Home
Who am I
Technology
EST Assembly
Contact

These datas are free for academic use only, please contact me for any other use.

Takifugu rubripes
cluster # 2216 cluster # 2216       Sequences # 4       consensus # 3


see consensus multiple alignment with clustalw

Direct access to contigs :
consensus_2216#0 length = 788 sequences # 2  
consensus_2216#1 length = 515 sequences # 1  
consensus_2216#2 length = 365 sequences # 1  

consensusID : consensus_2216#0
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 2
consensus length = 788
fasta sequence
                              [CAATTCCTGGCTGCTTCGCGGCCTCCGCCTGCCGAGAATTAATATCTGTCAAATGGGATCGATTGCTTTTATCGACGAAAAAGCTGACTGTGACGTGTTGACGCTGCTGATCTCAGGATGGGCCTGTCCTCCTTATTTGATGACCCTCAGCTCTCCTCCTCCTCAGAAACCCCCCTTTCCTCTCAGACTCTCCCTCCAATCACGGAATTTCTGGCTGAGCTGCAGAAGAAACTGCTTAATATGTTGTCATACTCTGAAACGCTCCATCTGATTGGTCATGTGGCGAATCTTTTCCAAACCGCTGATCCTGATTGGTTGTTCAGTCCAAGTAGTGGGTTAGCAGAACTTCAGGTCGAGTACAACGCTGTGGTAAAGGCTCTGGTAAGAGTTGCTGCTCTACCGCTCTGTGAGGATGACTATGGCTCGTTACCTGCTGCCACCTATCAGAGTATTCCATATCAAGCTGTCACAGTATGCTCCGCTCTCACAGCACTACTGGAAACTCTGGGAAACAGGGGTGTTCAGACTGGCATTCCACTGACCATAGCTCCCTCTGTGTTAGTGTTTGCTGTCACACACTTTCAGGATCAGCCTTGGACCAACTCTGTCTCCAGAGCTGCAGCCAGAAACCTGCAGGAGGTGCTCCTCAGGGCAGGGGGCTGGAGAGATTCTGGCCACCTCCTGACAGGGGAAAACAATGGAGTTCTAGGAAAAATCCTGGACATCCTGCAACCTCAAATGACCCAAACCATGTGGCAGCGGTGTGAAGCAGTGAAGTTTGTTTATGT]

[+] EMBL CA846059             [CAATTCCTGGCTGCTTCGCGGCCTCCGCCTGCCGAGAATTAATATCTGTCAAATGGGATCGATTGCTTTTATCGACGAAAAAGCTGACTGTGACGTGTTGACGCTGCTGATCTCAGGATGGGCCTGTCCTCCTTATTTGATGACCTTCAGCTCTCCTCCTCCTCAGAAACCCCCCTTTCCTCTCAGACTCTCCCTCCAATCACGGAATTTCTGGCTGAGCTGCAGAAGAAACTGCTTAATATGTTGTCATACTCTGAAACGCTCCATCTGATTGGTCATGTGGCGAATCTTTTCCAAACCGCTGATCCTGATTGGTTGTTCAGTCCAAGTAGTGGGTTAGCAGAACTTCAGGTCGAGTACAACGCTGTGGTAAAGGCTCTGGTAAGAGTTGCTGCTCTACCGCTCTGTGAGGATGACTATGGCTCGTTACCTGCTGCCACCTATCAGAGTATTCCATATCAAGCTGTCACAGTATGCTCCGCTCTCACAGCACTACTGGAAACTCTGGGAAACAGGGGTGTTCAGACTGGCATTCCACTGACCATAGCTCCCTCTGTGTTAGTGTTTGCTGTCACACACTTTCAGGATCAGCCTTGGACCAACTCTGTCTCCAGAGCTGCAGCCAGAAACCTGCAGGAGGTGCTCCTCAGGGCAGGGGGCTGGAGAGATTCTGGCCACCTCCTGACAGGGGAAAACAATGGAGTTCTAGGAAAAATCCTGGACATCCTGCAACCTCAAATGACCCAAACCATGTGGCAGCGGTGTGAAGCAGTGAAGTTTGTTTATGT]
[+] EMBL BU807880             [           TGCTTCGCGGCCTCCGCCTGCCGAGAATTAATATCTGTCAAATGGGATCGATTGCTTTTATCGACGAAAAAGCTGACTGTGACGTGTTGACGCTGCTGATCTCAGGATGGGCCTGTCCTCCTTATTTGATGACCCTCAGCTCTCCTCCTCCTCAGAAACCCCCCTTTCCTCTCAGACTCTCCCTCCAATCACGGAATTTCTGGCTGAGCTGCAGAAGAAACTGCTTAATATGTTGTCATACTCTGAAACGCTCCATCTGATTGGTCATGTGGCGAATCTTTTCCAAACCGCTGATCCTGATTGGTTGTTCAGTCCAAGTAGTGGGTTAGCAGAACTTCAGGTCGAGTACAACGCTGTGGTAAAGGCTCTGGTAAGAGTTGCTGCTCTACCGCTCTGTGAGGATGACTATGGCTCGTTACCTGCTGCCACCTATCAGAGTATTCCATATCAAGCTGTCACAGTATGCTCCGCTCTCACAGCACTACTGGAAACTCTGGGAAACAGGGGTGTTCAGACTGGCATTCCACTGA                                                                                                                                                                                                                                                       ]


>consensus_2216#0 CAATTCCTGGCTGCTTCGCGGCCTCCGCCTGCCGAGAATTAATATCTGTCAAATGGGATC GATTGCTTTTATCGACGAAAAAGCTGACTGTGACGTGTTGACGCTGCTGATCTCAGGATG GGCCTGTCCTCCTTATTTGATGACCCTCAGCTCTCCTCCTCCTCAGAAACCCCCCTTTCC TCTCAGACTCTCCCTCCAATCACGGAATTTCTGGCTGAGCTGCAGAAGAAACTGCTTAAT ATGTTGTCATACTCTGAAACGCTCCATCTGATTGGTCATGTGGCGAATCTTTTCCAAACC GCTGATCCTGATTGGTTGTTCAGTCCAAGTAGTGGGTTAGCAGAACTTCAGGTCGAGTAC AACGCTGTGGTAAAGGCTCTGGTAAGAGTTGCTGCTCTACCGCTCTGTGAGGATGACTAT GGCTCGTTACCTGCTGCCACCTATCAGAGTATTCCATATCAAGCTGTCACAGTATGCTCC GCTCTCACAGCACTACTGGAAACTCTGGGAAACAGGGGTGTTCAGACTGGCATTCCACTG ACCATAGCTCCCTCTGTGTTAGTGTTTGCTGTCACACACTTTCAGGATCAGCCTTGGACC AACTCTGTCTCCAGAGCTGCAGCCAGAAACCTGCAGGAGGTGCTCCTCAGGGCAGGGGGC TGGAGAGATTCTGGCCACCTCCTGACAGGGGAAAACAATGGAGTTCTAGGAAAAATCCTG GACATCCTGCAACCTCAAATGACCCAAACCATGTGGCAGCGGTGTGAAGCAGTGAAGTTT GTTTATGT



