Home
Who am I
Technology
EST Assembly
Contact

These datas are free for academic use only, please contact me for any other use.

Takifugu rubripes
cluster # 1062 cluster # 1062       Sequences # 2       consensus # 1


see consensus multiple alignment with clustalw

Direct access to contigs :
consensus_1062#0 length = 672 sequences # 2  

consensusID : consensus_1062#0
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 2
consensus length = 672
fasta sequence
                              [CAGTTTCCGTTAGTTTGACTTGCAAATCTCCCCCTCGCGTGAAACGGTGGCGCTTTTCCTCCCGTATTCAACAGAGGACACATTTGTAGTCTCGGATTACCCTCGGGTGTGAAGAGTAGCTGTGTTGAAGGCGAAGGAGCCGCTAACGTACAAGGCGTTCCCGCTGGACCGCAGCTCAACTCCCGGCCGAGGCCCAGCACTGAGCACGAGCGGCGGCTCCAAAAGTTTGTTGTTGTCACGTGATGTGATACGAACGTGGCTGTAAAAGTTTGCTTAGATAGTAAAACTGCGTGAGTGCGGCATCATCAAAACTGCTCGGATACCATTTTCACTACAATGCCGCAGCCAAAACACCGAAAGATTGCTGTTATAGGTTACAGGTCCGTGGGAAAGTCTTCTCTTACCATACAGTTTGTGGAGGGACAGTTTGTTGACTCCTATGACCCCACCATTGAAAATACATTTAACAAATTGGTCACTGTGAACAGTCAAGACTTCAATCTTCAGCTGGTTGATACAGCTGGACAAGATGAATACTCAATTTTTCATCAATCCCATTCGATGGACATTCATGGGTATGTCCTTGTATATTCGGTGACTTCCATGAAAAGTTTTGAAGTTGTGCAGTCTCTCCATGAGAAGCTGCTGGACATGGTTGGGAAAATTCAGGTC]

[+] EMBL BU804773             [CAGTTTCCGTTAGTTTGACTTGCAAATCTCCCCCTCGCGTGAAACGGTGGCGCTTTTCCTCCCGTATTCAACAGAGGACACATTTGTAGTCTCGGATTACCCTCGGGTGTGAAGAGTAGCTGTGTTGAAGGCGAAGGAGCCGCTAACGTACAAGGCGTTCCCGCTGGACCGCAGCTCAACTCCCGGCCGAGGCCCAGCACTGAGCACGAGCGGCGGCTCCAAAAGTTTGTTGTTGTCACGTGATGTGATACGAACGTGGCTGTAAAAGTTTGCTTAGATAGTAAAACTGCGTGAGTGCGGCATCATCAAAACTGCTCGGATACCATTTTCACTACAATGCCGCAGCCAAAACACCGAAAGATTGCTGTTATAGGTTACAGGTCCGTGGGAAAGTCTTCTCTTACCATACAGTTTGTGGAGGGACAGTTTGTTGACTCCTATGACCCCACCATTGAAAATACATTTAACAAATTGGTCACTGTGAACAGTCAAGACTTCAATCTTCAGCTGGTTGATACAGCTGGACAAGATGAATACTCAATTTTTCATCAATCCCATTCGATGGACATTCATGGGTATGTCCTTGTATATTCGGTGACTTCCATGAAAAGTTTTGAAGTTGTGCAGTCTCTCCATGAGAAGCTGCTGGACATGGTTGGGAAAATTCAGGTC]
[+] EMBL FR0060163            [                                                                                            CGGATTACCCTCGGGTGTGAAGAGTAGCTGTGTTGAAGGCGAAGGAGCCGCTAACGTACAAGGCGTTCCCGCTGGACCGCAGCTCAACTCCCGGCCGAGGCCCAGCACTGAGCACGAGCGGCGGCTCCAAAAGTTTGTTGTTGTCACGTGATGTGATACGAACGTGGCTGTAAAAGTTTGCTTAGATAGTAAAACTGCGTGAGTGCGGCATCATCAAAACTGCTCGGATACCATTTTCACTACAATGCCGCAGCCAAAACACCGAAAG                                                                                                                                                                                                                                                                                                                        ]


>consensus_1062#0 CAGTTTCCGTTAGTTTGACTTGCAAATCTCCCCCTCGCGTGAAACGGTGGCGCTTTTCCT CCCGTATTCAACAGAGGACACATTTGTAGTCTCGGATTACCCTCGGGTGTGAAGAGTAGC TGTGTTGAAGGCGAAGGAGCCGCTAACGTACAAGGCGTTCCCGCTGGACCGCAGCTCAAC TCCCGGCCGAGGCCCAGCACTGAGCACGAGCGGCGGCTCCAAAAGTTTGTTGTTGTCACG TGATGTGATACGAACGTGGCTGTAAAAGTTTGCTTAGATAGTAAAACTGCGTGAGTGCGG CATCATCAAAACTGCTCGGATACCATTTTCACTACAATGCCGCAGCCAAAACACCGAAAG ATTGCTGTTATAGGTTACAGGTCCGTGGGAAAGTCTTCTCTTACCATACAGTTTGTGGAG GGACAGTTTGTTGACTCCTATGACCCCACCATTGAAAATACATTTAACAAATTGGTCACT GTGAACAGTCAAGACTTCAATCTTCAGCTGGTTGATACAGCTGGACAAGATGAATACTCA ATTTTTCATCAATCCCATTCGATGGACATTCATGGGTATGTCCTTGTATATTCGGTGACT TCCATGAAAAGTTTTGAAGTTGTGCAGTCTCTCCATGAGAAGCTGCTGGACATGGTTGGG AAAATTCAGGTC



clustalw multiple alignements is not computed in this case


Data build on Sat Aug 9 00:50:02 CEST 2003 by Hubert Wassner    (hubert.wassner@noos.fr)