[meltsim] Re: [Fwd: [meltsim] Information]

[J.W. Bizzaro]

Carla Clemente wrote:
> 
> If I open the test sequence file using the Melt program and press begin in
> melt menu, appears an application error "......'0,075' is  not a valid
> floating point value" even if I try to change this value.

Are you trying to open the file that I sent with Melt?  As I mentioned, the
file I sent is annotated.  It needs to be Compiled first into raw DNA
sequences.

As another test, you can just create a text file filled with
"ACGTAGCAGCACGTATTAGACGAT", and open with Melt.

Hmmmm, but seeing that '0,075' value, I wonder if you're using non-English
decimal notation.  You should try entering 0.075.

Cheers.
Jeff
-- 
J.W. Bizzaro                                jeff at bioinformatics.org
Director, Bioinformatics.Org        http://bioinformatics.org/~jeff
"As we enjoy great advantages from the inventions of others, we
should be glad of an opportunity to serve others by any invention
of ours; and this we should do freely and generously."
                   -- Benjamin Franklin
--