consensusID : consensus_2216#1
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 1
consensus length = 515
fasta sequence
                              [TTGAAATGTAGGAGATGAGCTACCTTATCTTATTATTTCCTTATTGTGCTAATTTCACTGTCGCACTGACTGGCCTAACGTTTCCGGTTGTCTTGGACAGTCCATGCCCGCCCCCTCCGCGGAGAGTTGATGAGATCTATATATAAACTTCAAAGAGCCGAAACCATGTAAAAAACCAATGGACAAAAGGAAATGATGCATCCCTAAAGAGCAATATCATGATATATGAAACTCTCATTGTCTTGTCATGGAGCTCTTTGAAGACACTTGTGCTGCTGTGATTCTCTTGGACTAACATTTGTTTTATGAAAAGACAAATCTTAAAATGACCTGAATAAGTTATTAAAAAACTATTGTCTTCATGTTAACATCTGACAGCTAACATGTTCTTCCTCCTCTTCTCCTCTATACCTCCTTCTCAGGATGGGCCTGTCCTCCTTATTTGATGACCTTCAGCTCTCCTCCTCCTCAGAAACCCCCCTTTCCTCTCAGACTCTCCCTCCAATCACGGAATT]

[+] EMBL CA588354             [TTGAAATGTAGGAGATGAGCTACCTTATCTTATTATTTCCTTATTGTGCTAATTTCACTGTCGCACTGACTGGCCTAACGTTTCCGGTTGTCTTGGACAGTCCATGCCCGCCCCCTCCGCGGAGAGTTGATGAGATCTATATATAAACTTCAAAGAGCCGAAACCATGTAAAAAACCAATGGACAAAAGGAAATGATGCATCCCTAAAGAGCAATATCATGATATATGAAACTCTCATTGTCTTGTCATGGAGCTCTTTGAAGACACTTGTGCTGCTGTGATTCTCTTGGACTAACATTTGTTTTATGAAAAGACAAATCTTAAAATGACCTGAATAAGTTATTAAAAAACTATTGTCTTCATGTTAACATCTGACAGCTAACATGTTCTTCCTCCTCTTCTCCTCTATACCTCCTTCTCAGGATGGGCCTGTCCTCCTTATTTGATGACCTTCAGCTCTCCTCCTCCTCAGAAACCCCCCTTTCCTCTCAGACTCTCCCTCCAATCACGGAATT]


>consensus_2216#1 TTGAAATGTAGGAGATGAGCTACCTTATCTTATTATTTCCTTATTGTGCTAATTTCACTG TCGCACTGACTGGCCTAACGTTTCCGGTTGTCTTGGACAGTCCATGCCCGCCCCCTCCGC GGAGAGTTGATGAGATCTATATATAAACTTCAAAGAGCCGAAACCATGTAAAAAACCAAT GGACAAAAGGAAATGATGCATCCCTAAAGAGCAATATCATGATATATGAAACTCTCATTG TCTTGTCATGGAGCTCTTTGAAGACACTTGTGCTGCTGTGATTCTCTTGGACTAACATTT GTTTTATGAAAAGACAAATCTTAAAATGACCTGAATAAGTTATTAAAAAACTATTGTCTT CATGTTAACATCTGACAGCTAACATGTTCTTCCTCCTCTTCTCCTCTATACCTCCTTCTC AGGATGGGCCTGTCCTCCTTATTTGATGACCTTCAGCTCTCCTCCTCCTCAGAAACCCCC CTTTCCTCTCAGACTCTCCCTCCAATCACGGAATT



consensusID : consensus_2216#2
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 1
consensus length = 365
fasta sequence
                              [TGCTTTTATCGACGAAAAAGCTGACTGTGACGTGTTGACGCTGCTGATCTCAGCTCTCCTCCTCCTCAGAAACCCCCCTTTCCTCTCAGACTCTCCCTCCAATCACGGAATTTCTGGCTGAGCTGCAGAAGAAACTGCTTAATATGTTGTCATACTCTGAAACGCTCCATCTGATTGGTCATGTGGCGAATCTTTTCCAAACCGCTGATCCTGATTGGGTGTTCAGTCCAAGTAGTGGGTTAGCAGAACTTCAGGTCGAGTACAACGCTGTGGTAAAGGCTCTGGTAAGAGTTGCTGCTCTACCGCTCTGTGAGGATGACTATGGCTCGGTACCTGCTGCCACCTATCAGAGGATTCCATATCAA]

