[Biococoa-dev] Re: GDE format

[Peter Schols]

Hi Koen,

I implemented the second format indeed, because that is the format  
most people in the lab (and on the net) seemed to use. I haven't used  
the format myself though, so I don't know much more about these two  
subformats.

best wishes,

Peter


On 07 Apr 2006, at 01:48, Koen van der Drift wrote:

> Hi,
>
> I am now working on moving some more formats from BCReader to  
> BCSequenceReader. For the GDE format, I looked on the web, and  
> found actually two different possibilities. The first one:
>
> {
> name "Short name for sequence"
> longname "Long (more descriptive) name for sequence"
> sequence-ID "Unique ID number"
> creation-date "mm/dd/yy hh:mm:ss"
> direction [-1|1]
> strandedness [1|2]
> type [DNA|RNA||PROTEIN|TEXT|MASK]
> offset (-999999,999999)
> group-ID (0,999)
> creator "Author's name"
> descrip "Verbose description"
> comments "Lines of comments that can be fairly arbitrary text about  
> a sequence. Return characters are allowed, but no internal double  
> quotes or brace characters. Remember to close with a double quote"
> sequence "gctagctagctagctagctcttagctgtagtcgtagctgatgctagct  
> gatgctagctagctagctagctgatcgatgctagctgatcgtagctgacg  
> gactgatgctagctagctagctagctgtctagtgtcgtagtgcttattgc"
> }
>
>
> but also:
> #sf170-A3
>
> atgggaccagagtctaaagccatgtgtaaagttaacccctctctgcgttactttaaattgtagccat--- 
> aa catcaccacc---------------------------------
>
> #br20-B1
>
> atgggatcaaagcctaaagccttgtgtaaagttaaccccactctgtgttactttaaattgcattgatttg 
> aa t------------------------------------ 
> aatagtactaacaacaataatagtagtggggtaaa
>
>
>
> The second one seems to be what Peter added to BCReader. I am not  
> familiar with that format, so just wanted to check which one to use.
>
> cheers,
>
>
>
> - Koen.
>


Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm