//Written by Paul Stothard, University of Alberta, Canada

function randomCodingDna (theDocument) {

	var maxInput = 4000;

	if (testScript() == false) {
		return false;
	}
	
	var enteredNumber = (theDocument.forms[0].elements[0].value).replace(/[^\d]/g,"");
	if ((checkFormElement (theDocument.forms[0].elements[0]) == false) || (verifyMaxDigits (enteredNumber, maxInput) == false))	{
		return false;
	}

	var seqNum = parseInt(theDocument.forms[0].elements[5].options[theDocument.forms[0].elements[5].selectedIndex].value);
	var geneticCode = getGeneticCodeString(theDocument.forms[0].elements[4].options[theDocument.forms[0].elements[4].selectedIndex].value);	
	geneticCode = geneticCode.split(/,/);
	var codonListSet = new GeneticCode(geneticCode);
	codonListSet.parseGeneticCodeArray();

	openWindow("Random Coding DNA");
	openPre();
	for (var i=1; i <= seqNum; i++) {
		outputWindow.document.write ('&gt;' + 'random coding sequence ' + i + ' consisting of ' + (enteredNumber * 3)+ ' bases.\n');
		writeRandomCodingDna(codonListSet.startCodons, codonListSet.stopCodons, codonListSet.codingCodons, enteredNumber);
		outputWindow.document.write ("\n");
	}
	closePre();
	closeWindow();
    	return true;
}

function writeRandomCodingDna (startCodons, stopCodons, codingCodons, lengthInCodons)	{
	var sequence = "";
	var tempNum = 0;
	var tempChar = "";

	lengthInCodons = parseInt(lengthInCodons);
	
	//add start codon
	if (lengthInCodons > 0) {
		tempNum = Math.round((Math.random() * startCodons.length));
		if (tempNum == startCodons.length)	{
			tempNum = 0;
		}
		sequence = sequence + startCodons[tempNum];
	}

	//add coding codons
	for (var j = 0; j < lengthInCodons - 2; j++)	{
		tempNum = Math.round((Math.random() * codingCodons.length));
		if (tempNum == codingCodons.length)	{
			tempNum = 0;
		}
		sequence = sequence + codingCodons[tempNum];
		if (sequence.length == 60)	{
			outputWindow.document.write(sequence +'\n');
			sequence = "";
		}
	}
	
	//add stop codon
	if (lengthInCodons > 1) {
		tempNum = Math.round((Math.random() * stopCodons.length));
		if (tempNum == stopCodons.length)	{
			tempNum = 0;
		}
		sequence = sequence + stopCodons[tempNum];
	}	

	outputWindow.document.write(sequence + '\n');
	return true;
}

//class GeneticCode method parseGeneticCodeArray()
function parseGeneticCodeArray() {
	var codonSequence = "gggggaggtggcgaggaagatgacgtggtagttgtcgcggcagctgccaggagaagtagcaagaaaaataacatgataattatcacgacaactacctggtgatgttgctagtaatattacttgttatttttctcgtcatcttcccggcgacgtcgccagcaacatcacctgctacttctcccgccacctccc";
	var proteinSequence;
	var geneticCodeMatchExp = getGeneticCodeMatchExp (this.geneticCodeArray);
	var geneticCodeMatchResult = getGeneticCodeMatchResult (this.geneticCodeArray);

	codonSequence = codonSequence.replace(/(...)/g, 
                    function (str, p1, offset, s) {
                      	return " " + p1 + " ";
                   }
        );

	var codonSequenceCopy = codonSequence;

	for (var i = 0; i < geneticCodeMatchExp.length; i++)	{
		codonSequence = codonSequence.replace(geneticCodeMatchExp[i], geneticCodeMatchResult[i]);
	}
	var codonArray = codonSequenceCopy.split(/\s+/);

	codonSequence = codonSequence.replace(/\*/g, "Z");
	var proteinArray = codonSequence.split(/\s+/);

	for (var i = 0; i < codonArray.length; i++)	{
		//on some systems there will be empty items because of split function
		if ((proteinArray[i] == "") && (codonArray[i] == "")) {
			continue;
		}
		if (proteinArray[i].toLowerCase() == "z") {
			this.stopCodons.push(codonArray[i]);	
		}
		else if (proteinArray[i].toLowerCase() == "m") {
			this.startCodons.push(codonArray[i]);
			this.codingCodons.push(codonArray[i]);
		}
		else {
			this.codingCodons.push(codonArray[i]);
		}
		
	}
}

//class GeneticCode
function GeneticCode (geneticCodeArray) {
	this.geneticCodeArray = geneticCodeArray;
	this.startCodons = new Array();
	this.stopCodons = new Array();
	//coding will include starts
	this.codingCodons = new Array();
}

//create and throw away a prototype object
new GeneticCode();

// define object methods
GeneticCode.prototype.parseGeneticCodeArray = parseGeneticCodeArray;