[+] EMBL FR0061666            [TGCTTTTATCGACGAAAAAGCTGACTGTGACGTGTTGACGCTGCTGATCTCAGCTCTCCTCCTCCTCAGAAACCCCCCTTTCCTCTCAGACTCTCCCTCCAATCACGGAATTTCTGGCTGAGCTGCAGAAGAAACTGCTTAATATGTTGTCATACTCTGAAACGCTCCATCTGATTGGTCATGTGGCGAATCTTTTCCAAACCGCTGATCCTGATTGGGTGTTCAGTCCAAGTAGTGGGTTAGCAGAACTTCAGGTCGAGTACAACGCTGTGGTAAAGGCTCTGGTAAGAGTTGCTGCTCTACCGCTCTGTGAGGATGACTATGGCTCGGTACCTGCTGCCACCTATCAGAGGATTCCATATCAA]


>consensus_2216#2 TGCTTTTATCGACGAAAAAGCTGACTGTGACGTGTTGACGCTGCTGATCTCAGCTCTCCT CCTCCTCAGAAACCCCCCTTTCCTCTCAGACTCTCCCTCCAATCACGGAATTTCTGGCTG AGCTGCAGAAGAAACTGCTTAATATGTTGTCATACTCTGAAACGCTCCATCTGATTGGTC ATGTGGCGAATCTTTTCCAAACCGCTGATCCTGATTGGGTGTTCAGTCCAAGTAGTGGGT TAGCAGAACTTCAGGTCGAGTACAACGCTGTGGTAAAGGCTCTGGTAAGAGTTGCTGCTC TACCGCTCTGTGAGGATGACTATGGCTCGGTACCTGCTGCCACCTATCAGAGGATTCCAT ATCAA



consensus multiple alignement with clustalw

CLUSTAL W (1.82) multiple sequence alignment


consensus_2216#0      CAATTCCTGGCTGCTTCGCGGCCTCCGCCTGCCGAGAATTAATATCTGTCAAATGGGATC 60
consensus_2216#2      ------------------------------------------------------------
consensus_2216#1      -------------------------------TTGAAATGTAGGAGATGAGCTACCTTATC 29
                                                                                  

consensus_2216#0      GATTGCTTTTATCGACGAAA-AAGCTGACTGTGACGTGTTGACGCTGCTGATCTCAGGAT 119
consensus_2216#2      ---TGCTTTTATCGACGAAA-AAGCTGACTGTGACGTGTTGACGCTGCTGATCT------ 50
consensus_2216#1      TTATTATTTCCTTATTGTGCTAATTTCACTGT--CGCACTGACTGGCCTAACGTT----- 82
                         *  ***  *    *    **  * *****  **   ****    ** *  *      

consensus_2216#0      GGGCCTGTCCTCCTTATTTGATGACCCTCAGCTCTCCTCCTCCTCAGAAACCCCCC---- 175
consensus_2216#2      ----------------------------CAGCTCTCCTCCTCCTCAGAAACCCCCC---- 78
consensus_2216#1      -------TCCGGTTGTCTTGGACAGTCCATGCCCGCCCCCTCCGCGGAGAGTTGATGAGA 135
                                                    ** * ** ***** * ** *          

consensus_2216#0      TTTCCTCTCAGACTCTCC----CTCCAATCACGGAATTTCTGGCTGAGCTGCAGAAGAAA 231
consensus_2216#2      TTTCCTCTCAGACTCTCC----CTCCAATCACGGAATTTCTGGCTGAGCTGCAGAAGAAA 134
consensus_2216#1      TCTATATATAAACTTCAAAGAGCCGAAACCATGTAAAAAACCAATGGACAAAAGGAAATG 195
                      * *      * ***        *   ** ** * **        **  *   ** * *  

consensus_2216#0      CTGC-TTAATATGTTGTCATACTCTGAAACGCTCCATCTGATTGGTCATGTGGCGAATCT 290
consensus_2216#2      CTGC-TTAATATGTTGTCATACTCTGAAACGCTCCATCTGATTGGTCATGTGGCGAATCT 193
consensus_2216#1      ATGCATCCCTAAAGAGCAATATCATGATATATGAAACTCTCATTGTCTTGTCATGGAGCT 255
                       *** *   **    *  ***   *** *      *      * *** ***   * * **

consensus_2216#0      TTTCCAAACCGCTGATCCTGAT-TGGTTGTTCAGTCCAAGTAGTGGGTTAGCAGAACTTC 349
consensus_2216#2      TTTCCAAACCGCTGATCCTGAT-TGGGTGTTCAGTCCAAGTAGTGGGTTAGCAGAACTTC 252
consensus_2216#1      CTTTGAAGACACTTGTGCTGCTGTGATTCTCTTGGACTAACATTTGTTTTATGAAAAGAC 315
                       **  **  * **  * *** * **  * *   *  * *  * * * **     **   *

consensus_2216#0      AGGTCGAGTACAACGCTGTGGTAAAGGCTCTGGTAAGA-GTTGCTGCTCTACCGCTCTGT 408
consensus_2216#2      AGGTCGAGTACAACGCTGTGGTAAAGGCTCTGGTAAGA-GTTGCTGCTCTACCGCTCTGT 311
consensus_2216#1      AAATC--TTAAAATGACCTGAATAAGTTATTAAAAAACTATTGTCTTCATGTTAACATCT 373
                      *  **   ** ** *   **   ***    *   **    ***      *       * *

consensus_2216#0      GAGGATGACTATGGCTCGTTACCTGCTGCCACCTATCAGAGTATTCCATATCAAGCTGTC 468
consensus_2216#2      GAGGATGACTATGGCTCGGTACCTGCTGCCACCTATCAGAGGATTCCATATCAA------ 365
consensus_2216#1      GACAGCTAACATGTTCTTCCTCCTCTTCTCCTCTATACCTCCTTCTCAGGATGGGCCTGT 433
                      **     *  ***        ***  *  *  ****       *  **            

consensus_2216#0      ACAGTATGCTCCGCTCTCACAGCACTACTGGAAACTCTGGGAAACAGGGGTGTTC--AGA 526
consensus_2216#2      ------------------------------------------------------------
consensus_2216#1      CCTCCTTATTTGATGACCTTCAGCTCTCCTCCTCCTCAGAAACCCCCCTTTCCTCTCAGA 493
                                                                                  

consensus_2216#0      CTGGCATTCCACTGACCATAGCTCCCTCTGTGTTAGTGTTTGCTGTCACACACTTTCAGG 586
consensus_2216#2      ------------------------------------------------------------
consensus_2216#1      CTCTCCCTCCAATCACGGAATT-------------------------------------- 515
                                                                                  

consensus_2216#0      ATCAGCCTTGGACCAACTCTGTCTCCAGAGCTGCAGCCAGAAACCTGCAGGAGGTGCTCC 646
consensus_2216#2      ------------------------------------------------------------
consensus_2216#1      ------------------------------------------------------------
                                                                                  

consensus_2216#0      TCAGGGCAGGGGGCTGGAGAGATTCTGGCCACCTCCTGACAGGGGAAAACAATGGAGTTC 706
consensus_2216#2      ------------------------------------------------------------
consensus_2216#1      ------------------------------------------------------------
                                                                                  

consensus_2216#0      TAGGAAAAATCCTGGACATCCTGCAACCTCAAATGACCCAAACCATGTGGCAGCGGTGTG 766
consensus_2216#2      ------------------------------------------------------------
consensus_2216#1      ------------------------------------------------------------
                                                                                  

consensus_2216#0      AAGCAGTGAAGTTTGTTTATGT 788
consensus_2216#2      ----------------------
consensus_2216#1      ----------------------
                                            




Data build on Sat Aug 9 00:50:02 CEST 2003 by Hubert Wassner    (hubert.wassner@noos.fr)