Home
Who am I
Technology
EST Assembly
Contact

These datas are free for academic use only, please contact me for any other use.

Takifugu rubripes
cluster # 2862 cluster # 2862       Sequences # 31       consensus # 3


see consensus multiple alignment with clustalw

Direct access to contigs :
consensus_2862#0 length = 1545 sequences # 15  
consensus_2862#1 length = 749 sequences # 15  
consensus_2862#2 length = 249 sequences # 1  

consensusID : consensus_2862#0
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 15
consensus length = 1545
fasta sequence
                              [TTCCCAT--CTGCACACTAGTACCTTCTACCTGACTCATCCTCTATAAGCTGAAGATTCACCATGATCAAAAGAAACTACGGCTTTAGCTACAGGAGCAGTCCTTCTGCCCCGAAGGCGTACAGTGTGTCAGAATTTGGCTTCAGACAGCCCTCCCGCATCTCCTCTGCCAGCGTCCGCACCGTGTCCTCTGGGTATGGAGGTGGTGCTGGGGCTGGTGGTGGTTGCTTTGACTTGTCCAGCGCCCTGGACCTTGGCCAGCGCTCTGGTGGCGTGCAGGTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCAGGGAGTACTACGAGAATAAGGGTCCCGCTGCAGAGAAGGACTACAGCAACTACTGGGCCATCATCAATGACCTGAAGGACAAGATCGCCGCTGCCACCTGTGAAAATGCAAACATCCTGCTCCAGATTGACAACTCCAAACTGGCCGCTGACGACTTCAAGACCAAGTTTGACCATGAGCTGATGATGCGCCAGTCGGTGGAGGCGGACATCGCCAACCTGCGCCGCCTGTTGGACCAGACCACCCTCTCAAAGAGTGACTTGGAGATGCAGATCGAAGGGCTGCAGGATGAGCTGGCCTACCTCAAGAAGAACCATGCAGAGGAGCTGGCAGCGCTGCGCTCTCAGCTTACTGGCACTATCAACGTGGAGGTGGACGCCAAACCCCAGCAAGACCTCAACAGAGTCCTGGACGAGATCCGCTCCCAATACGAGAACATCTGCGACAAACACCGCCGTGAGCAGGAGGCCTGGTTTAATGAGCAGTCGACAGTCTTGAGCAAAGAGGTGGCCATAAGCACAGAAACCCTCCAGACGTCCAAGACAGAGATCACTGACCTGCGGCGCACACTCCAGGGCCTGGAGATTGAACTCCAGTCTCAGCTCAGCATGAAAGGGGCGCTGGAGAACACGTTAGCTGAAACGGATGCACGCTACAGCGCCATGCTCACCACCTTCCAGAGCACCATCAACATGCTGGAGACAGAAATCGGCAACGTGCGCGCCAGCATCGAGCAGCAGGGTCAGGACTACAAGATGCTGCTGGACATCAAGAGCAGGCTGGAGCAGGAGATCGCCACCTACAGGGGCCTTTTGGAGACAGAGGAGTCCAGAACCATCAGCACAGGGGGAATGAAGGCCACAATCACCACCACCACTGTGCGCACTTCCAGCTGAGAGGTGTAACTGGCAGGACCAACTGTTCTCACACACCACATACGCACACATAGTTTGAAATTAAAGCTGTTACA-CGAGACGACTGAAACTGTACTGAAAAGACAAGCTGAGAATAATGGGGAGCCCGGCTGTTGTGAGGAGACGCTGCGTGGTTCGCAAAAACTGAAACGGGAGGTTGAAAGGAAAATGCCGAAAGTGCTGCGTTTGTCCGTGCGTGTAGTTGCAGTGTGTGTCGTGAGAAAAATAAAACCCGCTGGTGCATACATG]

