18:14:36 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Tue, 11 Apr 2006 18:14:36 -0400 Subject: [Biococoa-dev] wiki page Message-ID: <5A25239D-AD2E-4402-80BE-8E9EF9298F77@earthlink.net> Hi, Check out the wiki page, it's starting to look like something. Feel free to add some more stuff ;-) http://bioinformatics.org/biococoa/wiki/ cheers, - Koen. From a.griekspoor at nki.nl Tue Apr 11 18:19:48 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Wed, 12 Apr 2006 00:19:48 +0200 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: References: <42E81331-EABE-47ED-ACD6-B57EF899C2B5@nki.nl> Message-ID: <92C3BA7E-C74B-4AA3-B150-014895302858@nki.nl> Hi Koen, The format is explained in detail on this page I happened to encounter: http://www.mekentosj.com/enzymex I copied the relevant part below: Another sequence format? Not really. The files EnzymeX creates look like normal files, but right-click and open their contents and you will see that they consist of a simple FASTA file and a file in which EnzymeX stores its preferences. Send a file to someone who doesn't have EnzymeX or to a Windows user and they will simply see a folder with a FASTA file. No problem! If you have any questions about the exDNA file "format", don't hesitate to contact us. Hope that helps.. Cheers, Alex Ps. The binary file reading is being tested on an intel based mac as we speak, turned out that I had it done already but mixed up Big (PPC) and Little (Endian) in my first attempt to fix the problem yesterday... On 12-apr-2006, at 0:09, Koen van der Drift wrote: > > On Apr 11, 2006, at 1:04 PM, Charles Parnot wrote: > >> Just a quick email to remind you guys that BioCocoa should support >> all formats, even the most obscure, and this is why it should also >> be able to read "exdna" files. I don't know if you heard of that >> format? > > Can you point me to a site where that format is explained? Alex > already provided some code to deal with such files, but I couldn't > find any format info. > > thanks, > > - Koen. > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com 4Peaks - For Peaks, Four Peaks. 2004 Winner of the Apple Design Awards Best Mac OS X Student Product http://www.mekentosj.com/4peaks ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From kvddrift at earthlink.net Tue Apr 11 18:27:29 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Tue, 11 Apr 2006 18:27:29 -0400 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: <92C3BA7E-C74B-4AA3-B150-014895302858@nki.nl> References: <42E81331-EABE-47ED-ACD6-B57EF899C2B5@nki.nl> <92C3BA7E-C74B-4AA3-B150-014895302858@nki.nl> Message-ID: <459FEA70-0B1A-4073-A7B3-EF3EF037DB8B@earthlink.net> On Apr 11, 2006, at 6:19 PM, Alexander Griekspoor wrote: > Hi Koen, > > The format is explained in detail on this page I happened to > encounter: http://www.mekentosj.com/enzymex > I copied the relevant part below: > > Another sequence format? > Not really. The files EnzymeX creates look like normal files, but > right-click and open their contents and you will see that they > consist of a simple FASTA file and a file in which EnzymeX stores > its preferences. Send a file to someone who doesn't have EnzymeX or > to a Windows user and they will simply see a folder with a FASTA > file. No problem! If you have any questions about the exDNA file > "format", don't hesitate to contact us. Hehehehehe :) - Koen. From kvddrift at earthlink.net Tue Apr 11 18:49:21 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Tue, 11 Apr 2006 18:49:21 -0400 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: <92C3BA7E-C74B-4AA3-B150-014895302858@nki.nl> References: <42E81331-EABE-47ED-ACD6-B57EF899C2B5@nki.nl> <92C3BA7E-C74B-4AA3-B150-014895302858@nki.nl> Message-ID: <3F73119B-0CA8-4CAE-A26F-77F007A8863F@earthlink.net> On Apr 11, 2006, at 6:19 PM, Alexander Griekspoor wrote: > Another sequence format? > Not really. The files EnzymeX creates look like normal files, but > right-click and open their contents and you will see that they > consist of a simple FASTA file and a file in which EnzymeX stores > its preferences. Send a file to someone who doesn't have EnzymeX or > to a Windows user and they will simply see a folder with a FASTA > file. No problem! If you have any questions about the exDNA file > "format", don't hesitate to contact us. > Now added to the framework, as well as the Entrez demo that is also in the repository. - Koen. From charles.parnot at gmail.com Tue Apr 11 19:02:31 2006 From: charles.parnot at gmail.com (Charles Parnot) Date: Tue, 11 Apr 2006 16:02:31 -0700 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: <459FEA70-0B1A-4073-A7B3-EF3EF037DB8B@earthlink.net> References: <42E81331-EABE-47ED-ACD6-B57EF899C2B5@nki.nl> <92C3BA7E-C74B-4AA3-B150-014895302858@nki.nl> <459FEA70-0B1A-4073-A7B3-EF3EF037DB8B@earthlink.net> Message-ID: I got you on this one, Koen :-) btw, great work. I see all these entries in the BioCocoa svn RSS feed in NetNewsWire, and I am amazed! charles > On Apr 11, 2006, at 6:19 PM, Alexander Griekspoor wrote: > >> Hi Koen, >> >> The format is explained in detail on this page I happened to >> encounter: http://www.mekentosj.com/enzymex >> I copied the relevant part below: >> >> Another sequence format? >> Not really. The files EnzymeX creates look like normal files, but >> right-click and open their contents and you will see that they >> consist of a simple FASTA file and a file in which EnzymeX stores >> its preferences. Send a file to someone who doesn't have EnzymeX >> or to a Windows user and they will simply see a folder with a >> FASTA file. No problem! If you have any questions about the exDNA >> file "format", don't hesitate to contact us. > > > Hehehehehe :) > > - Koen. -- Xgrid-at-Stanford Help science move fast forward: http://cmgm.stanford.edu/~cparnot/xgrid-stanford Charles Parnot charles.parnot at gmail.com From kvddrift at earthlink.net Tue Apr 11 19:27:05 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Tue, 11 Apr 2006 19:27:05 -0400 Subject: [Biococoa-dev] question about icons Message-ID: <3323F16F-1265-43E4-9145-1511D8E13FD0@earthlink.net> Hi, I used the BC.icns file that is in the project to create a .png file using Iconographer. This png file is now visible in the wiki page, however, it has a dark background, and looks rather ugly. Could anyone make a copy of the icon without that background, and also maybe a bit smaller? Or even better would be a logo that has the word 'BioCocoa' in it ;-) thanks, - Koen. From a.griekspoor at nki.nl Wed Apr 12 02:45:50 2006 From: a.griekspoor at nki.nl (a.griekspoor at nki.nl) Date: Wed, 12 Apr 2006 08:45:50 +0200 Subject: [Biococoa-dev] Even more on sequence formats Message-ID: <667464FDA2C81D4CA79D7F3B728D10E75A86A8@adsrv100.nki.nl> Hi Charles, What is the rss url you use to monitor the svn? Alex -----Original Message----- From: Charles Parnot [mailto:charles.parnot at gmail.com] Sent: Wed 4/12/2006 1:02 AM To: Koen van der Drift Cc: Alexander Griekspoor; BioCocoa Mailinglist Subject: Re: [Biococoa-dev] Even more on sequence formats I got you on this one, Koen :-) btw, great work. I see all these entries in the BioCocoa svn RSS feed in NetNewsWire, and I am amazed! charles > On Apr 11, 2006, at 6:19 PM, Alexander Griekspoor wrote: > >> Hi Koen, >> >> The format is explained in detail on this page I happened to >> encounter: http://www.mekentosj.com/enzymex >> I copied the relevant part below: >> >> Another sequence format? >> Not really. The files EnzymeX creates look like normal files, but >> right-click and open their contents and you will see that they >> consist of a simple FASTA file and a file in which EnzymeX stores >> its preferences. Send a file to someone who doesn't have EnzymeX >> or to a Windows user and they will simply see a folder with a >> FASTA file. No problem! If you have any questions about the exDNA >> file "format", don't hesitate to contact us. > > > Hehehehehe :) > > - Koen. -- Xgrid-at-Stanford Help science move fast forward: http://cmgm.stanford.edu/~cparnot/xgrid-stanford Charles Parnot charles.parnot at gmail.com From a.griekspoor at nki.nl Wed Apr 12 03:54:22 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Wed, 12 Apr 2006 09:54:22 +0200 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: References: <42E81331-EABE-47ED-ACD6-B57EF899C2B5@nki.nl> <92C3BA7E-C74B-4AA3-B150-014895302858@nki.nl> <459FEA70-0B1A-4073-A7B3-EF3EF037DB8B@earthlink.net> Message-ID: Thanks Koen, an important file format added -cough-! On a more relevant note, the binary file format reading now works on intel as well, here are the update methods: - (NSDictionary *)readStriderFile:(NSString *)textFile{ /* Binary file format, read in header, determine features and sequence -> create dictionary. */ STRIDER_HEADER *signature; NSMutableDictionary *matrixDictionary = [NSMutableDictionary dictionary]; NSMutableDictionary *striderDictionary = [NSMutableDictionary dictionary]; NSMutableArray *itemArray = [NSMutableArray arrayWithCapacity:10]; NSData *data = [NSData dataWithContentsOfFile: textFile]; // Memory alloc and read in struct signature = malloc(sizeof(STRIDER_HEADER)); [data getBytes: signature length: sizeof(STRIDER_HEADER)]; // Sequence NSData *seqdata = [data subdataWithRange: NSMakeRange(sizeof (STRIDER_HEADER), CFSwapInt32BigToHost(signature->nLength))]; NSString *sequence = [[NSString alloc] initWithBytes: [seqdata bytes] length: [seqdata length] encoding: NSASCIIStringEncoding]; NSString *filename = [[textFile lastPathComponent] stringByDeletingPathExtension]; [matrixDictionary setObject:sequence forKey:filename]; [itemArray addObject: filename]; [sequence release]; // Comments if(signature->com_length > 0){ NSData *comdata = [data subdataWithRange: NSMakeRange([data length] - CFSwapInt32BigToHost(signature->com_length), CFSwapInt32BigToHost(signature->com_length))]; NSString *comments = [[NSString alloc] initWithBytes: [comdata bytes] length: [comdata length] encoding: NSASCIIStringEncoding]; [striderDictionary setObject:comments forKey:@"comments"]; [comments release]; } [striderDictionary setObject:matrixDictionary forKey:@"matrix"]; [striderDictionary setObject:itemArray forKey:@"items"]; [striderDictionary setObject:@"DNAStrider" forKey:@"fileType"]; // Clean up free(signature); return striderDictionary; } - (NSDictionary *)readGCKFile:(NSString *)textFile{ /* Binary file format, read in header, determine features and sequence -> create dictionary. Same as DNA strider but comments are ignored */ GCK_HEADER *signature; NSMutableDictionary *matrixDictionary = [NSMutableDictionary dictionary]; NSMutableDictionary *gckDictionary = [NSMutableDictionary dictionary]; NSMutableArray *itemArray = [NSMutableArray arrayWithCapacity:10]; NSData *data = [NSData dataWithContentsOfFile: textFile]; // Memory alloc and read in struct signature = malloc(sizeof(GCK_HEADER)); [data getBytes: signature length: sizeof(GCK_HEADER)]; // Sequence NSData *seqdata = [data subdataWithRange: NSMakeRange(sizeof (GCK_HEADER), CFSwapInt32BigToHost(signature->nLength))]; NSString *sequence = [[NSString alloc] initWithBytes: [seqdata bytes] length: [seqdata length] encoding: NSASCIIStringEncoding]; NSString *filename = [[textFile lastPathComponent] stringByDeletingPathExtension]; [matrixDictionary setObject:sequence forKey:filename]; [itemArray addObject: filename]; [sequence release]; [gckDictionary setObject:matrixDictionary forKey:@"matrix"]; [gckDictionary setObject:itemArray forKey:@"items"]; [gckDictionary setObject:@"Gene Construction Kit" forKey:@"fileType"]; // Clean up free(signature); return gckDictionary; } Cheers, Alex On 12-apr-2006, at 1:02, Charles Parnot wrote: > I got you on this one, Koen :-) > > btw, great work. I see all these entries in the BioCocoa svn RSS > feed in NetNewsWire, and I am amazed! > > charles > > >> On Apr 11, 2006, at 6:19 PM, Alexander Griekspoor wrote: >> >>> Hi Koen, >>> >>> The format is explained in detail on this page I happened to >>> encounter: http://www.mekentosj.com/enzymex >>> I copied the relevant part below: >>> >>> Another sequence format? >>> Not really. The files EnzymeX creates look like normal files, but >>> right-click and open their contents and you will see that they >>> consist of a simple FASTA file and a file in which EnzymeX stores >>> its preferences. Send a file to someone who doesn't have EnzymeX >>> or to a Windows user and they will simply see a folder with a >>> FASTA file. No problem! If you have any questions about the exDNA >>> file "format", don't hesitate to contact us. >> >> >> Hehehehehe :) >> >> - Koen. > > -- > Xgrid-at-Stanford > Help science move fast forward: > http://cmgm.stanford.edu/~cparnot/xgrid-stanford > > Charles Parnot > charles.parnot at gmail.com > > > > ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com Windows is a 32-bit patch to a 16-bit shell for an 8-bit operating system, written for a 4-bit processor by a 2- bit company without 1 bit of sense. ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From a.griekspoor at nki.nl Wed Apr 12 05:07:01 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Wed, 12 Apr 2006 11:07:01 +0200 Subject: [Biococoa-dev] Wiki Message-ID: <8D47D449-4F45-4E6C-B0CF-B1780108E367@nki.nl> If I have some time I'll hope to do what Drew and Charles also did on their wiki, post some archived, handy, email conversations on the wiki as reference. Cheers, Alex ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com 4Peaks - For Peaks, Four Peaks. 2004 Winner of the Apple Design Awards Best Mac OS X Student Product http://www.mekentosj.com/4peaks ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From a.griekspoor at nki.nl Wed Apr 12 05:21:50 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Wed, 12 Apr 2006 11:21:50 +0200 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: References: <42E81331-EABE-47ED-ACD6-B57EF899C2B5@nki.nl> <92C3BA7E-C74B-4AA3-B150-014895302858@nki.nl> <459FEA70-0B1A-4073-A7B3-EF3EF037DB8B@earthlink.net> Message-ID: I found the link already in Peter's email, sorry for that. To always remember I've copied the relevant emails to the wiki ;-) http://bioinformatics.org/biococoa/wiki/pmwiki.php?n=Main.SVNTutorial Cheers, Alex On 12-apr-2006, at 1:02, Charles Parnot wrote: > I got you on this one, Koen :-) > > btw, great work. I see all these entries in the BioCocoa svn RSS > feed in NetNewsWire, and I am amazed! > > charles > > >> On Apr 11, 2006, at 6:19 PM, Alexander Griekspoor wrote: >> >>> Hi Koen, >>> >>> The format is explained in detail on this page I happened to >>> encounter: http://www.mekentosj.com/enzymex >>> I copied the relevant part below: >>> >>> Another sequence format? >>> Not really. The files EnzymeX creates look like normal files, but >>> right-click and open their contents and you will see that they >>> consist of a simple FASTA file and a file in which EnzymeX stores >>> its preferences. Send a file to someone who doesn't have EnzymeX >>> or to a Windows user and they will simply see a folder with a >>> FASTA file. No problem! If you have any questions about the exDNA >>> file "format", don't hesitate to contact us. >> >> >> Hehehehehe :) >> >> - Koen. > > -- > Xgrid-at-Stanford > Help science move fast forward: > http://cmgm.stanford.edu/~cparnot/xgrid-stanford > > Charles Parnot > charles.parnot at gmail.com > > > > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com Windows is a 32-bit patch to a 16-bit shell for an 8-bit operating system, written for a 4-bit processor by a 2- bit company without 1 bit of sense. ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From mek at mekentosj.com Wed Apr 12 03:51:05 2006 From: mek at mekentosj.com (Alexander Griekspoor) Date: Wed, 12 Apr 2006 09:51:05 +0200 Subject: [Biococoa-dev] question about icons In-Reply-To: <3323F16F-1265-43E4-9145-1511D8E13FD0@earthlink.net> References: <3323F16F-1265-43E4-9145-1511D8E13FD0@earthlink.net> Message-ID: <2D4598B6-04A7-4290-8D4A-E4FBCBAB7189@mekentosj.com> Tada!!! ? On 12-apr-2006, at 1:27, Koen van der Drift wrote: > Hi, > > I used the BC.icns file that is in the project to create a .png > file using Iconographer. This png file is now visible in the wiki > page, however, it has a dark background, and looks rather ugly. > Could anyone make a copy of the icon without that background, and > also maybe a bit smaller? > > Or even better would be a logo that has the word 'BioCocoa' in it ;-) > > > thanks, > > - Koen. > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 E-mail: a.griekspoor at nki.nl AIM: mekentosj at mac.com Web: http://www.mekentosj.com EnzymeX - To cut or not to cut http://www.mekentosj.com/enzymex ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: BC.png Type: application/applefile Size: 72196 bytes Desc: not available URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: BC.png Type: image/png Size: 21466 bytes Desc: not available URL: -------------- next part -------------- An HTML attachment was scrubbed... URL: From peter.schols at bio.kuleuven.be Wed Apr 12 08:09:12 2006 From: peter.schols at bio.kuleuven.be (Peter Schols) Date: Wed, 12 Apr 2006 14:09:12 +0200 Subject: [Biococoa-dev] Wiki and website In-Reply-To: <8D47D449-4F45-4E6C-B0CF-B1780108E367@nki.nl> References: <8D47D449-4F45-4E6C-B0CF-B1780108E367@nki.nl> Message-ID: <0053066A-1315-4A4C-896B-3B85B91621AB@bio.kuleuven.be> Hi guys, The dust is starting to settle down here, and I would like to resume my work on the BioCocoa website. I played around a bit in Sandvox, the new web editor (also because I promised Dan, the author, to send in some feedback). However, now that I have seen the BioCocoa wiki (which is becoming more useful every day, great work BTW!), I'm wondering if there is really a need for 'another' BioCocoa website. I was thinking that instead of designing a new BioCocoa website and spending time on CSS and xhtml, it could be better for the project that I could spend that time filling in the wiki (for example with some tutorials) and working on the project itself. When I'm using a third party framework, the first thing I'm looking for is sample code that can get me started asap, so I think that could be the best thing to add in order to gain extra users (and thus potential contributors). Before spending much time on web design, I'm wondering what the list is thinking about this: do we need a separate website / webpage apart from the Wiki? Or do we integrate everything into the wiki? In case we go for a separate website / webpage (that is of course linked to the wiki), what info should this webpage contain? Any feedback is appreciated! Peter On 12 Apr 2006, at 11:07, Alexander Griekspoor wrote: > If I have some time I'll hope to do what Drew and Charles also did > on their wiki, post some archived, handy, email conversations on > the wiki as reference. > Cheers, > Alex > > ********************************************************* > ** Alexander Griekspoor ** > ********************************************************* > The Netherlands Cancer Institute > Department of Tumorbiology (H4) > Plesmanlaan 121, 1066 CX, Amsterdam > Tel: + 31 20 - 512 2023 > Fax: + 31 20 - 512 2029 > AIM: mekentosj at mac.com > E-mail: a.griekspoor at nki.nl > Web: http://www.mekentosj.com > > 4Peaks - For Peaks, Four Peaks. > 2004 Winner of the Apple Design Awards > Best Mac OS X Student Product > http://www.mekentosj.com/4peaks > > ********************************************************* > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm From a.griekspoor at nki.nl Wed Apr 12 10:49:09 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Wed, 12 Apr 2006 16:49:09 +0200 Subject: [Biococoa-dev] Wiki and website In-Reply-To: <0053066A-1315-4A4C-896B-3B85B91621AB@bio.kuleuven.be> References: <8D47D449-4F45-4E6C-B0CF-B1780108E367@nki.nl> <0053066A-1315-4A4C-896B-3B85B91621AB@bio.kuleuven.be> Message-ID: <3449987B-E3F2-4B99-9C0A-C6AA4D1BF5F2@nki.nl> I think you are right, we don't really need one. If we give the wiki frontpage a bit more a "homepage feeling", it could be perfect already! Cheers, Alex On 12-apr-2006, at 14:09, Peter Schols wrote: > Hi guys, > > The dust is starting to settle down here, and I would like to > resume my work on the BioCocoa website. I played around a bit in > Sandvox, the new web editor (also because I promised Dan, the > author, to send in some feedback). However, now that I have seen > the BioCocoa wiki (which is becoming more useful every day, great > work BTW!), I'm wondering if there is really a need for 'another' > BioCocoa website. I was thinking that instead of designing a new > BioCocoa website and spending time on CSS and xhtml, it could be > better for the project that I could spend that time filling in the > wiki (for example with some tutorials) and working on the project > itself. > When I'm using a third party framework, the first thing I'm looking > for is sample code that can get me started asap, so I think that > could be the best thing to add in order to gain extra users (and > thus potential contributors). > > Before spending much time on web design, I'm wondering what the > list is thinking about this: do we need a separate website / > webpage apart from the Wiki? Or do we integrate everything into the > wiki? > In case we go for a separate website / webpage (that is of course > linked to the wiki), what info should this webpage contain? > Any feedback is appreciated! > > Peter > > > > On 12 Apr 2006, at 11:07, Alexander Griekspoor wrote: > >> If I have some time I'll hope to do what Drew and Charles also did >> on their wiki, post some archived, handy, email conversations on >> the wiki as reference. >> Cheers, >> Alex >> >> ********************************************************* >> ** Alexander Griekspoor ** >> ********************************************************* >> The Netherlands Cancer Institute >> Department of Tumorbiology (H4) >> Plesmanlaan 121, 1066 CX, Amsterdam >> Tel: + 31 20 - 512 2023 >> Fax: + 31 20 - 512 2029 >> AIM: mekentosj at mac.com >> E-mail: a.griekspoor at nki.nl >> Web: http://www.mekentosj.com >> >> 4Peaks - For Peaks, Four Peaks. >> 2004 Winner of the Apple Design Awards >> Best Mac OS X Student Product >> http://www.mekentosj.com/4peaks >> >> ********************************************************* >> >> _______________________________________________ >> Biococoa-dev mailing list >> Biococoa-dev at bioinformatics.org >> https://bioinformatics.org/mailman/listinfo/biococoa-dev > > > Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com LabAssistant - Get your life organized! http://www.mekentosj.com/labassistant ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From charles.parnot at gmail.com Wed Apr 12 13:29:57 2006 From: charles.parnot at gmail.com (Charles Parnot) Date: Wed, 12 Apr 2006 10:29:57 -0700 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: <667464FDA2C81D4CA79D7F3B728D10E75A86A8@adsrv100.nki.nl> References: <667464FDA2C81D4CA79D7F3B728D10E75A86A8@adsrv100.nki.nl> Message-ID: <316E7CD2-FC48-4FA4-AE96-F4A219DF1B9B@gmail.com> > Hi Charles, > > What is the rss url you use to monitor the svn? > Alex http://bioinformatics.org/websvn/rss.php?repname=BioCocoa&path=% 2F&rev=0&sc=0&isdir=1 -- Xgrid-at-Stanford Help science move fast forward: http://cmgm.stanford.edu/~cparnot/xgrid-stanford Charles Parnot charles.parnot at gmail.com From charles.parnot at gmail.com Wed Apr 12 13:36:16 2006 From: charles.parnot at gmail.com (Charles Parnot) Date: Wed, 12 Apr 2006 10:36:16 -0700 Subject: [Biococoa-dev] Wiki and website In-Reply-To: <3449987B-E3F2-4B99-9C0A-C6AA4D1BF5F2@nki.nl> References: <8D47D449-4F45-4E6C-B0CF-B1780108E367@nki.nl> <0053066A-1315-4A4C-896B-3B85B91621AB@bio.kuleuven.be> <3449987B-E3F2-4B99-9C0A-C6AA4D1BF5F2@nki.nl> Message-ID: <2F3C3C30-5B20-4A15-A882-06BE2332C93A@gmail.com> Peter: agreed with Alex. Maybe you would aim for a nice good-looking home page mostly using what you already have done, outside of the wiki, but then feed all the contents through the wiki. And it is probably possible to customize the wiki and give it a nice look too, ultimately. charles On Apr 12, 2006, at 7:49 AM, Alexander Griekspoor wrote: > I think you are right, we don't really need one. If we give the > wiki frontpage a bit more a "homepage feeling", it could be perfect > already! > Cheers, > Alex > > On 12-apr-2006, at 14:09, Peter Schols wrote: > >> Hi guys, >> >> The dust is starting to settle down here, and I would like to >> resume my work on the BioCocoa website. I played around a bit in >> Sandvox, the new web editor (also because I promised Dan, the >> author, to send in some feedback). However, now that I have seen >> the BioCocoa wiki (which is becoming more useful every day, great >> work BTW!), I'm wondering if there is really a need for 'another' >> BioCocoa website. I was thinking that instead of designing a new >> BioCocoa website and spending time on CSS and xhtml, it could be >> better for the project that I could spend that time filling in the >> wiki (for example with some tutorials) and working on the project >> itself. >> When I'm using a third party framework, the first thing I'm >> looking for is sample code that can get me started asap, so I >> think that could be the best thing to add in order to gain extra >> users (and thus potential contributors). >> >> Before spending much time on web design, I'm wondering what the >> list is thinking about this: do we need a separate website / >> webpage apart from the Wiki? Or do we integrate everything into >> the wiki? >> In case we go for a separate website / webpage (that is of course >> linked to the wiki), what info should this webpage contain? >> Any feedback is appreciated! >> >> Peter >> >> >> >> On 12 Apr 2006, at 11:07, Alexander Griekspoor wrote: >> >>> If I have some time I'll hope to do what Drew and Charles also >>> did on their wiki, post some archived, handy, email conversations >>> on the wiki as reference. >>> Cheers, >>> Alex >>> >>> ********************************************************* >>> ** Alexander Griekspoor ** >>> ********************************************************* >>> The Netherlands Cancer Institute >>> Department of Tumorbiology (H4) >>> Plesmanlaan 121, 1066 CX, Amsterdam >>> Tel: + 31 20 - 512 2023 >>> Fax: + 31 20 - 512 2029 >>> AIM: mekentosj at mac.com >>> E-mail: a.griekspoor at nki.nl >>> Web: http://www.mekentosj.com >>> >>> 4Peaks - For Peaks, Four Peaks. >>> 2004 Winner of the Apple Design Awards >>> Best Mac OS X Student Product >>> http://www.mekentosj.com/4peaks >>> >>> ********************************************************* >>> >>> _______________________________________________ >>> Biococoa-dev mailing list >>> Biococoa-dev at bioinformatics.org >>> https://bioinformatics.org/mailman/listinfo/biococoa-dev >> >> >> Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm >> >> _______________________________________________ >> Biococoa-dev mailing list >> Biococoa-dev at bioinformatics.org >> https://bioinformatics.org/mailman/listinfo/biococoa-dev >> > > ********************************************************* > ** Alexander Griekspoor ** > ********************************************************* > The Netherlands Cancer Institute > Department of Tumorbiology (H4) > Plesmanlaan 121, 1066 CX, Amsterdam > Tel: + 31 20 - 512 2023 > Fax: + 31 20 - 512 2029 > AIM: mekentosj at mac.com > E-mail: a.griekspoor at nki.nl > Web: http://www.mekentosj.com > > LabAssistant - Get your life organized! > http://www.mekentosj.com/labassistant > > ********************************************************* > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev -- Xgrid-at-Stanford Help science move fast forward: http://cmgm.stanford.edu/~cparnot/xgrid-stanford Charles Parnot charles.parnot at gmail.com From peter.schols at bio.kuleuven.be Wed Apr 12 15:35:32 2006 From: peter.schols at bio.kuleuven.be (Peter Schols) Date: Wed, 12 Apr 2006 21:35:32 +0200 Subject: [Biococoa-dev] Wiki and website In-Reply-To: <2F3C3C30-5B20-4A15-A882-06BE2332C93A@gmail.com> References: <8D47D449-4F45-4E6C-B0CF-B1780108E367@nki.nl> <0053066A-1315-4A4C-896B-3B85B91621AB@bio.kuleuven.be> <3449987B-E3F2-4B99-9C0A-C6AA4D1BF5F2@nki.nl> <2F3C3C30-5B20-4A15-A882-06BE2332C93A@gmail.com> Message-ID: <95437D44-7184-433E-893F-02F72C34FC0A@bio.kuleuven.be> Charles, Alex: the hybrid approach seems like a good idea, and in the meantime I noticed that the Wiki can be customized using skins, so I'll see what I can come up with. peter On 12 Apr 2006, at 19:36, Charles Parnot wrote: > Peter: agreed with Alex. Maybe you would aim for a nice good- > looking home page mostly using what you already have done, outside > of the wiki, but then feed all the contents through the wiki. And > it is probably possible to customize the wiki and give it a nice > look too, ultimately. > > charles > > > On Apr 12, 2006, at 7:49 AM, Alexander Griekspoor wrote: > >> I think you are right, we don't really need one. If we give the >> wiki frontpage a bit more a "homepage feeling", it could be >> perfect already! >> Cheers, >> Alex >> >> On 12-apr-2006, at 14:09, Peter Schols wrote: >> >>> Hi guys, >>> >>> The dust is starting to settle down here, and I would like to >>> resume my work on the BioCocoa website. I played around a bit in >>> Sandvox, the new web editor (also because I promised Dan, the >>> author, to send in some feedback). However, now that I have seen >>> the BioCocoa wiki (which is becoming more useful every day, great >>> work BTW!), I'm wondering if there is really a need for 'another' >>> BioCocoa website. I was thinking that instead of designing a new >>> BioCocoa website and spending time on CSS and xhtml, it could be >>> better for the project that I could spend that time filling in >>> the wiki (for example with some tutorials) and working on the >>> project itself. >>> When I'm using a third party framework, the first thing I'm >>> looking for is sample code that can get me started asap, so I >>> think that could be the best thing to add in order to gain extra >>> users (and thus potential contributors). >>> >>> Before spending much time on web design, I'm wondering what the >>> list is thinking about this: do we need a separate website / >>> webpage apart from the Wiki? Or do we integrate everything into >>> the wiki? >>> In case we go for a separate website / webpage (that is of course >>> linked to the wiki), what info should this webpage contain? >>> Any feedback is appreciated! >>> >>> Peter >>> >>> >>> >>> On 12 Apr 2006, at 11:07, Alexander Griekspoor wrote: >>> >>>> If I have some time I'll hope to do what Drew and Charles also >>>> did on their wiki, post some archived, handy, email >>>> conversations on the wiki as reference. >>>> Cheers, >>>> Alex >>>> >>>> ********************************************************* >>>> ** Alexander Griekspoor ** >>>> ********************************************************* >>>> The Netherlands Cancer Institute >>>> Department of Tumorbiology (H4) >>>> Plesmanlaan 121, 1066 CX, Amsterdam >>>> Tel: + 31 20 - 512 2023 >>>> Fax: + 31 20 - 512 2029 >>>> AIM: mekentosj at mac.com >>>> E-mail: a.griekspoor at nki.nl >>>> Web: http://www.mekentosj.com >>>> >>>> 4Peaks - For Peaks, Four Peaks. >>>> 2004 Winner of the Apple Design Awards >>>> Best Mac OS X Student Product >>>> http://www.mekentosj.com/4peaks >>>> >>>> ********************************************************* >>>> >>>> _______________________________________________ >>>> Biococoa-dev mailing list >>>> Biococoa-dev at bioinformatics.org >>>> https://bioinformatics.org/mailman/listinfo/biococoa-dev >>> >>> >>> Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm >>> >>> _______________________________________________ >>> Biococoa-dev mailing list >>> Biococoa-dev at bioinformatics.org >>> https://bioinformatics.org/mailman/listinfo/biococoa-dev >>> >> >> ********************************************************* >> ** Alexander Griekspoor ** >> ********************************************************* >> The Netherlands Cancer Institute >> Department of Tumorbiology (H4) >> Plesmanlaan 121, 1066 CX, Amsterdam >> Tel: + 31 20 - 512 2023 >> Fax: + 31 20 - 512 2029 >> AIM: mekentosj at mac.com >> E-mail: a.griekspoor at nki.nl >> Web: http://www.mekentosj.com >> >> LabAssistant - Get your life organized! >> http://www.mekentosj.com/labassistant >> >> ********************************************************* >> >> _______________________________________________ >> Biococoa-dev mailing list >> Biococoa-dev at bioinformatics.org >> https://bioinformatics.org/mailman/listinfo/biococoa-dev > > -- > Xgrid-at-Stanford > Help science move fast forward: > http://cmgm.stanford.edu/~cparnot/xgrid-stanford > > Charles Parnot > charles.parnot at gmail.com > > > > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm From kvddrift at earthlink.net Wed Apr 12 17:16:10 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Wed, 12 Apr 2006 17:16:10 -0400 Subject: [Biococoa-dev] Wiki and website In-Reply-To: <95437D44-7184-433E-893F-02F72C34FC0A@bio.kuleuven.be> References: <8D47D449-4F45-4E6C-B0CF-B1780108E367@nki.nl> <0053066A-1315-4A4C-896B-3B85B91621AB@bio.kuleuven.be> <3449987B-E3F2-4B99-9C0A-C6AA4D1BF5F2@nki.nl> <2F3C3C30-5B20-4A15-A882-06BE2332C93A@gmail.com> <95437D44-7184-433E-893F-02F72C34FC0A@bio.kuleuven.be> Message-ID: On Apr 12, 2006, at 3:35 PM, Peter Schols wrote: > Charles, Alex: the hybrid approach seems like a good idea, and in > the meantime I noticed that the Wiki can be customized using skins, > so I'll see what I can come up with. I agree - pmwiki is highly customizable. I actually already changed the skin, and added some extra lines in /local/config.php. Peter should have privileges for that directory too, not sure about the other members. I was also looking at this: http://bioinformatics.org/about/ hosting.php and was wondering if it would be possible to have a biococoa.org website. cheers, - Koen. From kvddrift at earthlink.net Wed Apr 12 17:17:20 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Wed, 12 Apr 2006 17:17:20 -0400 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: <316E7CD2-FC48-4FA4-AE96-F4A219DF1B9B@gmail.com> References: <667464FDA2C81D4CA79D7F3B728D10E75A86A8@adsrv100.nki.nl> <316E7CD2-FC48-4FA4-AE96-F4A219DF1B9B@gmail.com> Message-ID: <16C45F23-56EC-4944-9595-4FC4B9B21706@earthlink.net> On Apr 12, 2006, at 1:29 PM, Charles Parnot wrote: > http://bioinformatics.org/websvn/rss.php?repname=BioCocoa&path=% > 2F&rev=0&sc=0&isdir=1 Actually http://bioinformatics.org/websvn/rss.php?repname=BioCocoa should be enough ;-) cheers, - Koen. From kvddrift at earthlink.net Wed Apr 12 19:18:28 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Wed, 12 Apr 2006 19:18:28 -0400 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: References: <42E81331-EABE-47ED-ACD6-B57EF899C2B5@nki.nl> <92C3BA7E-C74B-4AA3-B150-014895302858@nki.nl> <459FEA70-0B1A-4073-A7B3-EF3EF037DB8B@earthlink.net> Message-ID: <4E2D9A1A-B6A1-4367-BE21-9FE7373C357D@earthlink.net> On Apr 12, 2006, at 3:54 AM, Alexander Griekspoor wrote: > On a more relevant note, the binary file format reading now works > on intel as well, here are the update methods: > Thanks, added to the repository. - Koen. From a.griekspoor at nki.nl Thu Apr 13 06:21:56 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Thu, 13 Apr 2006 12:21:56 +0200 Subject: [Biococoa-dev] KDTextView update Message-ID: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> Hi guys, While working yesterday on an EnzymeX update fixing a number of bugs, I also took another look at our beloved textview. I've moved the textstripping from my controller to the textview so that I don't have to worry about that anymore. Notice that the implementation Koen did in the current demo only works when you enter single characters at a time, copy, paste, dragging etc is not allow using that implementation. I've changed the approach by overriding a number of methods, and now it works great as far as I can see. Filtering can be switched on or off using the added "filter" property (maybe I should have named that "filters", hmm). One exercise for the reader would be to add an "allowed_characterset" property, I've currently hardcoded the DNA characters, hence it doesn't work for filtering aa's. I'm not sure how this fits with the bc classes, but I'll leave it up to koen to decide if/how to implement all this. As a bonus it also includes the code that I use to mark a certain region, which is now also updated upon editing (code that might come in handy when doing annotations). http://www.mekentosj.com/temporary/KDTextView2.zip Cheers, Alex ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com Windows vs Mac 65 million years ago, there were more dinosaurs than humans. Where are the dinosaurs now? ********************************************************* From kvddrift at earthlink.net Thu Apr 13 06:41:20 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Thu, 13 Apr 2006 06:41:20 -0400 Subject: [Biococoa-dev] KDTextView update In-Reply-To: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> Message-ID: <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> On Apr 13, 2006, at 6:21 AM, Alexander Griekspoor wrote: > One exercise for the reader would be to add an > "allowed_characterset" property, I've currently hardcoded the DNA > characters, hence it doesn't work for filtering aa's. > I'm not sure how this fits with the bc classes, but I'll leave it > up to koen to decide if/how to implement all this. Well, eventually the BCSymbolSet needs to be used as a filter, probably through the controller (maybe using textShouldChange or something like that). I'll have a look at your code later today, now I'm off to work soon. Thanks for improving this class. - Koen. From a.griekspoor at nki.nl Thu Apr 13 06:47:51 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Thu, 13 Apr 2006 12:47:51 +0200 Subject: [Biococoa-dev] KDTextView update In-Reply-To: <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> Message-ID: <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> The big problem with textShouldChange (and thus the current implementation) is that it only allows YES or NO insert this string, you can't modify the string. No problem a single character, but if someone drags or paste let's say ATTAATAGATGAF then you would disallow that because it contains the F. What you want however is to allow it, but filter the F. A solution in the context of what you had in mind would be to delegate the filtering to the controller in those methods that I override, which is easy to do and elegant. Cheers, Alex On 13-apr-2006, at 12:41, Koen van der Drift wrote: > > On Apr 13, 2006, at 6:21 AM, Alexander Griekspoor wrote: > >> One exercise for the reader would be to add an >> "allowed_characterset" property, I've currently hardcoded the DNA >> characters, hence it doesn't work for filtering aa's. >> I'm not sure how this fits with the bc classes, but I'll leave it >> up to koen to decide if/how to implement all this. > > > Well, eventually the BCSymbolSet needs to be used as a filter, > probably through the controller (maybe using textShouldChange or > something like that). > > I'll have a look at your code later today, now I'm off to work > soon. Thanks for improving this class. > > > - Koen. > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com Claiming that the Macintosh is inferior to Windows because most people use Windows, is like saying that all other restaurants serve food that is inferior to McDonalds ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From kvddrift at earthlink.net Thu Apr 13 19:50:32 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Thu, 13 Apr 2006 19:50:32 -0400 Subject: [Biococoa-dev] KDTextView update In-Reply-To: <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> Message-ID: <31992CED-7A34-4E58-AC59-7D80C0281E2C@earthlink.net> On Apr 13, 2006, at 6:47 AM, Alexander Griekspoor wrote: > The big problem with textShouldChange (and thus the current > implementation) is that it only allows YES or NO insert this > string, you can't modify the string. No problem a single character, > but if someone drags or paste let's say ATTAATAGATGAF then you > would disallow that because it contains the F. What you want > however is to allow it, but filter the F. I don't think a textview should take of filtering, it should just display a string. The controller should take care of the filtering, which would be more an MVC approach. > A solution in the context of what you had in mind would be to > delegate the filtering to the controller in those methods that I > override, which is easy to do and elegant. That's indeed a more MVC approach, so I will look into that. BTW, I think you forgot to include the Color_Extension and String_Extension files. The latter I guess contains the filterDNABases method? cheers, - Koen From a.griekspoor at nki.nl Thu Apr 13 20:00:17 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Fri, 14 Apr 2006 02:00:17 +0200 Subject: [Biococoa-dev] KDTextView update In-Reply-To: <31992CED-7A34-4E58-AC59-7D80C0281E2C@earthlink.net> References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> <31992CED-7A34-4E58-AC59-7D80C0281E2C@earthlink.net> Message-ID: <97E21DBC-DA4C-415A-9DF4-9C5DFDA0D209@nki.nl> > I don't think a textview should take of filtering, it should just > display a string. The controller should take care of the filtering, > which would be more an MVC approach. >> A solution in the context of what you had in mind would be to >> delegate the filtering to the controller in those methods that I >> override, which is easy to do and elegant. > > That's indeed a more MVC approach, so I will look into that. That's the difference between providing something for extensive reuse and something that fulfils specific needs in my app ;-) Usually, the latter evolves slowly to the first, with the pressure on slowly, that's why it's done that way yet, at least the "proper" idea is there ;-) > > BTW, I think you forgot to include the Color_Extension and > String_Extension files. The latter I guess contains the > filterDNABases method? The color you can replace to your liking, here's the relevant string method: -(NSString *)filterDNABases { int i; NSMutableString* filteredstring = [NSMutableString stringWithCapacity: [self length]]; NSString *upper = [self uppercaseString]; for(i=0; i<[upper length]; i++){ switch([upper characterAtIndex: i]){ case 'A': [filteredstring appendString: @"A"]; break; case 'C': [filteredstring appendString: @"C"]; break; case 'G': [filteredstring appendString: @"G"]; break; case 'T': [filteredstring appendString: @"T"]; break; case 'U': [filteredstring appendString: @"T"]; break; case 'W': [filteredstring appendString: @"N"]; break; case 'S': [filteredstring appendString: @"N"]; break; case 'M': [filteredstring appendString: @"N"]; break; case 'K': [filteredstring appendString: @"N"]; break; case 'R': [filteredstring appendString: @"N"]; break; case 'Y': [filteredstring appendString: @"N"]; break; case 'H': [filteredstring appendString: @"N"]; break; case 'V': [filteredstring appendString: @"N"]; break; case 'D': [filteredstring appendString: @"N"]; break; case 'B': [filteredstring appendString: @"N"]; break; case 'N': [filteredstring appendString: @"N"]; break; default: break; } } return filteredstring; } Alex > > cheers, > > - Koen > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > *********************************** Mek (Alexander Griekspoor) MekenTosj.com Web: http://www.mekentosj.com Mail: mek at mekentosj.com *********************************** -------------- next part -------------- An HTML attachment was scrubbed... URL: From kvddrift at earthlink.net Thu Apr 13 21:28:22 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Thu, 13 Apr 2006 21:28:22 -0400 Subject: [Biococoa-dev] KDTextView update In-Reply-To: <97E21DBC-DA4C-415A-9DF4-9C5DFDA0D209@nki.nl> References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> <31992CED-7A34-4E58-AC59-7D80C0281E2C@earthlink.net> <97E21DBC-DA4C-415A-9DF4-9C5DFDA0D209@nki.nl> Message-ID: <295C0226-4D33-489E-BAF1-8776A1A1BDA8@earthlink.net> On Apr 13, 2006, at 8:00 PM, Alexander Griekspoor wrote: > That's the difference between providing something for extensive > reuse and something that fulfils specific needs in my app ;-) > Usually, the latter evolves slowly to the first, with the pressure > on slowly, that's why it's done that way yet, at least the "proper" > idea is there ;-) >> Fair enough. I have committed the changes, including a new delegate method for BCSequenceView: filterInputString. The Translation demo uses it as follows, using the symbolSet of the BCSequence that is connected to each textView: - (NSString *)filterInputString: (NSString *) inputString textView: (BCSequenceView *)textView { BCSymbolSet *symbolSet; // need to filter for rich text here if ( textView == theInput ) { symbolSet = [theDNA symbolSet]; return [symbolSet stringByRemovingUnknownCharsFromString: inputString]; } else if (textView == theOutput) { symbolSet = [theProtein symbolSet]; return [symbolSet stringByRemovingUnknownCharsFromString: inputString]; } return inputString; } However, it does not have the same functionality as the filter that Alex made, i.e. renaming all ambiguous symbols into 'N'. We also need a method to return a plain NSString from richtext input, though. For instance, I copy-pasted the short sequence that Alex gave as an example (ATTAATAGATGAF ), but that was rich text from Mail.app, so it showed up as follows in the view: rtmacanscgccartccasbrtnttbswsscharstHvtcacrtbrdgrnbdtabardardtabnatrascA TTAATAGATGA I couldn't find a method in the FoundationKit, so I started a category method in BCUtilString, but it is not working yet. This method can then also be used in BCSequenceReader. Finally, copy-paste within the sequenceview isn't working. cheers, - Koen. From kvddrift at earthlink.net Fri Apr 14 07:41:41 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Fri, 14 Apr 2006 07:41:41 -0400 Subject: [Biococoa-dev] KDTextView update In-Reply-To: <295C0226-4D33-489E-BAF1-8776A1A1BDA8@earthlink.net> References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> <31992CED-7A34-4E58-AC59-7D80C0281E2C@earthlink.net> <97E21DBC-DA4C-415A-9DF4-9C5DFDA0D209@nki.nl> <295C0226-4D33-489E-BAF1-8776A1A1BDA8@earthlink.net> Message-ID: On Apr 13, 2006, at 9:28 PM, Koen van der Drift wrote: > We also need a method to return a plain NSString from richtext > input, though. For instance, I copy-pasted the short sequence that > Alex gave as an example (ATTAATAGATGAF ), but that was rich text > from Mail.app, so it showed up as follows in the view: > > rtmacanscgccartccasbrtnttbswsscharstHvtcacrtbrdgrnbdtabardardtabnatras > cATTAATAGATGA > > I couldn't find a method in the FoundationKit, so I started a > category method in BCUtilString, but it is not working yet. This > method can then also be used in BCSequenceReader. I think I solved that, I changed readSelectionFromPasteboard in BCSequenceView to only accept NSStringPboardType: - (BOOL)readSelectionFromPasteboard:(NSPasteboard *)pboard type: (NSString *)type{ // the docs say to call this first, so we do ;-) [pboard types]; // try to read a string, if not succesful bummer, otherwise insert it NSString *aString = [pboard stringForType: NSStringPboardType]; // only accept plain strings if(aString){ [self insertText: aString]; return YES; } else return NO; } Would this break anything else? If not, I will commit it. cheers, - Koen. From a.griekspoor at nki.nl Fri Apr 14 07:47:29 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Fri, 14 Apr 2006 13:47:29 +0200 Subject: [Biococoa-dev] KDTextView update In-Reply-To: References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> <31992CED-7A34-4E58-AC59-7D80C0281E2C@earthlink.net> <97E21DBC-DA4C-415A-9DF4-9C5DFDA0D209@nki.nl> <295C0226-4D33-489E-BAF1-8776A1A1BDA8@earthlink.net> Message-ID: <969CD974-5827-4BD8-8166-60F474AD2DDB@nki.nl> Hmm, Koen take a look at the methods I override in the textview I shared, it solved all those problems already. For instance by using this: - (BOOL)readSelectionFromPasteboard:(NSPasteboard *)pboard type: (NSString *)type{ // the docs say to call this first, so we do ;-) [pboard types]; // try to read a string, if not succesful bummer, otherwise insert it NSString *aString = [pboard stringForType: type]; if(aString){ [self insertText: aString]; return YES; } else return NO; } You can read strings, rtf etc. And you also have to override both setString and insertText. I just checked out the svn, but your updated BCSequenceView was not committed.. Cheers, Alex On 14-apr-2006, at 13:41, Koen van der Drift wrote: > > On Apr 13, 2006, at 9:28 PM, Koen van der Drift wrote: > >> We also need a method to return a plain NSString from richtext >> input, though. For instance, I copy-pasted the short sequence that >> Alex gave as an example (ATTAATAGATGAF ), but that was rich text >> from Mail.app, so it showed up as follows in the view: >> >> rtmacanscgccartccasbrtnttbswsscharstHvtcacrtbrdgrnbdtabardardtabnatra >> scATTAATAGATGA >> >> I couldn't find a method in the FoundationKit, so I started a >> category method in BCUtilString, but it is not working yet. This >> method can then also be used in BCSequenceReader. > > > I think I solved that, I changed readSelectionFromPasteboard in > BCSequenceView to only accept NSStringPboardType: > > - (BOOL)readSelectionFromPasteboard:(NSPasteboard *)pboard type: > (NSString *)type{ > > // the docs say to call this first, so we do ;-) > [pboard types]; > // try to read a string, if not succesful bummer, otherwise insert it > NSString *aString = [pboard stringForType: > NSStringPboardType]; // only accept plain strings > if(aString){ > [self insertText: aString]; > return YES; > } > else > return NO; > } > > Would this break anything else? If not, I will commit it. > > cheers, > > - Koen. > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 E-mail: a.griekspoor at nki.nl AIM: mekentosj at mac.com Web: http://www.mekentosj.com EnzymeX - To cut or not to cut http://www.mekentosj.com/enzymex ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From a.griekspoor at nki.nl Fri Apr 14 07:48:21 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Fri, 14 Apr 2006 13:48:21 +0200 Subject: [Biococoa-dev] KDTextView update In-Reply-To: References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> <31992CED-7A34-4E58-AC59-7D80C0281E2C@earthlink.net> <97E21DBC-DA4C-415A-9DF4-9C5DFDA0D209@nki.nl> <295C0226-4D33-489E-BAF1-8776A1A1BDA8@earthlink.net> Message-ID: Hmm, that is my code already, why didn't the other stuff work then? It works fine in enzymex... Alex On 14-apr-2006, at 13:41, Koen van der Drift wrote: > > On Apr 13, 2006, at 9:28 PM, Koen van der Drift wrote: > >> We also need a method to return a plain NSString from richtext >> input, though. For instance, I copy-pasted the short sequence that >> Alex gave as an example (ATTAATAGATGAF ), but that was rich text >> from Mail.app, so it showed up as follows in the view: >> >> rtmacanscgccartccasbrtnttbswsscharstHvtcacrtbrdgrnbdtabardardtabnatra >> scATTAATAGATGA >> >> I couldn't find a method in the FoundationKit, so I started a >> category method in BCUtilString, but it is not working yet. This >> method can then also be used in BCSequenceReader. > > > I think I solved that, I changed readSelectionFromPasteboard in > BCSequenceView to only accept NSStringPboardType: > > - (BOOL)readSelectionFromPasteboard:(NSPasteboard *)pboard type: > (NSString *)type{ > > // the docs say to call this first, so we do ;-) > [pboard types]; > // try to read a string, if not succesful bummer, otherwise insert it > NSString *aString = [pboard stringForType: > NSStringPboardType]; // only accept plain strings > if(aString){ > [self insertText: aString]; > return YES; > } > else > return NO; > } > > Would this break anything else? If not, I will commit it. > > cheers, > > - Koen. > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > *********************************** Mek (Alexander Griekspoor) MekenTosj.com Web: http://www.mekentosj.com Mail: mek at mekentosj.com *********************************** -------------- next part -------------- An HTML attachment was scrubbed... URL: From kvddrift at earthlink.net Fri Apr 14 07:55:12 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Fri, 14 Apr 2006 07:55:12 -0400 Subject: [Biococoa-dev] KDTextView update In-Reply-To: References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> <31992CED-7A34-4E58-AC59-7D80C0281E2C@earthlink.net> <97E21DBC-DA4C-415A-9DF4-9C5DFDA0D209@nki.nl> <295C0226-4D33-489E-BAF1-8776A1A1BDA8@earthlink.net> Message-ID: On Apr 14, 2006, at 7:48 AM, Alexander Griekspoor wrote: > Hmm, that is my code already, why didn't the other stuff work then? > It works fine in enzymex... > I changed this line in your code: NSString *aString = [pboard stringForType: type]; to: NSString *aString = [pboard stringForType: NSStringPboardType]; So aString is forced to a plain string. With the original line, I get the rtf code pasted as well. Oh, it also solved the copy-paste in the same view. And forward- delete also works :) - Koen. From kvddrift at earthlink.net Fri Apr 14 08:51:19 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Fri, 14 Apr 2006 08:51:19 -0400 Subject: [Biococoa-dev] KDTextView update In-Reply-To: <969CD974-5827-4BD8-8166-60F474AD2DDB@nki.nl> References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> <31992CED-7A34-4E58-AC59-7D80C0281E2C@earthlink.net> <97E21DBC-DA4C-415A-9DF4-9C5DFDA0D209@nki.nl> <295C0226-4D33-489E-BAF1-8776A1A1BDA8@earthlink.net> <969CD974-5827-4BD8-8166-60F474AD2DDB@nki.nl> Message-ID: On Apr 14, 2006, at 7:47 AM, Alexander Griekspoor wrote: > I just checked out the svn, but your updated BCSequenceView was not > committed.. > That's weird, the repository shows it is committed: http:// bioinformatics.org/websvn/listing.php?repname=BioCocoa&path=% 2F&rev=47&sc=0 - Koen. From kvddrift at earthlink.net Fri Apr 14 11:09:29 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Fri, 14 Apr 2006 11:09:29 -0400 Subject: [Biococoa-dev] KDTextView update In-Reply-To: References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> <31992CED-7A34-4E58-AC59-7D80C0281E2C@earthlink.net> <97E21DBC-DA4C-415A-9DF4-9C5DFDA0D209@nki.nl> <295C0226-4D33-489E-BAF1-8776A1A1BDA8@earthlink.net> <969CD974-5827-4BD8-8166-60F474AD2DDB@nki.nl> Message-ID: <5D72D5BB-98D9-4221-B308-DD80A53948AF@earthlink.net> On Apr 14, 2006, at 8:51 AM, Koen van der Drift wrote: > That's weird, the repository shows it is committed: http:// > bioinformatics.org/websvn/listing.php?repname=BioCocoa&path=% > 2F&rev=47&sc=0 I commited stuff using Xcode, but apparently it didn't make it to the repository, although the log messages did. I now used svnX and I think it worked. Please let me know if you get the updated sourcefiles. cheers, - Koen. From a.griekspoor at nki.nl Fri Apr 14 16:48:38 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Fri, 14 Apr 2006 22:48:38 +0200 Subject: [Biococoa-dev] KDTextView update In-Reply-To: <5D72D5BB-98D9-4221-B308-DD80A53948AF@earthlink.net> References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> <31992CED-7A34-4E58-AC59-7D80C0281E2C@earthlink.net> <97E21DBC-DA4C-415A-9DF4-9C5DFDA0D209@nki.nl> <295C0226-4D33-489E-BAF1-8776A1A1BDA8@earthlink.net> <969CD974-5827-4BD8-8166-60F474AD2DDB@nki.nl> <5D72D5BB-98D9-4221-B308-DD80A53948AF@earthlink.net> Message-ID: Yep, now it's there! On 14-apr-2006, at 17:09, Koen van der Drift wrote: > > On Apr 14, 2006, at 8:51 AM, Koen van der Drift wrote: > >> That's weird, the repository shows it is committed: http:// >> bioinformatics.org/websvn/listing.php?repname=BioCocoa&path=% >> 2F&rev=47&sc=0 > > I commited stuff using Xcode, but apparently it didn't make it to > the repository, although the log messages did. I now used svnX and > I think it worked. Please let me know if you get the updated > sourcefiles. > > cheers, > > - Koen. ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com The requirements said: Windows 2000 or better. So I got a Macintosh. ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From a.griekspoor at nki.nl Fri Apr 14 16:53:20 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Fri, 14 Apr 2006 22:53:20 +0200 Subject: [Biococoa-dev] KDTextView update In-Reply-To: References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> <31992CED-7A34-4E58-AC59-7D80C0281E2C@earthlink.net> <97E21DBC-DA4C-415A-9DF4-9C5DFDA0D209@nki.nl> <295C0226-4D33-489E-BAF1-8776A1A1BDA8@earthlink.net> Message-ID: <40141E45-BD73-477E-A5F7-2E3B45E48DB9@nki.nl> Still it is weird that rtf works fine in enzymeX, the problem thus must be in the different type of filtering.. Also in this approach you probably have to check whether [pBoard types] contains NSStringPboardType. > And forward-delete also works :) Thanks for letting me know. You can change the comment ;-) Cheers, Alex *********************************** Mek (Alexander Griekspoor) MekenTosj.com Web: http://www.mekentosj.com Mail: mek at mekentosj.com *********************************** -------------- next part -------------- An HTML attachment was scrubbed... URL: From kvddrift at earthlink.net Fri Apr 14 18:08:47 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Fri, 14 Apr 2006 18:08:47 -0400 Subject: [Biococoa-dev] KDTextView update In-Reply-To: <40141E45-BD73-477E-A5F7-2E3B45E48DB9@nki.nl> References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> <31992CED-7A34-4E58-AC59-7D80C0281E2C@earthlink.net> <97E21DBC-DA4C-415A-9DF4-9C5DFDA0D209@nki.nl> <295C0226-4D33-489E-BAF1-8776A1A1BDA8@earthlink.net> <40141E45-BD73-477E-A5F7-2E3B45E48DB9@nki.nl> Message-ID: <66C715CB-C17E-472C-9BD1-EF17C9D160E2@earthlink.net> On Apr 14, 2006, at 4:53 PM, Alexander Griekspoor wrote: > Still it is weird that rtf works fine in enzymeX, the problem thus > must be in the different type of filtering.. Did you try stepping through the code in BioCocoa, maybe that clarifies better what's happening here. I see that behaviour when I drag a rtf text into the sequenceView. On my machine, the original code: - (BOOL)readSelectionFromPasteboard:(NSPasteboard *)pboard type: (NSString *)type{ // the docs say to call this first, so we do ;-) [pboard types]; // try to read a string, if not succesful bummer, otherwise insert it NSString *aString = [pboard stringForType: type]; if(aString){ [self insertText: aString]; return YES; } else return NO; } aString would still contain all the rtf code in it, only when changing the code to NSString *aString = [pboard stringForType: NSStringPboardType]; I get a plain string for aString. Filtering happens after that (through insertText). > Also in this approach you probably have to check whether [pBoard > types] contains NSStringPboardType. Yep, I will add that. cheers, - Koen. From kvddrift at earthlink.net Sat Apr 15 10:34:57 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Sat, 15 Apr 2006 10:34:57 -0400 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: References: <5B9BF2B3-9FD5-4A6F-8A64-3349D6721E8D@earthlink.net> <2FB99B57-87E8-41A3-B098-349884426AE1@mekentosj.com> Message-ID: <1A257862-94C7-4229-AA87-BA377CE28644@earthlink.net> On Apr 11, 2006, at 6:46 AM, Alexander Griekspoor wrote: > - (NSDictionary *)readFile:(NSString *)textFile > { > NSMutableDictionary *theContents; > NSString *lineBreak; > > // BINARY > // Strider? > if([NSHFSTypeOfFile(textFile) isEqualToString: @"'xDNA'"]){ > > theContents = (NSMutableDictionary*) [self > readStriderFile:textFile]; > > // GCK? > }else if([NSHFSTypeOfFile(textFile) isEqualToString: @"'GCKc'"] || > [NSHFSTypeOfFile(textFile) isEqualToString: @"'GCKs'"]){ > > theContents = (NSMutableDictionary*) [self readGCKFile:textFile]; > > // TEXT > }else { > NSMutableString *sequenceFile; > > // EXDNA > if([[textFile pathExtension]isEqualToString:@"exdna"]) > sequenceFile = [NSMutableString stringWithContentsOfFile: > [textFile stringByAppendingPathComponent: @"sequence.txt"]]; > else > sequenceFile = [NSMutableString stringWithContentsOfFile:textFile]; > > With these new great additions, I was wondering if we should slightly rethink the methods in BCSequenceReader. Right now we have - (BCSequenceArray *)readFileUsingPath:(NSString *)filePath { return nil; // TODO } - (BCSequenceArray *)readFileUsingData:(NSData *)dataFile { NSString *entryString = [[NSString alloc] initWithData: dataFile encoding:NSASCIIStringEncoding]; return [self readFileUsingText: [entryString autorelease]]; } and - (BCSequenceArray *)readFileUsingText:(NSString *)entryString { ... } The last one contains all the actual code. So maybe we should factor out the code with NSHFSTypeOfFile and the exdna part to readFileUsingPath, and let that method call in turn readFileUsingText, which actually deals with a contentstring. This will allow users to either pass a path, or the contents of a file or a data object. What do you guys think? cheeers, - Koen. From kvddrift at earthlink.net Sat Apr 15 14:34:26 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Sat, 15 Apr 2006 14:34:26 -0400 Subject: [Biococoa-dev] KDTextView update In-Reply-To: <40141E45-BD73-477E-A5F7-2E3B45E48DB9@nki.nl> References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> <31992CED-7A34-4E58-AC59-7D80C0281E2C@earthlink.net> <97E21DBC-DA4C-415A-9DF4-9C5DFDA0D209@nki.nl> <295C0226-4D33-489E-BAF1-8776A1A1BDA8@earthlink.net> <40141E45-BD73-477E-A5F7-2E3B45E48DB9@nki.nl> Message-ID: <1369269F-7D18-4F9A-A547-3E609D71ECC8@earthlink.net> On Apr 14, 2006, at 4:53 PM, Alexander Griekspoor wrote: > Still it is weird that rtf works fine in enzymeX, the problem thus > must be in the different type of filtering.. Aha, found it. It had to do with the settings in the Nib file. I turned off Multiple Fonts Allowed, and Continuous Spell Checker for the sequence views, and it worked as you described. I will also add those settings in the code, just to be sure. cheers, - Koen. From a.griekspoor at nki.nl Sat Apr 15 18:02:51 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Sun, 16 Apr 2006 00:02:51 +0200 Subject: [Biococoa-dev] KDTextView update In-Reply-To: <1369269F-7D18-4F9A-A547-3E609D71ECC8@earthlink.net> References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> <31992CED-7A34-4E58-AC59-7D80C0281E2C@earthlink.net> <97E21DBC-DA4C-415A-9DF4-9C5DFDA0D209@nki.nl> <295C0226-4D33-489E-BAF1-8776A1A1BDA8@earthlink.net> <40141E45-BD73-477E-A5F7-2E3B45E48DB9@nki.nl> <1369269F-7D18-4F9A-A547-3E609D71ECC8@earthlink.net> Message-ID: Ha, never thought about that one, great job! Now, there's two options, one: document this so that people make sure they turn it off in their nib files, or two: make sure we programatically to this upon awakeFromNib, so that we override the interface builder settings. We still should document that, I guess. Before anyone starts thinking why his spellchecker doesn't work despite the proper IB settings ;-) Cheers, Alex On 15-apr-2006, at 20:34, Koen van der Drift wrote: > > On Apr 14, 2006, at 4:53 PM, Alexander Griekspoor wrote: > >> Still it is weird that rtf works fine in enzymeX, the problem thus >> must be in the different type of filtering.. > > Aha, found it. It had to do with the settings in the Nib file. I > turned off Multiple Fonts Allowed, and Continuous Spell Checker for > the sequence views, and it worked as you described. I will also add > those settings in the code, just to be sure. > > cheers, > > - Koen. > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com Claiming that the Macintosh is inferior to Windows because most people use Windows, is like saying that all other restaurants serve food that is inferior to McDonalds ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From kvddrift at earthlink.net Sat Apr 15 18:50:25 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Sat, 15 Apr 2006 18:50:25 -0400 Subject: [Biococoa-dev] KDTextView update In-Reply-To: References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> <31992CED-7A34-4E58-AC59-7D80C0281E2C@earthlink.net> <97E21DBC-DA4C-415A-9DF4-9C5DFDA0D209@nki.nl> <295C0226-4D33-489E-BAF1-8776A1A1BDA8@earthlink.net> <40141E45-BD73-477E-A5F7-2E3B45E48DB9@nki.nl> <1369269F-7D18-4F9A-A547-3E609D71ECC8@earthlink.net> Message-ID: <3759771E-667D-4CA5-A8CD-CC3E1FCB9D00@earthlink.net> On Apr 15, 2006, at 6:02 PM, Alexander Griekspoor wrote: > Now, there's two options, one: document this so that people make > sure they turn it off in their nib files, or two: make sure we > programatically to this upon awakeFromNib, so that we override the > interface builder settings. We still should document that, I guess. > Before anyone starts thinking why his spellchecker doesn't work > despite the proper IB settings ;-) > Yes, I agree, the wiki seems the appropriate place for this. I will look into creating some more sections for the wiki, so these things are easy to find. Now we need some readers as well ;-) BTW, I could not find a method to set Multiple Fonts Allowed programmatically. cheers, - Koen. From a.griekspoor at nki.nl Sat Apr 15 18:59:36 2006 From: a.griekspoor at nki.nl (Alexander Griekspoor) Date: Sun, 16 Apr 2006 00:59:36 +0200 Subject: [Biococoa-dev] KDTextView update In-Reply-To: <3759771E-667D-4CA5-A8CD-CC3E1FCB9D00@earthlink.net> References: <02EB6F29-AC0A-411B-8D19-A4C5F916601C@nki.nl> <03269953-4B3F-4446-985C-49CDFE4A423A@earthlink.net> <55FC88E0-A90E-4179-838A-84DFDDB6EC92@nki.nl> <31992CED-7A34-4E58-AC59-7D80C0281E2C@earthlink.net> <97E21DBC-DA4C-415A-9DF4-9C5DFDA0D209@nki.nl> <295C0226-4D33-489E-BAF1-8776A1A1BDA8@earthlink.net> <40141E45-BD73-477E-A5F7-2E3B45E48DB9@nki.nl> <1369269F-7D18-4F9A-A547-3E609D71ECC8@earthlink.net> <3759771E-667D-4CA5-A8CD-CC3E1FCB9D00@earthlink.net> Message-ID: <23E0FFCB-9FD3-44BE-9FBB-DEF72BAB1D93@nki.nl> > BTW, I could not find a method to set Multiple Fonts Allowed > programmatically. I think it's - (void)setRichText:(BOOL)flag Cheers, Alex > ************************************************************** ** Alexander Griekspoor ** ************************************************************** The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com MacOS X: The power of UNIX with the simplicity of the Mac *************************************************************** -------------- next part -------------- An HTML attachment was scrubbed... URL: From biococoa at bioworxx.com Sun Apr 16 12:54:12 2006 From: biococoa at bioworxx.com (Philipp Seibel) Date: Sun, 16 Apr 2006 18:54:12 +0200 Subject: [Biococoa-dev] can't compile framework Message-ID: Hey everyone, i'm trying to get into the project again, but i can't compile the framework. Following problem: ld: can't locate file for: -lSystemStubs /usr/bin/libtool: internal link edit command failed ld: can't locate file for: -lSystemStubs /usr/bin/libtool: internal link edit command failed I think it's because i haven't installed the right sdk. But sdk 10.2.8 is installed and the environment is set to 10.2, so it should work right? Maybe i'm completly wrong ;-). thx for help Phil -------------- next part -------------- An HTML attachment was scrubbed... URL: From kvddrift at earthlink.net Sun Apr 16 14:28:33 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Sun, 16 Apr 2006 14:28:33 -0400 Subject: [Biococoa-dev] can't compile framework In-Reply-To: References: Message-ID: <970EE585-5996-4D00-A58A-80C5CD9E3A38@earthlink.net> On Apr 16, 2006, at 12:54 PM, Philipp Seibel wrote: > Hey everyone, > > i'm trying to get into the project again, but i can't compile the > framework. > Following problem: > > > ld: can't locate file for: -lSystemStubs > /usr/bin/libtool: internal link edit command failed > ld: can't locate file for: -lSystemStubs > /usr/bin/libtool: internal link edit command failed > > > I think it's because i haven't installed the right sdk. But sdk > 10.2.8 is installed and the environment is set to 10.2, so it > should work right? Maybe i'm completly wrong ;-). > Hey Phil, Welcome back! Make sure you use the most recent version of Xcode (2.2.1). Also, did you checkout the most recent version from svn? On my system it uses the 10.3.9 sdk. cheers, - Koen. From kvddrift at earthlink.net Sun Apr 16 22:23:39 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Sun, 16 Apr 2006 22:23:39 -0400 Subject: [Biococoa-dev] selection overview bug Message-ID: <0EEF0A8D-66CC-4DF6-BAFD-5FC09F692502@earthlink.net> Hi, While working with the BCSequenceView in my own app, I noticed a bug. If you click in a sequence in the last line, you will see the symbol number in the oval grey cursor. After about a second a 2nd oval shows up. Also try clicking in the next to last line, the oval moves only a bit after the 2nd click and is drawn partially. I tried making a screenshot, but couldn't because after hitting the keyboard, the second oval disappeared. So I guess you will have to try it out yourself to see what I mean. It also happens in EnzymeX 3. cheers, - Koen. From kvddrift at earthlink.net Mon Apr 17 19:28:41 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Mon, 17 Apr 2006 19:28:41 -0400 Subject: [Biococoa-dev] Even more on sequence formats In-Reply-To: References: <42E81331-EABE-47ED-ACD6-B57EF899C2B5@nki.nl> <92C3BA7E-C74B-4AA3-B150-014895302858@nki.nl> <459FEA70-0B1A-4073-A7B3-EF3EF037DB8B@earthlink.net> Message-ID: On Apr 12, 2006, at 5:21 AM, Alexander Griekspoor wrote: > I found the link already in Peter's email, sorry for that. To > always remember I've copied the relevant emails to the wiki ;-) > http://bioinformatics.org/biococoa/wiki/pmwiki.php?n=Main.SVNTutorial I have been working on the wiki page a bit, and moved that entry to Documentation -> Developer info. cheers, - Koen. From biococoa at bioworxx.com Tue Apr 18 13:11:57 2006 From: biococoa at bioworxx.com (Philipp Seibel) Date: Tue, 18 Apr 2006 19:11:57 +0200 Subject: [Biococoa-dev] WWDC Message-ID: <32CB808B-609E-4F40-83BB-A1A4FFE1D8FD@bioworxx.com> Hey, is anyone planning to attend this years wwdc? Phil From mek at mekentosj.com Tue Apr 18 14:12:13 2006 From: mek at mekentosj.com (Alexander Griekspoor) Date: Tue, 18 Apr 2006 20:12:13 +0200 Subject: [Biococoa-dev] Re: Weird bug with selection in Textview with custom textcontainer [solved] In-Reply-To: <549BA00A-04A5-45EB-8B6C-0631EF9528FA@apple.com> References: <667464FDA2C81D4CA79D7F3B728D10E75A86C1@adsrv100.nki.nl> <549BA00A-04A5-45EB-8B6C-0631EF9528FA@apple.com> Message-ID: <46150049-46A5-45A6-9C69-C8020A4A027A@mekentosj.com> Hi Douglas, Many thanks for the advice, I've got it to work! Below is the implementation of a custom layoutmanager class that fixes the problem. The nice thing is that it will get self- deactivated when you've fixed the problem ;-) I know if I have correctly implemented the fractionOfDistanceThroughGlyph part of the method, I'm not well known with c pointers, but that's anyway not really needed anyway for me. Once again, thanks for the help! Cheers, Alex #import "KDLayoutManager.h" #define COLUMN_WIDTH 10 @implementation KDLayoutManager - (unsigned)glyphIndexForPoint:(NSPoint)aPoint inTextContainer: (NSTextContainer *)aTextContainer fractionOfDistanceThroughGlyph: (float *)partialFraction{ unsigned idx = [super glyphIndexForPoint: aPoint inTextContainer: aTextContainer fractionOfDistanceThroughGlyph: partialFraction]; // because of a bug in this method we check by hand if wrong value is given if(idx == COLUMN_WIDTH && !NSPointInRect(aPoint, [self boundingRectForGlyphRange: NSMakeRange(COLUMN_WIDTH,1) inTextContainer: aTextContainer])){ int i; for (i=0; i > On Apr 18, 2006, at 12:43 AM, Alexander Griekspoor wrote: > >> I've thought a bit about it and I see one potential