|
These datas are free for academic use only, please contact me for any other use. Takifugu rubripes see consensus multiple alignment with clustalw Direct access to contigs :
consensusID : consensus_0#0 NCBI blastX ! send the sequence to the NCBI site ! NCBI blastN ! send the sequence to the NCBI site ! Sequences nbr = 1 consensus length = 71 fasta sequence
[TGAGATTCAAGCATTTCATCAAAGGGATTGTTGATCCCACTGTATTTTGGAACGAAATATGCATTAAAATG]
[+] EMBL CA847284 [TGAGATTCAAGCATTTCATCAAAGGGATTGTTGATCCCACTGTATTTTGGAACGAAATATGCATTAAAATG]
clustalw multiple alignements is not computed in this case |
|||||||
| Data build on Sat Aug 9 00:50:02 CEST 2003 by Hubert Wassner (hubert.wassner@noos.fr) |