[+] EMBL BU808050             [TCCACAG  CTGCACACTAGTACCTTCTACCTGACTCATCCTCTATAAGCTGAAGATTCACCATGATCAAAAGAAACTACGGCTTTAGCTACAGGAGCAGTCCTTCTGCCCCGAAGGCGTACAGTGTGTCAGAATTTGGCTTCAGACAGCCCTCCCGCATCTCCTCTGCCAGCGTCCGCACCGTGTCCTCTGGGTATGGAGGTGGTGCTGGGGCTGGTGGTGGTTGCTTTGACTTGTCCAGCGCCCTGGACCTTGGCCAGCGCTCTGGTGGCGTGCAGGTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCAGGGAGTACTACGAGAATAAGGGTCCCGCTGCAGAGAAGGACTACAGCAACTACTGGGCCATCATCAATGACCTGAAGGACAAGATCGCCGCTGCCACCTGTGAAAATGCAAACATCCTGCTCCAGATTGACAACTCCAAACTGGCCGCTGACGACTTCAAGACCAAGTTTGACCATGAGCTGATGATGCGCCAGTCGGTGGAGGCGGACATCGCCAACCTGCGCCGCCTGTTGGACCAGACCACCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CA845845             [ TCCCAT  CTGAACACTAGTACCTTCTACCTGACTCATCCTCTATACGCTGAAGATTCACCATGATCAAAAGAAACTACGGCTTTAGCTACAGGAGCAGTCCTTCTGCCCCGAAGGCGTACAGTGTGTCAGAATTTGGCTTCAGACAGCCCTCCCGCATCTCCTCTGCCAGCGTCCGCACCGTGTCCTCTGGGTATGGAGGTGGTGCTGGGGCTGGTGGTGGTTGCTTTGACTTGTCCAGCGCCCTGGACCTTGGCCAGCGCTCTGGTGGCGTGCAGGTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCAGGGAGTACTACGAGAATAAGGGTCCCGCTGCAGAGAAGGACTACAGCAACTACTGGGCCATCATCAATGACCTGAAGGACAAGATCGCCGCTGCCACCTGTGAAAATGCAAACATCCTGCTCCAGATTGACAACTCCAAACTGGCCGCTGACGACTTCAAGACCAAGTTTGACCATGAGCTGATGATGCGCCAGTCGGTGGAGGCGGACATCGCCAACCTGCGCCGCCTGTTGGACCAGACCACCCTCTCAAAGAGTGACTTGGAGATGCAGATCGAAGGGCTGCAGGATGAGCTGGCCTACCTCAAGAAGAACCATGCAGAGGAGCTGGCAGCGCTGCGCTCTCAGCTTACTGGCACTATCAACGTGGAGGTGGACGCCAGACCCCAGCAAGACCTCAACAGAGTCCTGGACGAGATCCGCctg                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CA845811             [ TCCCATGAAAGCACACTAGTACCTTCTACCTGACTCATCCTCTATCTTTTGAAGATTCACCATGATCAAAAGAAACTACGGCTTTAGCTACAGGAGCAGTCCTTCTGCCCCGAAGGCGTACAGTGTGTCAGAATTTGGCTTCAGACAGCCCTCCCGCATCTCCTCTGCCAGCGTCCGCACCGTGTCCTCTGGGTATGGAGGTGGTGCTGGGGCTGGTGGTGGTTGCTTTGACTTGTCCAGCGCCCTGGACCTTGGCCAGCGCTCTGGTGGCGTGCAGGTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCAGGGAGTACTACGAGAATAAGGGTCCCGCTGCAGAGAAGGACTACAGCAACTACTGGGCCATCATCAATGACCTGAAGGACAAGATCGCCGCTGCCACCTGTGAAAATGCAAACATCCTGCTCCAGATTGACAACTCCAAACTGGCCGCTGACGACTTCAAGACCAAGTTTGACCATGAGCTGATGATGCGCCAGTCGGTGGAGGCGGACATCGCCAACCTGCGCCGCCTGCTGGACCAGACCACCCTCTCAAAGAGTGACTTGGAGATGCAGATCGAAGGGCTGCAGGATGAGCTGGCCTACCTCAAGAAGAACCATGCAGAGGAGCTGGCAGCGCTGCGCTCTCAGCTTACTGGCACTATCAACGTGGAGGTGGACGCCAAACCCCAGCAAGACCTCAACAGAGTCCTGGACGAGATC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL FR0061204            [                                      TCCTCTATAAGCTGAAGATTCACCATGATCAAAAGAAACTACGGCTTTAGCTACAGGAGCAGTCCTTCTGCCCCGAAGGCGTACAGTGTGTCAGAATTTGGCTTCAGACAGCCCTCCCGCATCTCCTCTGCCAGCGTCCGCACCGTGTCCTCTGGGTATGGAGGTGGTGCTGGGGCTGGTGGTGGTTGCTTTGACTTGTCCAGCGCCCTGGACCTTGGCCAGCGCTCTGGTGGCGTGCAGGTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCAGGGAGTACTACGAGAATAAGGGTCCCGCTGCAGAGAAGGACTACAGCCACTACTGGGGCATCATCAATGACCTGAAGGACAAGATCGCCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL FR0062471            [                                            ATAAGCTGAAGATTCACCATGATCAAAAGAAACTACGGCTTTAGCTACAGGAGCAGTCCTTCTGCCCCGAACGCGTACAGTGTGTCAGAATTTGGCTTCAGACAGCCCTCCCGCATCTCCTCTGCCAGCGTCCGCACCGTGTCCTCTGGGTATGGAGGTGGTGCTGGGGCTGGTGGTGGNTGCTTTGACTTGTCCAGCGCCCTGGACCTTGGCCAGCGCTCTGGTGGCGTGCAGGTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CA845382             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGACATCGCCAACCTGCGCCGCCTGTTGGACCAGACCACCCTCACAAAGAGTGACTTGGAGATGCAGATCGAAGGGCTGCAGGATGAGCTGGCCTACCTCAAGAAGAACCATGCAGAGGAGCTGATAGCGCTGCGCTCTCAGCTTACTGGCACTATCAACGTGGAGGTGGACGCCAAACCCCAGCAAGACCTCAACAGAATCCTGGATGAGATCCGCTCCCAATACGAGAACATCTGCGACAAACACCGCCGTGAGCAGGAGGCCTGGTTTAATGAGCAGTCGACAGTCTTGAGCAAAGAGGTGGCCATAAGCACAGAAACCCTCCAGACGTCCAAGACAGAGATCACTGACCTGCGGCGCACACTCCAGGGCCTGGAGATTGAACTCCAGTCTCAGCTCAGCATGAAAGGGGCGCTGGAGAACACGTTAGCTGAAACGGATGCACGCTACAGCGCCATGCTCACCACCTTCCAGAGCACCATCAACATGCTGGAGACAGAAATCGGCAACGTGCGCGCCAGCATCGAGCAGCAGGGTCAGGACTACAAGATGCTGCTGGACATCAAGAGCAGGCTGGAGCAGGAGATCGCCACCTACAGGGGCCTTTTGGAGACAGAGGAGTCCAGAA                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CA845652             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCAGCACCCTCTAAACAGAATCCTGGATGAGATCCGCTCCCAATACGAGAACATCTGCGACAAACACCGCCGTGAGCAGGAGGCCTGGTTTAATGAGCAGTCGACAGTCTTGAGCAAAGAGGTGGCCATAAGCACAGAAACCCTCCAGACGTCCAAGACAGAGATCACTGACCTGCGGCGCACACTCCAGGGCCTGGAGATTGAACTCCAGTCTCAGCTCAGCATGAAAGGGGCGCTGGAGAACACGTTAGCTGAAACGGATGCACGCTACAGCGCCATGCTCACCACCTTCCAGAGCACCATCAATATGCTGGAGACAGAAATCGGCAACGTGCGCGCCAGCATCGAGCAGCAGGGTCAGGACTACAAGATGCTGCTGGACATCAAGAGCAGGCTGGAGCAGGAGATCGCCACCTACAGGGGCCTTTTGGAGACAGAGGAGTCCAGAACCATCAGCACAGGGGGAATGAAGGCCACAATCACCACCACCACTGTGCGCACTTCCAGCTGAGAGGTGTAACTGGCAGGACCAACTGTTCTCACACACCACATACGCACACATAGTTTGAAATTAAAGCTGTTACA CGAGACGACTGAAACTGTACTGAAAAGACAAGCTGAGAATAATGGGGAGCCCGGCTGTTGT                                                                                                                                    ]
[+] EMBL FR0057014            [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACACCGCCGTGAGCAGGAGGCCTGGTTTAATGAGCAGTCGACAGTCTTGAGCAAAGAGGTGGCCATAAGCACAGAAACCCTCCAGACGTCCAAGACAGAGATCACTGACCTGCGGTGCACACTCCAGGGCCTGGAGATTGAGCTCCAGTCTCAGCTCAGCATGAAAGGGGCGCTGGAGAACACGTTAGCTGAGACGGATGCACGCTACAGCGCCATGCTCACCACCTTCCAGAGCACCATCAGCATGCTGGGGACAGAAATCGGCAACGTGCGCGCCAGCATCGAGCAGCAGGGTCAGGACTACAAGATGCTGCTGGACATCAAGAGCAGGCTGGAGCAGGAGATCGCCca                                                                                                                                                                                                                                                                                                                                                                             ]
[-] EMBL CA331915             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTGACTTCCAGTTTCAGTTCACCATGAAAGGGCGCTTGGAGACCCCGTTAGTTGAAACGGATGCACGGTACAGCGCCATGCTCACCACTTTCCAGAGCACCATCAACATGCTGGAGACAGAAATTGGCAACGTGCGCGCCAGCATCGAGCAGCAGGGTCAGGACTACAAGATGCTGCTGGACATCAAGAGCAGGCTGGAGCAGGAGATCGCCACCTACAGGGGCCTTTTGGAGACAGAGAAGTCCAGAACCATCAGCACAGGGGGAATGAAGGCCACAATCACCACCACCACTGTGCGCACTTCCAGCTGAGAGGTGTAACTGGCAGGACCAACTGTTCTCACACACCACATACGCACACATAGTTTGAAATTAAAGCTGTTACA CGAGACGACTGAAACTGTACTGAAAAGACAAGCTGAGAATAATGGGGAGCCCGGCTGTTGTGAGGAGACGCTGCGTGGTTCGCAAAAACTGAAACGGGAGGTTGAAAGGAAAATGCCGAAAGTGCTGCGTTTGTCCGTGCGTGTAGTTGCAGTGTGTGTCGTGAGAAAAATAAAACCCGCTGGTGCATA    ]
[+] EMBL CA845787             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCCTTAGAGAGCACCATCAACATGCTGGAGACAGAAATCGGCAACGTGCGCGCCAGCATCGAGCAGCAGGGTCACGACTACAAGATGCTGCTGGACATCAAGAGCAGGCTGGAGCAGGAGATCGCCACCTACAGGGGCCTTTTGGAGACAGAGGAGTCCAGAACCATCAGCACAGGGGGAATGAAGGCCACAATCACCACCACCACTGTGCGCACTTCCAGCTGAGAGGTGTAACTGGCAGGACCAACTGTTCTCACACACCACATACGCACACATAGTTTGAAATTAAAGCTGTTACATTTAGACGACTGAAACTGTACTGAAAAGACAAGCTGAGAATAATGGGGAGCCCGGCTGTTGTGAGGAGACGCTGCGTGGTTCGCAAAAACTGAAACGGGAGGTTGAAAGGAAAATGCCGAAAGTGCTGCGT                                                               ]
[+] EMBL CA845032             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAGGCCACAATCACCACCACCACTGTGCGCACTTCCAGCTGAGAGGTGTAACTGGCAGGACCAACTGTTCTCACACACCACATACGCACACATAGTTTGAAATTAAAGCTGTTACA CGAGACGACTGAAACTGTACTGAAAAGACAAGCTGAGAATAATGGGGAGCCCGGCTGTTGTGAGGAGACGCTGCGTGGTTCGCAAAAACTGAAACGGGAGGTTGAAAGGAAAATGCCGAAAGTGCTGCGTTTGTCCGTGCGTGTAGTTGCAGTGTGTGTCGTGAGAAAAATAAAACCCGCTGGTGCATA    ]
[+] EMBL CA845513             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATCACCACCACCACTGTGCGCACTTCCAGCTGAGAGGTGTAACTGGCAGGACCAACTGTTCTCACACACCACATCCGCACACATAGTTTGAAATTAAAGCTGTTACA CGAGACGACTGAAACTGTACTGAAAAGACAAGCTGAGAATAATGGGGAGCCCGGCTGTTGTGAGGAGACGCTGCGTGGTTCGCAAAAACTGAAACGGGAGGTTGAAAGGAAAATGCCGAAAGTGCTGCGTTTTGCCGTGCATGTAGTTGCAGTGTGTGTCGGGAGAAAAAAAAACCCCGCTGGTGCAT     ]
[+] EMBL CA845000             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACTGTGCGCACTTCCAGCTGAGAGGTGTAACTGGCAGGACCAACTGTTCTCACACACCACATACGCACACATAGTTTGAAATTAAAGCTGTTACA CGAGACGACTGAAACTGTACTGAAAAGACAAGCTGAGAATAATGGGGAGCCCGGCTGTTGTGAGGAGACGCTGCGTGGTTCGCAAAAACTGAAACGGGAGGTTGAAAGGAAAATGCCGAAAGTGCTGCGTTTGTCCGTGCGTGTAGTTGCAGTGTGTGTCGTGAGAAAAATAAAACCCGCTGGTGCATACATG]
[+] EMBL CA845048             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGCAGGACCAACTGTTCTCACACACCACATACGCACACATAGTTTGAAATTAAAGCTGTTACA CGAGACGACTGAAACTGTACTGAAAAGACAAGCTGAGAATAATGGGGAGCCCGGCTGTTGTGAGGAGACGCTGCGTGGTTCGCAAAAACTGAAACGGGAGGTTGAAAGGAAAATGCCGAAAGTGCTGCGTTTGTCCGTGCGTGTATTTGCAGTGTGTGTCGTGAGAAAAATAAAACCCGCTGGTGCATACATG]
[+] EMBL CA847122             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACCACATACGCACACATAGTTTGAAATTAAAGCTGTTACA CGAGACGACTGAAACTGTACTGAAAAGACAAGCTGAGAATAATGGGGAGCCCGGCTGTTGTGAGGAGACGCTGCGTGGTTCGCAAAAACTGAAACGGGAGGTTGAAAGGAAAATGCCGAAAGTGCTGCGTTTGTCCGTGCGTGTAGTTGCAGTGTGTGTCGTGAGAAAAATAAAACCCGCTGGTGCATA    ]