workaround. >> Can you tell me whether it's likely to work? >> Here's what I had in mind: >> 1) as you suggested, override: - (unsigned)glyphIndexForPoint: >> (NSPoint)aPoint inTextContainer:(NSTextContainer *)aTextContainer >> fractionOfDistanceThroughGlyph:(float *)partialFraction >> >> 2) in it, find out if the point is within the first 10 characters >> and there is only one line (the conditions that the bug presents >> itself). <- is there an easy way to do this? > > You can find out from the layout manager how many fragments there > are, using the effective glyph range argument to > lineFragmentRectForGlyphAtIndex:effectiveRange: and iterating, and > I think you have a fixed maximum number of fragments per line. > However, in your case I think just counting characters will suffice > to determine how many lines there are. Then I would check to see > whether the super method > glyphIndexForPoint:inTextContainer:fractionOfDistanceThroughGlyph: > points at the first glyph in the second fragment, which is what > happens in the error case. > >> 3) if we are dealing with the above, use - (NSRectArray) >> rectArrayForGlyphRange:(NSRange)glyphRange >> withinSelectedGlyphRange:(NSRange)selGlyphRange inTextContainer: >> (NSTextContainer *)aTextContainer rectCount:(unsigned *)rectCount >> with glyphrange 1-10, iterate over the rect array to see if the >> point falls within each rect and return the one where we have bingo. >> > > I would use locationForGlyphAtIndex:, and if it falls before one of > the locations of the glyphs in the first fragment, handle it > accordingly, and otherwise just use the super method's values. > > Douglas Davidson > ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com iRNAi, do you? http://www.mekentosj.com/irnai ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From ddavidso at apple.com Tue Apr 18 14:16:43 2006 From: ddavidso at apple.com (Douglas Davidson) Date: Tue, 18 Apr 2006 11:16:43 -0700 Subject: [Biococoa-dev] Re: Weird bug with selection in Textview with custom textcontainer [solved] In-Reply-To: <46150049-46A5-45A6-9C69-C8020A4A027A@mekentosj.com> References: <667464FDA2C81D4CA79D7F3B728D10E75A86C1@adsrv100.nki.nl> <549BA00A-04A5-45EB-8B6C-0631EF9528FA@apple.com> <46150049-46A5-45A6-9C69-C8020A4A027A@mekentosj.com> Message-ID: <136711DA-59AE-4809-9161-368D909D8452@apple.com> On Apr 18, 2006, at 11:12 AM, Alexander Griekspoor wrote: > Many thanks for the advice, I've got it to work! > Below is the implementation of a custom layoutmanager class that > fixes the problem. The nice thing is that it will get self- > deactivated when you've fixed the problem ;-) I know if I have > correctly implemented the fractionOfDistanceThroughGlyph part of > the method, I'm not well known with c pointers, but that's anyway > not really needed anyway for me. > Once again, thanks for the help! > That should work. The lines that say "partialFraction = &fraction;" should instead read "if (partialFraction) *partialFraction = fraction;" but overall it seems reasonable. Douglas Davidson From mek at mekentosj.com Tue Apr 18 14:23:02 2006 From: mek at mekentosj.com (Alexander Griekspoor) Date: Tue, 18 Apr 2006 20:23:02 +0200 Subject: [Biococoa-dev] Re: Weird bug with selection in Textview with custom textcontainer [solved] In-Reply-To: <136711DA-59AE-4809-9161-368D909D8452@apple.com> References: <667464FDA2C81D4CA79D7F3B728D10E75A86C1@adsrv100.nki.nl> <549BA00A-04A5-45EB-8B6C-0631EF9528FA@apple.com> <46150049-46A5-45A6-9C69-C8020A4A027A@mekentosj.com> <136711DA-59AE-4809-9161-368D909D8452@apple.com> Message-ID: <0F5C0EAD-58EC-4598-92C0-C3A6BA887AD5@mekentosj.com> Great, it works perfect now! Cheers, Alex Ps. Koen I can send you the updated KDTextView for the BioCocoa project. On 18-apr-2006, at 20:16, Douglas Davidson wrote: > > On Apr 18, 2006, at 11:12 AM, Alexander Griekspoor wrote: > >> Many thanks for the advice, I've got it to work! >> Below is the implementation of a custom layoutmanager class that >> fixes the problem. The nice thing is that it will get self- >> deactivated when you've fixed the problem ;-) I know if I have >> correctly implemented the fractionOfDistanceThroughGlyph part of >> the method, I'm not well known with c pointers, but that's anyway >> not really needed anyway for me. >> Once again, thanks for the help! >> > > That should work. The lines that say "partialFraction = > &fraction;" should instead read "if (partialFraction) > *partialFraction = fraction;" but overall it seems reasonable. > > Douglas Davidson > > *********************************** Mek (Alexander Griekspoor) MekenTosj.com Web: http://www.mekentosj.com Mail: mek at mekentosj.com *********************************** -------------- next part -------------- An HTML attachment was scrubbed... URL: From peter.schols at bio.kuleuven.be Tue Apr 18 14:25:00 2006 From: peter.schols at bio.kuleuven.be (Peter Schols) Date: Tue, 18 Apr 2006 20:25:00 +0200 Subject: [Biococoa-dev] WWDC In-Reply-To: <32CB808B-609E-4F40-83BB-A1A4FFE1D8FD@bioworxx.com> References: <32CB808B-609E-4F40-83BB-A1A4FFE1D8FD@bioworxx.com> Message-ID: If all goes well, I'm definitely attending Peter On 18 Apr 2006, at 19:11, Philipp Seibel wrote: > Hey, > > is anyone planning to attend this years wwdc? > > Phil > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm From mek at mekentosj.com Tue Apr 18 14:27:27 2006 From: mek at mekentosj.com (Alexander Griekspoor) Date: Tue, 18 Apr 2006 20:27:27 +0200 Subject: [Biococoa-dev] WWDC In-Reply-To: References: <32CB808B-609E-4F40-83BB-A1A4FFE1D8FD@bioworxx.com> Message-ID: <09B57FE0-6759-4ED1-8E91-7904C1D6739C@mekentosj.com> Unfortunately we can't go this year (although doubts begin to rise again), unless we can pull of the same trick as Peter did last year ;-) Cheers, Alex On 18-apr-2006, at 20:25, Peter Schols wrote: > If all goes well, I'm definitely attending > > Peter > > On 18 Apr 2006, at 19:11, Philipp Seibel wrote: > >> Hey, >> >> is anyone planning to attend this years wwdc? >> >> Phil >> _______________________________________________ >> Biococoa-dev mailing list >> Biococoa-dev at bioinformatics.org >> https://bioinformatics.org/mailman/listinfo/biococoa-dev >> > > > Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com Windows is a 32-bit patch to a 16-bit shell for an 8-bit operating system, written for a 4-bit processor by a 2- bit company without 1 bit of sense. ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From peter.schols at bio.kuleuven.be Tue Apr 18 15:57:37 2006 From: peter.schols at bio.kuleuven.be (Peter Schols) Date: Tue, 18 Apr 2006 21:57:37 +0200 Subject: [Biococoa-dev] WWDC In-Reply-To: <09B57FE0-6759-4ED1-8E91-7904C1D6739C@mekentosj.com> References: <32CB808B-609E-4F40-83BB-A1A4FFE1D8FD@bioworxx.com> <09B57FE0-6759-4ED1-8E91-7904C1D6739C@mekentosj.com> Message-ID: <990FFEC4-0754-41A6-996E-BE170E17C541@bio.kuleuven.be> Trick? I would be very interested to learn that trick ;-) (really!) On 18 Apr 2006, at 20:27, Alexander Griekspoor wrote: > Unfortunately we can't go this year (although doubts begin to rise > again), unless we can pull of the same trick as Peter did last > year ;-) > Cheers, > Alex > > On 18-apr-2006, at 20:25, Peter Schols wrote: > >> If all goes well, I'm definitely attending >> >> Peter >> >> On 18 Apr 2006, at 19:11, Philipp Seibel wrote: >> >>> Hey, >>> >>> is anyone planning to attend this years wwdc? >>> >>> Phil >>> _______________________________________________ >>> Biococoa-dev mailing list >>> Biococoa-dev at bioinformatics.org >>> https://bioinformatics.org/mailman/listinfo/biococoa-dev >>> >> >> >> Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm >> >> _______________________________________________ >> Biococoa-dev mailing list >> Biococoa-dev at bioinformatics.org >> https://bioinformatics.org/mailman/listinfo/biococoa-dev >> > > ********************************************************* > ** Alexander Griekspoor ** > ********************************************************* > The Netherlands Cancer Institute > Department of Tumorbiology (H4) > Plesmanlaan 121, 1066 CX, Amsterdam > Tel: + 31 20 - 512 2023 > Fax: + 31 20 - 512 2029 > AIM: mekentosj at mac.com > E-mail: a.griekspoor at nki.nl > Web: http://www.mekentosj.com > > Windows is a 32-bit patch to a 16-bit shell for an 8-bit > operating system, written for a 4-bit processor by a 2- > bit company without 1 bit of sense. > > ********************************************************* > > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm From mek at mekentosj.com Tue Apr 18 16:01:21 2006 From: mek at mekentosj.com (Alexander Griekspoor) Date: Tue, 18 Apr 2006 22:01:21 +0200 Subject: [Biococoa-dev] WWDC In-Reply-To: <990FFEC4-0754-41A6-996E-BE170E17C541@bio.kuleuven.be> References: <32CB808B-609E-4F40-83BB-A1A4FFE1D8FD@bioworxx.com> <09B57FE0-6759-4ED1-8E91-7904C1D6739C@mekentosj.com> <990FFEC4-0754-41A6-996E-BE170E17C541@bio.kuleuven.be> Message-ID: <1B522420-4600-48C7-BD93-D6BB96FC8BCE@mekentosj.com> Well we should both know right ;-) Something with a cube? ;-) On 18-apr-2006, at 21:57, Peter Schols wrote: > Trick? I would be very interested to learn that trick ;-) > (really!) > > > On 18 Apr 2006, at 20:27, Alexander Griekspoor wrote: > >> Unfortunately we can't go this year (although doubts begin to rise >> again), unless we can pull of the same trick as Peter did last >> year ;-) >> Cheers, >> Alex >> >> On 18-apr-2006, at 20:25, Peter Schols wrote: >> >>> If all goes well, I'm definitely attending >>> >>> Peter >>> >>> On 18 Apr 2006, at 19:11, Philipp Seibel wrote: >>> >>>> Hey, >>>> >>>> is anyone planning to attend this years wwdc? >>>> >>>> Phil >>>> _______________________________________________ >>>> Biococoa-dev mailing list >>>> Biococoa-dev at bioinformatics.org >>>> https://bioinformatics.org/mailman/listinfo/biococoa-dev >>>> >>> >>> >>> Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm >>> >>> _______________________________________________ >>> Biococoa-dev mailing list >>> Biococoa-dev at bioinformatics.org >>> https://bioinformatics.org/mailman/listinfo/biococoa-dev >>> >> >> ********************************************************* >> ** Alexander Griekspoor ** >> ********************************************************* >> The Netherlands Cancer Institute >> Department of Tumorbiology (H4) >> Plesmanlaan 121, 1066 CX, Amsterdam >> Tel: + 31 20 - 512 2023 >> Fax: + 31 20 - 512 2029 >> AIM: mekentosj at mac.com >> E-mail: a.griekspoor at nki.nl >> Web: http://www.mekentosj.com >> >> Windows is a 32-bit patch to a 16-bit shell for an 8-bit >> operating system, written for a 4-bit processor by a 2- >> bit company without 1 bit of sense. >> >> ********************************************************* >> >> >> _______________________________________________ >> Biococoa-dev mailing list >> Biococoa-dev at bioinformatics.org >> https://bioinformatics.org/mailman/listinfo/biococoa-dev > > > Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com Windows is a 32-bit patch to a 16-bit shell for an 8-bit operating system, written for a 4-bit processor by a 2- bit company without 1 bit of sense. ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: From peter.schols at bio.kuleuven.be Tue Apr 18 16:11:05 2006 From: peter.schols at bio.kuleuven.be (Peter Schols) Date: Tue, 18 Apr 2006 22:11:05 +0200 Subject: [Biococoa-dev] WWDC In-Reply-To: <1B522420-4600-48C7-BD93-D6BB96FC8BCE@mekentosj.com> References: <32CB808B-609E-4F40-83BB-A1A4FFE1D8FD@bioworxx.com> <09B57FE0-6759-4ED1-8E91-7904C1D6739C@mekentosj.com> <990FFEC4-0754-41A6-996E-BE170E17C541@bio.kuleuven.be> <1B522420-4600-48C7-BD93-D6BB96FC8BCE@mekentosj.com> Message-ID: Oh, OK, *that* trick ;-)) Seriously: aren't you guys elegible for a student scholarship? On 18 Apr 2006, at 22:01, Alexander Griekspoor wrote: > Well we should both know right ;-) Something with a cube? ;-) > > On 18-apr-2006, at 21:57, Peter Schols wrote: > >> Trick? I would be very interested to learn that trick ;-) >> (really!) >> >> >> On 18 Apr 2006, at 20:27, Alexander Griekspoor wrote: >> >>> Unfortunately we can't go this year (although doubts begin to >>> rise again), unless we can pull of the same trick as Peter did >>> last year ;-) >>> Cheers, >>> Alex >>> >>> On 18-apr-2006, at 20:25, Peter Schols wrote: >>> >>>> If all goes well, I'm definitely attending >>>> >>>> Peter >>>> >>>> On 18 Apr 2006, at 19:11, Philipp Seibel wrote: >>>> >>>>> Hey, >>>>> >>>>> is anyone planning to attend this years wwdc? >>>>> >>>>> Phil >>>>> _______________________________________________ >>>>> Biococoa-dev mailing list >>>>> Biococoa-dev at bioinformatics.org >>>>> https://bioinformatics.org/mailman/listinfo/biococoa-dev >>>>> >>>> >>>> >>>> Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm >>>> >>>> _______________________________________________ >>>> Biococoa-dev mailing list >>>> Biococoa-dev at bioinformatics.org >>>> https://bioinformatics.org/mailman/listinfo/biococoa-dev >>>> >>> >>> ********************************************************* >>> ** Alexander Griekspoor ** >>> ********************************************************* >>> The Netherlands Cancer Institute >>> Department of Tumorbiology (H4) >>> Plesmanlaan 121, 1066 CX, Amsterdam >>> Tel: + 31 20 - 512 2023 >>> Fax: + 31 20 - 512 2029 >>> AIM: mekentosj at mac.com >>> E-mail: a.griekspoor at nki.nl >>> Web: http://www.mekentosj.com >>> >>> Windows is a 32-bit patch to a 16-bit shell for an 8-bit >>> operating system, written for a 4-bit processor by a 2- >>> bit company without 1 bit of sense. >>> >>> ********************************************************* >>> >>> >>> _______________________________________________ >>> Biococoa-dev mailing list >>> Biococoa-dev at bioinformatics.org >>> https://bioinformatics.org/mailman/listinfo/biococoa-dev >> >> >> Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm >> >> _______________________________________________ >> Biococoa-dev mailing list >> Biococoa-dev at bioinformatics.org >> https://bioinformatics.org/mailman/listinfo/biococoa-dev >> > > ********************************************************* > ** Alexander Griekspoor ** > ********************************************************* > The Netherlands Cancer Institute > Department of Tumorbiology (H4) > Plesmanlaan 121, 1066 CX, Amsterdam > Tel: + 31 20 - 512 2023 > Fax: + 31 20 - 512 2029 > AIM: mekentosj at mac.com > E-mail: a.griekspoor at nki.nl > Web: http://www.mekentosj.com > > Windows is a 32-bit patch to a 16-bit shell for an 8-bit > operating system, written for a 4-bit processor by a 2- > bit company without 1 bit of sense. > > ********************************************************* > > > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm From kvddrift at earthlink.net Tue Apr 18 18:26:15 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Tue, 18 Apr 2006 18:26:15 -0400 Subject: [Biococoa-dev] WWDC In-Reply-To: <32CB808B-609E-4F40-83BB-A1A4FFE1D8FD@bioworxx.com> References: <32CB808B-609E-4F40-83BB-A1A4FFE1D8FD@bioworxx.com> Message-ID: On Apr 18, 2006, at 1:11 PM, Philipp Seibel wrote: > is anyone planning to attend this years wwdc? Nope - no tricks up my sleeve ;-) - Koen. From kvddrift at earthlink.net Fri Apr 21 22:12:44 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Fri, 21 Apr 2006 22:12:44 -0400 Subject: [Biococoa-dev] calculating symbols per column Message-ID: <0BFCA723-1604-4A11-ACC7-E8ED798B742C@earthlink.net> Hi, I have been puzzling a bit with some code to set the number of symbols per column in the BCSequenceView, right now it is hard coded to 10, but it would be nice if we make this flexible. Instead of the number of symbols in a column, the textContainer for the sequenceView needs to know the actual width of that particular number of symbols. Assuming we are using a monospaced font and don't mix lower and uppercase strings, I came up with the following code. First get the width of each character, this can be done in two ways (I am not sure which ones of the two to choose): float characterWidth = [[self font] boundingRectForFont].size.width; OR: float characterWidth = [[self font] maximumAdvancement].width; Then from that calculate the width of the column: float columnWidth = (float) (symbolsPerColumn * characterWidth ); And pass it to the textContainer and layoutManager: [(BCSequenceViewContainer *) [self textContainer] setColumnWidth: columnWidth]; [(BCSequenceViewLayoutManager *) [self layoutManager] setSymbolsPerColumn: symbolsPerColumn]; As you may have guessed, that doesn't work as expected, I get more than the expected number of symbols in a column. Also the selection code gets screwed up a bit. Any suggestions/ideas? cheers, - Koen. From kvddrift at earthlink.net Sun Apr 23 16:10:03 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Sun, 23 Apr 2006 16:10:03 -0400 Subject: [Biococoa-dev] translation bug Message-ID: <15E0E48B-72FC-4504-A93D-D9FD92597A16@earthlink.net> Hi, When running the Translation demo, every DNA sequence that is entered only returns one amino acid for the translated protein. So I have been trying to find out why this happens. I have narrowed it down to BCSequenceCodon's longestOpenReadingFrame: method, which will always return a holdingRange with a length of one, possibly because openReadingFramesLongerThanCutoff: returns a wrong value. My knowledge of this particular part of the code is limited, so if anyone feels to jump in and have a look if they see what is going on, please go ahead ;-) cheers, - Koen. From peter.schols at bio.kuleuven.be Thu Apr 27 04:35:08 2006 From: peter.schols at bio.kuleuven.be (Peter Schols) Date: Thu, 27 Apr 2006 10:35:08 +0200 Subject: [Biococoa-dev] calculating symbols per column Message-ID: <5F6099EF-D67F-4F81-90CC-22F0EDBBE9F1@bio.kuleuven.be> From: Alexander Griekspoor Date: 27 april 2006 9:23:03 GMT+02:00 To: Koen van der Drift Cc: BioCocoa Mailinglist Subject: Re: [Biococoa-dev] calculating symbols per column Hi Koen, I have to tell a little secret, these were the things I did in first instance when I started with the textview column modifications, but indeed I found out that it didn't work, hence I decided to hardcode the wide. What I think goes wrong is that we miss things like paragraph style etc. Perhaps we should play with an attributed string, and/or ask/search the cocoadev list.. Cheers, Alex On 22-apr-2006, at 4:12, Koen van der Drift wrote: Hi, I have been puzzling a bit with some code to set the number of symbols per column in the BCSequenceView, right now it is hard coded to 10, but it would be nice if we make this flexible. Instead of the number of symbols in a column, the textContainer for the sequenceView needs to know the actual width of that particular number of symbols. Assuming we are using a monospaced font and don't mix lower and uppercase strings, I came up with the following code. First get the width of each character, this can be done in two ways (I am not sure which ones of the two to choose): float characterWidth = [[self font] boundingRectForFont].size.width; OR: float characterWidth = [[self font] maximumAdvancement].width; Then from that calculate the width of the column: float columnWidth = (float) (symbolsPerColumn * characterWidth ); And pass it to the textContainer and layoutManager: [(BCSequenceViewContainer *) [self textContainer] setColumnWidth: columnWidth]; [(BCSequenceViewLayoutManager *) [self layoutManager] setSymbolsPerColumn: symbolsPerColumn]; As you may have guessed, that doesn't work as expected, I get more than the expected number of symbols in a column. Also the selection code gets screwed up a bit. Any suggestions/ideas? cheers, - Koen. _______________________________________________ Biococoa-dev mailing list Biococoa-dev at bioinformatics.org https://bioinformatics.org/mailman/listinfo/biococoa-dev ************************************************************** ** Alexander Griekspoor ** ************************************************************** The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com MacOS X: The power of UNIX with the simplicity of the Mac *************************************************************** ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com Windows is a 32-bit patch to a 16-bit shell for an 8-bit operating system, written for a 4-bit processor by a 2- bit company without 1 bit of sense. ********************************************************* Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm From kvddrift at earthlink.net Thu Apr 27 05:39:32 2006 From: kvddrift at earthlink.net (Koen van der Drift) Date: Thu, 27 Apr 2006 05:39:32 -0400 Subject: [Biococoa-dev] calculating symbols per column In-Reply-To: <1E154E98-0C5B-4C4B-894F-B2E9C3A65C25@mekentosj.com> References: <0BFCA723-1604-4A11-ACC7-E8ED798B742C@earthlink.net> <1E154E98-0C5B-4C4B-894F-B2E9C3A65C25@mekentosj.com> Message-ID: <1E89FA58-F26A-4D6E-BEEE-D8ACB8C01D97@earthlink.net> On Apr 27, 2006, at 3:23 AM, Alexander Griekspoor wrote: > I have to tell a little secret, these were the things I did in > first instance when I started with the textview column > modifications, but indeed I found out that it didn't work, hence I > decided to hardcode the wide. What I think goes wrong is that we > miss things like paragraph style etc. Perhaps we should play with > an attributed string, and/or ask/search the cocoadev list.. > That may very well be the case. For now, lets stick with the hardcoded 10 symbols per column, I guess that is what most people will use. Maybe we should add the option to have no columns. For the purpose of the framework, right now I'd rather focus my attention on the BCFoundation part and try to get that in a shape that is usable and can be released as v2.0. - Koen. From mek at mekentosj.com Thu Apr 27 05:40:56 2006 From: mek at mekentosj.com (Alexander Griekspoor) Date: Thu, 27 Apr 2006 11:40:56 +0200 Subject: [Biococoa-dev] calculating symbols per column In-Reply-To: <1E89FA58-F26A-4D6E-BEEE-D8ACB8C01D97@earthlink.net> References: <0BFCA723-1604-4A11-ACC7-E8ED798B742C@earthlink.net> <1E154E98-0C5B-4C4B-894F-B2E9C3A65C25@mekentosj.com> <1E89FA58-F26A-4D6E-BEEE-D8ACB8C01D97@earthlink.net> Message-ID: <754E8407-28D7-4B91-80BE-7B85307D66BE@mekentosj.com> Good plan! On 27-apr-2006, at 11:39, Koen van der Drift wrote: > > On Apr 27, 2006, at 3:23 AM, Alexander Griekspoor wrote: > >> I have to tell a little secret, these were the things I did in >> first instance when I started with the textview column >> modifications, but indeed I found out that it didn't work, hence I >> decided to hardcode the wide. What I think goes wrong is that we >> miss things like paragraph style etc. Perhaps we should play with >> an attributed string, and/or ask/search the cocoadev list.. >> > > That may very well be the case. For now, lets stick with the > hardcoded 10 symbols per column, I guess that is what most people > will use. Maybe we should add the option to have no columns. For > the purpose of the framework, right now I'd rather focus my > attention on the BCFoundation part and try to get that in a shape > that is usable and can be released as v2.0. > > - Koen. > _______________________________________________ > Biococoa-dev mailing list > Biococoa-dev at bioinformatics.org > https://bioinformatics.org/mailman/listinfo/biococoa-dev > ********************************************************* ** Alexander Griekspoor ** ********************************************************* The Netherlands Cancer Institute Department of Tumorbiology (H4) Plesmanlaan 121, 1066 CX, Amsterdam Tel: + 31 20 - 512 2023 Fax: + 31 20 - 512 2029 AIM: mekentosj at mac.com E-mail: a.griekspoor at nki.nl Web: http://www.mekentosj.com LabAssistant - Get your life organized! http://www.mekentosj.com/labassistant ********************************************************* -------------- next part -------------- An HTML attachment was scrubbed... URL: