Home
Who am I
Technology
EST Assembly
Contact

These datas are free for academic use only, please contact me for any other use.

Takifugu rubripes
cluster # 2651 cluster # 2651       Sequences # 10       consensus # 1


see consensus multiple alignment with clustalw

Direct access to contigs :
consensus_2651#0 length = 455 sequences # 10  

consensusID : consensus_2651#0
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 10
consensus length = 455
fasta sequence
                              [TTCCAATCAGTTAATAATTATGCGTAAAAGCAGCTTCGCGACTGCACAAGAATCTCCTTTCTGCAAGTTATTTTCGTTGCGATAATTTGTCTCACGTCTTTTCTCTGCTCTTTCCCAGCGCTCTGTCCGGTCACAAGGCAGCATGCCTCGCAAGATTGAAGAAATCAAAGATTTCCTGCTGACAGCCAGGAGGAAGGATGCCAAGTCCGTAAAGATCAAGAAGAACAAGGACAATGTAAAGTTCAAGGTGCGCTGCAGCAGGTACCTGTACACCCTGGTCATCACAGACAAGGAGAAGGCCGAGAAGCTCAAGCAGTCCCTGCCTCCAGGTCTGGCTGTGAAGGAGCTCAAGTAAAACCACGATGTACAGATAATTGTAATAAAAATTGGAAAAACTCCCG-AAAAAAAAAAAAAAAAAAACCCCGAGGGGGGGCCGGGTACCAAGTTTTGGTCCC]

[+] EMBL CA846688             [TTCCAATCAGTTAATAATTATGCGTAAAAGCAGCTTCGCGACTGCACAAGAATCTCCTTTCTGCAAGTTATTTTCGTTGCGATAATTTGTCTCACGTCTTTTCTCTGCTCTTTCCCAGCGCTCTGTCCGGTCACAAGGCAGCATGCCTCGCAAGATTGAAGAAATCAAAGATTTCCTGCTGACAGCCAGGAGGAAGGATGCCAAGTCCGTAAAGATCAAGAAGAACAAGGACAATGTAAAGTTCAAGGTGCGCTGCAGCAGGTACCTGTACACCCTGGTCATCACACACAAGGAGAAGGCCGAGAAGCTCAAGCAGTCCCTGCCTCCAGGTTTGGCT                                                                                                                       ]
[+] EMBL FR0055921            [                                                                                             ACGTCTTTTCTCTGCTCTTTCCCAGCGCTCTGTCCGGTCACAAGGCAGCATGCCTCGCAAGATTGAAGAAATCAAAGATTTCCTGCTGACAGCCAGGAGGAAGGATGCCAAGTCCGTAAAGATCAAGAAGAACAAGGACAATGTAAAGTTCAAGGTGCGCTGCAGCAGGTACCTGTACACCCTGGTCATCACAGACAAGGAGAAGGCCGAGAAGCTCAAGCAGTCCCTGCCTCCAGGTCTGGCTGTGAAGGAGCTCAAGTAAAACCACGATGTACAGATAATTGTAATAAAAATTGGGAAAACTCCC                                                        ]
[+] EMBL FR0056867            [                                                                                                                              CCGGTCACAAGGCAGCATGCCTCGCAAGATTGAAGAAATCAAAGATTTCCTGCTGACAGCCAGGAGGAAGGATGCCAAGTCCGTAAAGATCAAGAAGAACAAGGACAATGTAAAGTTCAAGGTGCGCTGCAGCAGGTACCTGTACACCCTGGTCATCACAGACAAGGAGAAGGCCGAGAAGCTCAAGCAGTCCCTGCCTCCAGGTCTGGCTGTGAAGGAGCTCAAGTAAAACCACGATGTACAGATAATTGTAATAAAAATTGGAAAAACTCCTG AAAAAAAAAAAAAAAAAAACCCCGAGGGGGG                       ]
[+] EMBL CA845535             [                                                                                                                              CCGGTCACAAGGCAGCATGCCTCGCTAGACTGAAGAAA CAAAGATTTCCTGCTGACAGCCAGGAGGAAGGATGCCAAGTCCGTAAAGATCAAGAAGAACAAGGACAATGTAAAGTTCAAGGTGCGCTGCAGCAGGTACCTGTACACCCTGGTCATCACAGACAAGGAGAAGGCCGAGAAGCTCAAGCAGTCCCTGCCTCCAGGTCTGGCTGTGAAGGAGCTCAAGTAAAACCTCTTTGTACAGATAATTGTAATAAAAATTGGAAAAACTC                                                          ]
[+] EMBL FR0056501            [                                                                                                                                 GTCACAAGGCAGCATGCCTCGCAAGATTGAAGAAATCAAAGATTTCCTGCTGACAGCCAGGAGGAAGGATGCCAAGTCCGTAAAGATCAAGAAGAACAAGGACAATGTAAAGTTCAAGGTGCGCTGCAGCAGGTACCTGTACACCCTGGTCATCACAGACAAGGAGAAGGCCGAGAAGCTCAAGCAGTCCCTGCCTCCAGGTCTGGCTGTGAAGGAGCTCAAGTAAAACCACGATGTACAGATAATTGTAATAAAA                                                                       ]
[+] EMBL FR0056909            [                                                                                                                                                        AGATTGAAGAAATCAAAGATTTCCTGCTGACAGCCAGGAGGAAGGATGCCAAGTCCGTAAAGATCAAGAAGAACAAGGACAATGTAAAGTTCAAGGTGCGCTGCAGCAGGTACCTGTACACCCTGGTCATCACAGACAAGGAGAAGGCCGAGAAGCTCAAGCAGTCCCTGCCTCCAGGTCTGGCTGTGAAGGAGCTCAAGTAAAACCACGATGTACAGATAATTGTAATAAAAATTGGAAAAACTCCCGAAAAAAAAAAAAAAAAAAAACCCCGAGGGGGGGCCCGGTACCAAGTTTTTGTCCC]
[+] EMBL FR0055972            [                                                                                                                                                            TGAAGAAATCAAAGATTTCCTGCTGACAGCCAGGAGGAAGGATGCCAAGTCCGTAAAGATCAAGAAGAACAAGGACAATGTAAAGTTCAAGGTGCGCTGCAGCAGGTACCTGTACACCCTGGTCATCACAGACAAGGAGAAGGCCGAGAAGCTCAAGCAGTCCCTGCCTCCAGGTCTGGCTGTGAAGGAGCTCAAGTAAAACCACGATGTACAGATAATTGTAATAAAAATTGGAAAAACTCCCG  AAAAAAAAAAAAAAAAAACCCCAGGGGGGGCCCGGGTCCCAAGTTTTGGTCC ]
[+] EMBL CA845411             [                                                                                                                                                                 AAATCAAAGATTTCCTGCTGACAGCCAGGAGGAAGGATGCCAAGTCCGTAAAGATCAAGAAGAACAAGGACAATGTAAAGTTCAAGGTGCGCTGCAGCAGGTACCTGTACACCCTGGTCATCACAGACAAGGAGAAGGCCGAGAAGCTCAAGCAGTCCCTGCCTCCAGGTCTGGCT                                                                                                                       ]
[+] EMBL CA330574             [                                                                                                                                                                             TCCTGCTGACAGCCAGGAGGAAGGATGCCAAGTCCGTAAAGATCAAGAAGAACAAGGACAATGTAAAGTTCAAGGTGCGCTGCAGCAGGTACCTGTACACCCTGGTCATCACAGACAAGGAGAAGGCCGAGAAGCTCAAGCAGACCCTGCCTCCAGGTCTGGCT                                                                                                                       ]
[+] EMBL CA330549             [                                                                                                                                                                             TCCTACTGACAGCCAGGAGGAAGGATGCCAAGTCCGTAAAGATCAAGAAGAACAAGGACAATGTAAAGTTCAAGGTGCGCTGCAACAGGTACCTGTACACCCTGGTCATCACAGACAAGGAGAAGGCCGAGAAGCTCAAGCAGTCCCTGCCTCCAGGTCTGGCT                                                                                                                       ]


>consensus_2651#0 TTCCAATCAGTTAATAATTATGCGTAAAAGCAGCTTCGCGACTGCACAAGAATCTCCTTT CTGCAAGTTATTTTCGTTGCGATAATTTGTCTCACGTCTTTTCTCTGCTCTTTCCCAGCG CTCTGTCCGGTCACAAGGCAGCATGCCTCGCAAGATTGAAGAAATCAAAGATTTCCTGCT GACAGCCAGGAGGAAGGATGCCAAGTCCGTAAAGATCAAGAAGAACAAGGACAATGTAAA GTTCAAGGTGCGCTGCAGCAGGTACCTGTACACCCTGGTCATCACAGACAAGGAGAAGGC CGAGAAGCTCAAGCAGTCCCTGCCTCCAGGTCTGGCTGTGAAGGAGCTCAAGTAAAACCA CGATGTACAGATAATTGTAATAAAAATTGGAAAAACTCCCGAAAAAAAAAAAAAAAAAAA CCCCGAGGGGGGGCCGGGTACCAAGTTTTGGTCCC



clustalw multiple alignements is not computed in this case


Data build on Sat Aug 9 00:50:02 CEST 2003 by Hubert Wassner    (hubert.wassner@noos.fr)