>consensus_2862#0 TTCCCATCTGCACACTAGTACCTTCTACCTGACTCATCCTCTATAAGCTGAAGATTCACC ATGATCAAAAGAAACTACGGCTTTAGCTACAGGAGCAGTCCTTCTGCCCCGAAGGCGTAC AGTGTGTCAGAATTTGGCTTCAGACAGCCCTCCCGCATCTCCTCTGCCAGCGTCCGCACC GTGTCCTCTGGGTATGGAGGTGGTGCTGGGGCTGGTGGTGGTTGCTTTGACTTGTCCAGC GCCCTGGACCTTGGCCAGCGCTCTGGTGGCGTGCAGGTGAACGAGAAGGCCACCATGCAG AACCTGAATGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAAC GCCAAGCTGGAGATCCAGATCAGGGAGTACTACGAGAATAAGGGTCCCGCTGCAGAGAAG GACTACAGCAACTACTGGGCCATCATCAATGACCTGAAGGACAAGATCGCCGCTGCCACC TGTGAAAATGCAAACATCCTGCTCCAGATTGACAACTCCAAACTGGCCGCTGACGACTTC AAGACCAAGTTTGACCATGAGCTGATGATGCGCCAGTCGGTGGAGGCGGACATCGCCAAC CTGCGCCGCCTGTTGGACCAGACCACCCTCTCAAAGAGTGACTTGGAGATGCAGATCGAA GGGCTGCAGGATGAGCTGGCCTACCTCAAGAAGAACCATGCAGAGGAGCTGGCAGCGCTG CGCTCTCAGCTTACTGGCACTATCAACGTGGAGGTGGACGCCAAACCCCAGCAAGACCTC AACAGAGTCCTGGACGAGATCCGCTCCCAATACGAGAACATCTGCGACAAACACCGCCGT GAGCAGGAGGCCTGGTTTAATGAGCAGTCGACAGTCTTGAGCAAAGAGGTGGCCATAAGC ACAGAAACCCTCCAGACGTCCAAGACAGAGATCACTGACCTGCGGCGCACACTCCAGGGC CTGGAGATTGAACTCCAGTCTCAGCTCAGCATGAAAGGGGCGCTGGAGAACACGTTAGCT GAAACGGATGCACGCTACAGCGCCATGCTCACCACCTTCCAGAGCACCATCAACATGCTG GAGACAGAAATCGGCAACGTGCGCGCCAGCATCGAGCAGCAGGGTCAGGACTACAAGATG CTGCTGGACATCAAGAGCAGGCTGGAGCAGGAGATCGCCACCTACAGGGGCCTTTTGGAG ACAGAGGAGTCCAGAACCATCAGCACAGGGGGAATGAAGGCCACAATCACCACCACCACT GTGCGCACTTCCAGCTGAGAGGTGTAACTGGCAGGACCAACTGTTCTCACACACCACATA CGCACACATAGTTTGAAATTAAAGCTGTTACACGAGACGACTGAAACTGTACTGAAAAGA CAAGCTGAGAATAATGGGGAGCCCGGCTGTTGTGAGGAGACGCTGCGTGGTTCGCAAAAA CTGAAACGGGAGGTTGAAAGGAAAATGCCGAAAGTGCTGCGTTTGTCCGTGCGTGTAGTT GCAGTGTGTGTCGTGAGAAAAATAAAACCCGCTGGTGCATACATG



