[ssml] formatdb modifying subject id

Robert Citek rwcitek at alum.calberkeley.org
Tue Mar 2 12:04:40 EST 2004


Hello all,

Got this strange behaviour with NCBI's formatdb where it adds a  
vertical bar "|" to the end of the subject id.  The vertical bar  
appears both in a blast report and in the output from a fastacmd.   
Below is a sample fasta file with the corresponding formatdb, fastacmd,  
and blast commands.  This is the formatdb from 2003.04.21.

With WU-BLAST the subject id is unmodified.

Has anyone else seen similar behaviour?  Thought I'd get some feedback  
before I write the NCBI.

Regards,
- Robert

-----

$ cat foo.fasta
 >gi|12345678|gb|AB123456.1 bogus sequence
TTTGGTAGCTGCCGCTGGTCGCCTGTCGAAAGTGTGGCCTCAGCTGAACG
TTTGGTAGCTGCCGCTGGTCGCCTGTCGAAAGTGTGGCCTCAGCTGAACG
TTTGGTAGCTGCCGCTGGTCGCCTGTCGAAAGTGTGGCCTCAGCTGAACG
TTTGGTAGCTGCCGCTGGTCGCCTGTCGAAAGTGTGGCCTCAGCTGAACG
TTTGGTAGCTGCCGCTGGTCGCCTGTCGAAAGTGTGGCCTCAGCTGAACG
TTTGGTAGCTGCCGCTGGTCGCCTGTCGAAAGTGTGGCCTCAGCTGAACG

$ formatdb -t foo -i foo.fasta -l foo.log -p F -o T -n foo
$ fastacmd -D -d foo
 >gi|12345678|gb|AB123456.1| bogus sequence
TTTGGTAGCTGCCGCTGGTCGCCTGTCGAAAGTGTGGCCTCAGCTGAACGTTTGGTAGCTGCCGCTGGTCGC 
CTGTCGAA
AGTGTGGCCTCAGCTGAACGTTTGGTAGCTGCCGCTGGTCGCCTGTCGAAAGTGTGGCCTCAGCTGAACGTT 
TGGTAGCT
GCCGCTGGTCGCCTGTCGAAAGTGTGGCCTCAGCTGAACGTTTGGTAGCTGCCGCTGGTCGCCTGTCGAAAG 
TGTGGCCT
CAGCTGAACGTTTGGTAGCTGCCGCTGGTCGCCTGTCGAAAGTGTGGCCTCAGCTGAACG

$ blastall -p blastn -i foo.fasta -d foo -m 8
gi|12345678|gb|AB123456.1       gi|12345678|gb|AB123456.1|      100.00   
300     0       0     1300     1       300     6e-175  595.2




More information about the ssml-general mailing list