consensusID : consensus_2862#1
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 15
consensus length = 749
fasta sequence
                              [TTGAGTCGACAGCTGTACAGTGGTCATCTCTCCTCTCTTCTACTGATAGACCAGAAATCCATCCAAGATGTTCTACAACAAGAGTGTCATCGGCGGGCCCACCATGGTCAGACAGAGCCACAGCTACAGAACCAGTAGCGCTCCCCACAAGGCTCACAGTGTGTCAGGAGCCAGCTTCAGATCTGGTCCCCGCATCTCCTCTACCAGCATGCGCACTGTGTCCTCTAGCTATGGAGGCGGCATGGGGGTCGGTGGTGGATTCGACCTGGCCGGCGCTCTGGACCAGAGCACCGTCCACCTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCAGGGAGTACTACGAGAATAAGGGTCCCGCTGCCGACAGAGACTACAGCCACTACTGGGCCATCATCAATGACCTGAAGGACAAGATTGGTGCTGCCACCTGTGGCAATGCAAACCTCCTGCTCCAGATTGACAACTCCAAAC-TGGCCGCTGACGACTTCAAGATCAAGTTTGACCACGAGCTGATGATGCGCCAGTCGGTGGAGGCGGACATCGCCAACCTGCGCCGCCTGTTGGACCAGAGCACCCTCACAAAGAGTGACTTGGAGATGCAGATCGAGGGGCTGCAGGATGAGCTGGCCTACCTCAAGAAGAACCATGCAGAGGAGCTGATAGCGCTGCGCTCTC]

[+] EMBL CA590429             [TTGAGTCGACAGCTGTACAGTGGTCATCTCTCCTCTCTTCTACTGATAGACCAGAAATCCATCCAAGATGTTCTACAACAAGAGTGTCATCGGCGGGCCCACCATGGTCAGACAGAGCCACAGCTACAGAACCAGTAGCGCTCCCCACAAGGCTCACAGTGTGTCAGGAGCCAGCTTCAGATCTGGTCCCCGCATCTCCTCTACCAGCATGCGCACTGTGTCCTCTAGCTATGGAGGCGGCATGGGGGTCGGTGGTGGATTCGACCTGGCCGGCGCTCTGGACCAGAGCACCGTCCACCTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCAGGGAGTACTACGAGAATAAGGGTCCCGCTGCCGACAGAGACTACAGCCACTA                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CA589911             [ TGAGTCGACAGCTGTACAGTGGTCATCTCTCCTCTCTTCTACTGATAGACCAGAAATCCATCCAAGATGTTCTACAACAAGAGTGTCATCGGCGGGCCCACCATGGTCAGACAGAGCCACAGCTACAGAACCAGTAGCGCTCCCCACAAGGCTCATAGTGTGTCAGGAGCCAGCTTCAGATCTGGTCCCCGCATCTCCTCTACCAGCATGCGCACTGTGTCCTCTAGCTATGGAGGCGGCATGGGGGTCGGTGGTGGATTCGACCTGGCCGGCGCTCTGGACCAGAGCACCGTCCACCTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCAGGGAGTACTACGAGAATAAGGGTCCCGCTGCCGACAGAGACTACAGCCACTACTGGGCCATCATCAATGACCTGAAGGACAAGATTGGTGCTGCCACCTGTGGCAATGCAAACCTCCTGCTCCAGATTGACAACTCCAAAC TGGCCGCTGACGACTTCCAGATCAAGTTTGACCACGAGCTG                                                                                                                                                                   ]
[+] EMBL BU808550             [     TCGACAGCTGTACAGTGGTCATCTCTCCTCTCTTCTACTGATAGACCAGAAATCCATCCAAGATGTTCTACAACAAGAGTGTCATCGGCGGGCCCACCATGGTCAGACAGAGCCACAGCTACAGAACCAGTAGCGCTCCCCACAAGGCTCACAGTGTGTCAGGAGCCAGCTTCAGATCTGGTCCCCGCATCTCCACTACCAGCATGCGCACTGTGTCCTCTAGCTATGGAGGCGGCATGGGGGTCGGTGGTGGATTCGACCTGGCCGGCGCTCTGGACCAGAGCACCGTCCACCTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCAGGGAGTACTACGAGAATAAGGGTCCCGCTGCCGACAGAGACTACAGCCACTACTGGGCCATCATCAATGACCTGAAGGACAAGATTGGTGCTGCCACCTGTGGCAATGCAAACCTCCTGCTCCAGATTGACAACTCCAAAC TGGCCGCTGACGACTTCAAGATCAAGTTTGACCACGAGCTGATGATGCGCCAGTCGGTGGAGGCGGACATCGCCAACCTGCGC                                                                                                                         ]
[+] EMBL FR0063107            [                                         ACTGATATACCAGAAATCCATCCAAGAGG  GTACAACAAGAGTGTCATCGGC GGCCCACCATGGTCAGACAGAGCCACAGCTACAGAACCAGTAGCGCTCCCCACAAGGCTCACAGTGTGTCAGGAGCCAGCTTCAGATCTGGTCCCCGCATCTCCTCTACCAGCATGCGCACTGTGTCCTCTAGCTATGGAGGCGGCATGGGGGTCGGTGGTGGATTCGACCTGGCCGGCGCTCTGGACCAGAGCACCGTCCACCTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCAGGGAGTACTACGAGAATAAGGGTCCCGCTGCCGACAGAGACTACAGCCACTACTGGGCCATCATTAATG                                                                                                                                                                                                                                                                                     ]
[+] EMBL CA846632             [                                                GACCAGAAATCCATCCAAGATGTTCTACAACAAGAGTGTCATCGGCGGGCCCACCATGGTCAGACAGAGCCACAGCTACAGAACCAGTAGCGCTCCCCACAAGGCTCACAGTGTGTCAGGAGCCAGCTTCAGATCTGGTCCCCGCATCTCCTCTACCAGCATGCGCACTGTGTCCTCTAGCTATGGAGGTGGCATGGGGGTCGGTGGTGTATTCGACCTGGCCGGCGCTCTGGACCAGAGCACCGTCCACCTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCAGGGAGTACTACGAGAATAAGGGTCCCGCTGCCGACAGAGACTACAGCCACTACTGGGCCATCATCAATGACCTGAAGGACAAGATTGGTGCTGCCACCTGTGGCAATGCAAACCTCCTGCTCCAGATTGACAACTCCAAAC TGGCCGCTGACGACTTCAAGATCAAGTTTGACCACGAGCTGATGATGCGCCAGTCGGTGGAGGCGGACATCG                                                                                                                                    ]
[+] EMBL FR0056265            [                                                 ACCAGAAATCCATCCAAGATGTTCTACAACAAGAGTGTCATCGGCGGGCCCACCATGGTCAGACAGAGCCACAGCTACAGAACCAGTAGCGCTCCCCACAAGGCTCACAGTGTGTCAGGAGCCAGCTTCAGATCTGGTCCCCGCATCTCCTCTACCAGCATGCGCACTGTGTCCTCTAGCTATGGAGGCGGCATGGGGGTCGGTGGTGGATTCGACCTGGCCGGCGCTCTGGACCACAGCACCGTCCACCTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCAGGGAGTACTACGAGAATAAGGATCC                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL FR0056261            [                                                   CAGAAATCCATCCAAGATGTTCTACAACAAGAGTGTCATCGGCGGGCCCACCATGGTCAGACAGAGCCACAGCTACAGAACCAGTAGCGCTCCCCACAAGGCTCACAGTGTGTCAGGAGCCAGCTTCAGATCTGGTCCCCGCATCTCCTCTACCAGCATGCGCACTGTGTCCTCTAGCTATGGAGGCGGCATGGGGGTCGGTGGTGGATTCGACCTGGCCGGCGCTCTGGCCCAGAGCACCGTCCACCTGAACGAGAAGGCCACCATGCAGGACCTGAATGACCGACTGTCCAACTACCTGGGCAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCA                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL FR0060005            [                                                                   ATGTTCTACAACAAGAGTGTCATCGGCGGGCCCACCATGGTCAGACAGAGCCACAGCTACAGAACCAGTAGCGCTCCCCACAAGGCTCACAGTGTGTCAGGAGCCAGCTTCAGATCTGGTCCCCGCATCTCCTCTACCAGCATGCGCACTGTGTCCTCTAGCTATGGAGGCGGCATGGGGGTCGGTGGTGGATTCGACCTGGCCGGCGCTCTGGACCAGAGCACCGTCCACCTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGTCC                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL FR0062332            [                                                                   ATGTTCTACAACAAGAGTGTCATCGGCGGGCCCACCATGGTCAGACAGAGCCACAGCTACAGAACCAGTAGCGCTCCCCACAAGGCTCACAGTGTGTCAGGAGCCAACTTCAGATCTGGTCCCCGCATCTCCTCTACCAGCATGCGCACTGTGTCCTCTAGCTATGGAGGCGGCATGGGGGTCGGTGGTGGATTCGACCTGGCCGGCGCTCTGGACCAGAGCACCGTCCACCTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCCAGCTGGAGATCCAGATCAGGGAGTA                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL FR0057075            [                                                                                             CGGGCCCACCATGGTCAGACAGAGCCACAGCTACAGAACCAGTAGCGCTCCCCACAAGGCTCACAGTGTGTCAGGAGCCAGCTTCAGATCTGGTCCCCGCATCTCCTCTACCAGCATGCGCACTGTGTCCTCTAGCTATGGAGGTGGCATGGGGGTCGGTGGTGGATTCGACCTGGCCGGCGCTCTGGACCAGAGCACCGTCCACCTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCAGGGAGTACTACGAGAATAAGGGTCCCGCTGCCGACAGAGACTACAGCCACTACTGGGCCATCATCAATGACCTGAAGGACAAGATTGGTGCTGCCACCTGTGGCAATGCAAACCTCCTGCTCCAGATTGACAACTCCAAAC TGGCCGCTGACGACTTCAAGATCAAGTTTGGCCACGAGCTGATGATGC CCAGTCGGTGGAGGCGGACATCGCCAACCTGCGCCGCCTGTTGGACC                                                                                                            ]
[+] EMBL CA847049             [                                                                                                                                                         TCACAGTGTGTCAGGAGCCAGCTTCAGATCTGGTCCCCGCATCTCCTCTACCAGCATGCGCACTGTGTCCTCTAGCTATGGAGGCGGCATGGGGGTCGGTGGTGGATTCGACCTGGCCGGCGCTCTGGACCAGAGCACCGTCCACCTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCAGGGAGTACTACGAGAATAAGGGTCCCGCTGCCGACAGAGACTACAGCCACTACTGGGCCATCATCAATGACCTGAAGGACAAGATTGGTGCTGCCACCTGTGGCAATGCAAACCTCCTGCTCCAGATTGACAACTCCAAAC TGGCCGCTGACGACTTTCAGATCAAGTTTGACCACGAGCTGATGATGCGCCAGTCGGTGGAGGCGGACATCGCCAACCTG                                                                                                                            ]
[+] EMBL FR0055364            [                                                                                                                                                           ACAGTGTGTCAGGAGCCAGCTTCAGATCTGGTCCCCGCATCTCCTCTACCAGCATGCGCACTGTGTCCTCTAGCTATGGAGGCGGCATGGCGGTCGGTGGTGGATTCGACCTGGCCGGCGCTCTGGGCCAGAGCACCGTCCACCTGAACGAGAAGGCCACCATGCAGAACCTGAGTGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGACATCGCCAACCTGCGCCGCCTGTTgg                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CA844713             [                                                                                                                                                                                                     CCTCTACCAGCATGCGCACTGTGTCCTCTATGTATGGAGGTGGCATGTGGGTCGGAGGCGGATTCGACCTGGTCGGTGTTCTGGACCAAAGCACCGTCCACCTGAACGAGAAGGGCACCATGCTGAACCTGAATGACCGACTGTCCTACTACCTGGACAAGGCTCGCTCTCTGGAGGTGGCCAACTTTTTTCTGGACATCCAGATCATGGAGTACTACGAGAATAAGGGTCCCGCTGCCGACTGAGACTACAGCCACTACTGGGCCATCATCAATGACCTGAAGGACAAGATTGGTGCTGCCACCTGTGGCAATGCAAACCTCCTGCTCCAGATAGACAACTCCAAAC TGGCCGCTGACGACTTCTCCATCTAGTTTGACCACGAGCTGATGATGCGCCAGCCGACGGAGGAGGAAATCGACAACCTGCGCCGCCTGTTGGACCAGAGCACCCTCACAAAGAGTGACTTGTAGATGCAGATCAAGAGGCTGCAGGATGAGCTG                                                 ]
[+] EMBL FR0059165            [                                                                                                                                                                                                                                      ATGGAGGCGGCATGGGGGTCGGTGGTGTATTCGACCTGGCCGGCGCTCTGGACCAGAGCGCCGTCCACCTGAACGAGAAGGCCACCATGCACAACCTGAATGACCGACTGTCCAACTACCTGGACAAGGCTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCAGGGAGGACTACGAGAATAAGGGTCCCGCTGCCGACAGAGACTACAGCCACTACTGGGCCATCATCAATGACCTGAACGACAAGATTGGTGCTGCCACCTGTGGCAATGCAAACCTCCTGCTCCAGAATGACAACTCCAAACTTGGCCGCTGACCACTT                                                                                                                                                                                            ]
[+] EMBL FR0057395            [                                                                                                                                                                                                                                                                                                                                      TGAATGACCGACTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCAGGGAGTACTACGAGAATAAGGGTCCCGCTGCCGACAGAGACTACAGCCACTACTGGGCCATCATCAATGACCTGAAGGACAAGATTGGTGCTGCCACCTGTGGCAATGCAAACCTCCTGCTCCAGATTGACAACTCCAAAC TGGCCGCTGACGACTTCAAGATCAAGTTTGACCACGAGCTGATGATGCGCCAGTCGGTGGAGGCGGACATCGCCAACCTGCGCCGCCTGTTGGACCAGACCACCCTCACAAAGAGTGACTTGGAGATGCAGATCGAAGGGCTGCAGGATGAGCTGGCCTACCTCAAGAAGAACCATGCAGAGGAGCTGATAGCGCTGCGCTCTC]


>consensus_2862#1 TTGAGTCGACAGCTGTACAGTGGTCATCTCTCCTCTCTTCTACTGATAGACCAGAAATCC ATCCAAGATGTTCTACAACAAGAGTGTCATCGGCGGGCCCACCATGGTCAGACAGAGCCA CAGCTACAGAACCAGTAGCGCTCCCCACAAGGCTCACAGTGTGTCAGGAGCCAGCTTCAG ATCTGGTCCCCGCATCTCCTCTACCAGCATGCGCACTGTGTCCTCTAGCTATGGAGGCGG CATGGGGGTCGGTGGTGGATTCGACCTGGCCGGCGCTCTGGACCAGAGCACCGTCCACCT GAACGAGAAGGCCACCATGCAGAACCTGAATGACCGACTGTCCAACTACCTGGACAAGGT TCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATCCAGATCAGGGAGTACTACGAGAA TAAGGGTCCCGCTGCCGACAGAGACTACAGCCACTACTGGGCCATCATCAATGACCTGAA GGACAAGATTGGTGCTGCCACCTGTGGCAATGCAAACCTCCTGCTCCAGATTGACAACTC CAAACTGGCCGCTGACGACTTCAAGATCAAGTTTGACCACGAGCTGATGATGCGCCAGTC GGTGGAGGCGGACATCGCCAACCTGCGCCGCCTGTTGGACCAGAGCACCCTCACAAAGAG TGACTTGGAGATGCAGATCGAGGGGCTGCAGGATGAGCTGGCCTACCTCAAGAAGAACCA TGCAGAGGAGCTGATAGCGCTGCGCTCTC



consensusID : consensus_2862#2
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 1
consensus length = 249
fasta sequence
                              [ACATGCTGGAGGGAGAACTGGCCAACGTGCGCGCCAGCATCGAGCAGCAGGGTCAGGACTACAAGATGCTGCTGGACATCAAGAGCAGGCTGGAGCAGGAGATCGCCATCTACAGGGGCCTTTTGGAGACAGAGGAGTCCAGGACCATCAGCACAGGTGGTTCTCTGTAATTAAGCAGAAACCTGGCAGGACAAGCACACACGTGCAAGCCCACGTACGTGCATGCAGAGTTTAATAAAAATCTTCAAA]

[+] EMBL CA330128             [ACATGCTGGAGGGAGAACTGGCCAACGTGCGCGCCAGCATCGAGCAGCAGGGTCAGGACTACAAGATGCTGCTGGACATCAAGAGCAGGCTGGAGCAGGAGATCGCCATCTACAGGGGCCTTTTGGAGACAGAGGAGTCCAGGACCATCAGCACAGGTGGTTCTCTGTAATTAAGCAGAAACCTGGCAGGACAAGCACACACGTGCAAGCCCACGTACGTGCATGCAGAGTTTAATAAAAATCTTCAAA]


>consensus_2862#2 ACATGCTGGAGGGAGAACTGGCCAACGTGCGCGCCAGCATCGAGCAGCAGGGTCAGGACT ACAAGATGCTGCTGGACATCAAGAGCAGGCTGGAGCAGGAGATCGCCATCTACAGGGGCC TTTTGGAGACAGAGGAGTCCAGGACCATCAGCACAGGTGGTTCTCTGTAATTAAGCAGAA ACCTGGCAGGACAAGCACACACGTGCAAGCCCACGTACGTGCATGCAGAGTTTAATAAAA ATCTTCAAA



consensus multiple alignement with clustalw

CLUSTAL W (1.82) multiple sequence alignment


consensus_2862#0      ------------------------------------TTCCCATCTGCACACTAGTACCTT 24
consensus_2862#1      TTGAGTCGACAGCTGTACAGTGGTCATCTCTCCTCTCTTCTACTGATAGACCAGAAA--T 58
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      CTACCTGACTCATCCT-CTATAAG--------CTGAAGATTCACCATGATCAAAAGAAAC 75
consensus_2862#1      CCATCCAAGATGTTCTACAACAAGAGTGTCATCGGCGGGCCCACCATGGTCAGACAGAGC 118
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      TACGGCTTTAGCTACAGGAGCAGTCCTTCTGCCCCGAAGGCGTACAGTGTGTCAGAATTT 135
consensus_2862#1      CAC------AGCTACAGAACCAGTAGCGCTCCCCACAAGGCTCACAGTGTGTCAGGAGCC 172
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      GGCTTCAGACAGCCCTCCCGCATCTCCTCTGCCAGCGTCCGCACCGTGTCCTCTGGGTAT 195
consensus_2862#1      AGCTTCAGATCTGGTCCCCGCATCTCCTCTACCAGCATGCGCACTGTGTCCTCTAGCTAT 232
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      GGAGGTGGTGCTGGGGCTGGTGGTGGTTGCTTTGACTTGTCCAGCGCCCTGGACCTTGGC 255
consensus_2862#1      GGAGGCGGCATGGGGGTCGGTGGTGGAT---TCGACCTGGCCGGCGCTCTGGACC----- 284
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      CAGCGCTCTGGTGGCGTGCAGGTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGA 315
consensus_2862#1      -AGAGCAC------CGTCCACCTGAACGAGAAGGCCACCATGCAGAACCTGAATGACCGA 337
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      CTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATC 375
consensus_2862#1      CTGTCCAACTACCTGGACAAGGTTCGCTCTCTGGAGGCGGCCAACGCCAAGCTGGAGATC 397
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      CAGATCAGGGAGTACTACGAGAATAAGGGTCCCGCTGCAGAGAAGGACTACAGCAACTAC 435
consensus_2862#1      CAGATCAGGGAGTACTACGAGAATAAGGGTCCCGCTGCCGACAGAGACTACAGCCACTAC 457
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      TGGGCCATCATCAATGACCTGAAGGACAAGATCGCCGCTGCCACCTGTGAAAATGCAAAC 495
consensus_2862#1      TGGGCCATCATCAATGACCTGAAGGACAAGATTGGTGCTGCCACCTGTGGCAATGCAAAC 517
consensus_2862#2      -------------ACATGCTGGAGGG-AGAACTGGC----CAACGTGCG----CGCCAGC 38
                                   *    *** ***  *  *  *      * ** ** *     ** * *

consensus_2862#0      ATCCTGCTCCAGATTGACAACTCCAAACTGGCCGCTGACGACTTCAAGACCAAGTTTGAC 555
consensus_2862#1      CTCCTGCTCCAGATTGACAACTCCAAACTGGCCGCTGACGACTTCAAGATCAAGTTTGAC 577
consensus_2862#2      ATCGAGCAGCAGGGTCAGGACTACAAGATG-CTGCTG--GACATCAAGAGCAGGCTGGAG 95
                       **  **  ***  * *  *** ***  ** * ****  *** ****** ** * * ** 

consensus_2862#0      CATGAGCTGATGATGCGCCAGTCGGTGGAGGCGGACATCGCCAACCTGCGCCGCCTGTTG 615
consensus_2862#1      CACGAGCTGATGATGCGCCAGTCGGTGGAGGCGGACATCGCCAACCTGCGCCGCCTGTTG 637
consensus_2862#2      CAGGAGATCGCCATCTAC-AGGGGCCTTTTGGAGACAGAGGAGTCCAGGACCATCAGCAC 154
                      ** *** *    **   * **  *      *  ****  *    ** *  **  * *   

consensus_2862#0      GACCAGACCACCCTCTCAAAG-AGTGACTTGGAGATGCAGATCGAAGGGCTGCAGGATGA 674
consensus_2862#1      GACCAGAGCACCCTCACAAAG-AGTGACTTGGAGATGCAGATCGAGGGGCTGCAGGATGA 696
consensus_2862#2      AGGTGGTTCTCTGTAATTAAGCAGAAACCTG-----GCAGGACAAGCACACAC-GTGCAA 208
                           *  * *  *    *** **  ** **     ****  * *       * *    *

consensus_2862#0      GCTGGCCTACCT-CAAGAAGAACCATGCAGAGGAGCTGGCAGCGCTGCGCTCTCAGCTTA 733
consensus_2862#1      GCTGGCCTACCT-CAAGAAGAACCATGCAGAGGAGCTGATAGCGCTGCGCTCTC------ 749
consensus_2862#2      GCCCACGTACGTGCATGCAGAGTTTAATAAAAATCTTCAAA------------------- 249
                      **   * *** * ** * ***       * *     *   *                   

consensus_2862#0      CTGGCACTATCAACGTGGAGGTGGACGCCAAACCCCAGCAAGACCTCAACAGAGTCCTGG 793
consensus_2862#1      ------------------------------------------------------------
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      ACGAGATCCGCTCCCAATACGAGAACATCTGCGACAAACACCGCCGTGAGCAGGAGGCCT 853
consensus_2862#1      ------------------------------------------------------------
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      GGTTTAATGAGCAGTCGACAGTCTTGAGCAAAGAGGTGGCCATAAGCACAGAAACCCTCC 913
consensus_2862#1      ------------------------------------------------------------
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      AGACGTCCAAGACAGAGATCACTGACCTGCGGCGCACACTCCAGGGCCTGGAGATTGAAC 973
consensus_2862#1      ------------------------------------------------------------
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      TCCAGTCTCAGCTCAGCATGAAAGGGGCGCTGGAGAACACGTTAGCTGAAACGGATGCAC 1033
consensus_2862#1      ------------------------------------------------------------
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      GCTACAGCGCCATGCTCACCACCTTCCAGAGCACCATCAACATGCTGGAGACAGAAATCG 1093
consensus_2862#1      ------------------------------------------------------------
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      GCAACGTGCGCGCCAGCATCGAGCAGCAGGGTCAGGACTACAAGATGCTGCTGGACATCA 1153
consensus_2862#1      ------------------------------------------------------------
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      AGAGCAGGCTGGAGCAGGAGATCGCCACCTACAGGGGCCTTTTGGAGACAGAGGAGTCCA 1213
consensus_2862#1      ------------------------------------------------------------
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      GAACCATCAGCACAGGGGGAATGAAGGCCACAATCACCACCACCACTGTGCGCACTTCCA 1273
consensus_2862#1      ------------------------------------------------------------
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      GCTGAGAGGTGTAACTGGCAGGACCAACTGTTCTCACACACCACATACGCACACATAGTT 1333
consensus_2862#1      ------------------------------------------------------------
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      TGAAATTAAAGCTGTTACACGAGACGACTGAAACTGTACTGAAAAGACAAGCTGAGAATA 1393
consensus_2862#1      ------------------------------------------------------------
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      ATGGGGAGCCCGGCTGTTGTGAGGAGACGCTGCGTGGTTCGCAAAAACTGAAACGGGAGG 1453
consensus_2862#1      ------------------------------------------------------------
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      TTGAAAGGAAAATGCCGAAAGTGCTGCGTTTGTCCGTGCGTGTAGTTGCAGTGTGTGTCG 1513
consensus_2862#1      ------------------------------------------------------------
consensus_2862#2      ------------------------------------------------------------
                                                                                  

consensus_2862#0      TGAGAAAAATAAAACCCGCTGGTGCATACATG 1545
consensus_2862#1      --------------------------------
consensus_2862#2      --------------------------------
                                                      




Data build on Sat Aug 9 00:50:02 CEST 2003 by Hubert Wassner    (hubert.wassner@noos.fr)