Who am I
EST Assembly

These datas are free for academic use only, please contact me for any other use.

Takifugu rubripes
cluster # 2913 cluster # 2913       Sequences # 2004       consensus # 93

see consensus multiple alignment with clustalw

Direct access to contigs :
consensus_2913#0 length = 1955 sequences # 563  
consensus_2913#1 length = 1940 sequences # 64  
consensus_2913#2 length = 1894 sequences # 138  
consensus_2913#3 length = 1785 sequences # 67  
consensus_2913#4 length = 1680 sequences # 261  
consensus_2913#5 length = 1309 sequences # 20  
consensus_2913#6 length = 1258 sequences # 5  
consensus_2913#7 length = 1051 sequences # 74  
consensus_2913#8 length = 1044 sequences # 30  
consensus_2913#9 length = 1031 sequences # 29  
consensus_2913#10 length = 1008 sequences # 32  
consensus_2913#11 length = 978 sequences # 4  
consensus_2913#12 length = 959 sequences # 16  
consensus_2913#13 length = 924 sequences # 6  
consensus_2913#14 length = 917 sequences # 25  
consensus_2913#15 length = 891 sequences # 69  
consensus_2913#16 length = 846 sequences # 46  
consensus_2913#17 length = 838 sequences # 25  
consensus_2913#18 length = 826 sequences # 35  
consensus_2913#19 length = 823 sequences # 7  
consensus_2913#20 length = 820 sequences # 79  
consensus_2913#21 length = 802 sequences # 6  
consensus_2913#22 length = 785 sequences # 11  
consensus_2913#23 length = 769 sequences # 4  
consensus_2913#24 length = 751 sequences # 2  
consensus_2913#25 length = 726 sequences # 10  
consensus_2913#26 length = 723 sequences # 4  
consensus_2913#27 length = 707 sequences # 15  
consensus_2913#28 length = 706 sequences # 2  
consensus_2913#29 length = 698 sequences # 5  
consensus_2913#30 length = 691 sequences # 71  
consensus_2913#31 length = 632 sequences # 1  
consensus_2913#32 length = 629 sequences # 2  
consensus_2913#33 length = 626 sequences # 1  
consensus_2913#34 length = 620 sequences # 1  
consensus_2913#35 length = 617 sequences # 2  
consensus_2913#36 length = 608 sequences # 32  
consensus_2913#37 length = 606 sequences # 1  
consensus_2913#38 length = 600 sequences # 2  
consensus_2913#39 length = 599 sequences # 28  
consensus_2913#40 length = 595 sequences # 44  
consensus_2913#41 length = 590 sequences # 63  
consensus_2913#42 length = 579 sequences # 1  
consensus_2913#43 length = 579 sequences # 3  
consensus_2913#44 length = 578 sequences # 3  
consensus_2913#45 length = 574 sequences # 1  
consensus_2913#46 length = 570 sequences # 2  
consensus_2913#47 length = 561 sequences # 11  
consensus_2913#48 length = 521 sequences # 1  
consensus_2913#49 length = 508 sequences # 2  
consensus_2913#50 length = 485 sequences # 6  
consensus_2913#51 length = 481 sequences # 1  
consensus_2913#52 length = 462 sequences # 2  
consensus_2913#53 length = 462 sequences # 1  
consensus_2913#54 length = 453 sequences # 6  
consensus_2913#55 length = 451 sequences # 6  
consensus_2913#56 length = 442 sequences # 1  
consensus_2913#57 length = 441 sequences # 2  
consensus_2913#58 length = 437 sequences # 1  
consensus_2913#59 length = 434 sequences # 2  
consensus_2913#60 length = 417 sequences # 1  
consensus_2913#61 length = 402 sequences # 13  
consensus_2913#62 length = 399 sequences # 2  
consensus_2913#63 length = 382 sequences # 1  
consensus_2913#64 length = 374 sequences # 1  
consensus_2913#65 length = 368 sequences # 2  
consensus_2913#66 length = 364 sequences # 1  
consensus_2913#67 length = 363 sequences # 1  
consensus_2913#68 length = 362 sequences # 3  
consensus_2913#69 length = 356 sequences # 1  
consensus_2913#70 length = 351 sequences # 1  
consensus_2913#71 length = 337 sequences # 1  
consensus_2913#72 length = 296 sequences # 1  
consensus_2913#73 length = 260 sequences # 1  
consensus_2913#74 length = 197 sequences # 1  
consensus_2913#75 length = 190 sequences # 1  
consensus_2913#76 length = 167 sequences # 1  
consensus_2913#77 length = 165 sequences # 2  
consensus_2913#78 length = 152 sequences # 1  
consensus_2913#79 length = 145 sequences # 1  
consensus_2913#80 length = 144 sequences # 1  
consensus_2913#81 length = 140 sequences # 1  
consensus_2913#82 length = 137 sequences # 1  
consensus_2913#83 length = 134 sequences # 1  
consensus_2913#84 length = 134 sequences # 1  
consensus_2913#85 length = 132 sequences # 1  
consensus_2913#86 length = 116 sequences # 1  
consensus_2913#87 length = 110 sequences # 1  
consensus_2913#88 length = 110 sequences # 1  
consensus_2913#89 length = 105 sequences # 1  
consensus_2913#90 length = 102 sequences # 1  
consensus_2913#91 length = 100 sequences # 1  
consensus_2913#92 length = 96 sequences # 1  

consensusID : consensus_2913#0
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 563
consensus length = 1955
fasta sequence

[+] EMBL BU806352             [CAGAACTGCATAAAAGCAAACAGGAGCA  GCTGTC   A  GAC ACTCAGAGGGATTTGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CA588937             [                   ACAGGAGCA  GCTGTC   A  GAC ACTCAGAGGGATTTGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGGAA GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CA589752             [                     AGGGCCATTGTTGG C TA  CTT GCTCAGAGGGA TTGGCTCT CCT CTTGACGCCTGCACATCTTC GTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU805917             [                        ACCATTGTTGGCCTTT  TGC ACTCAGAGGGATTTGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL BU807153             [                        ATCATTGTTGGCC TT  CACGACTCAGAGGGATTTGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  T TC TT TT T C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGGCTACA TCAGCAACCTGCGCAGACAGCTC GATGGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU806309             [                        ATCATTGTTGGCCTTT  TGC ACTCAGAGGGATTTGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGGGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AT TGTT T  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACGGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU807329             [                        ACCATTGTTGGCC TAT TCC ACTCAGAGGGATTTGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACATTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL BU806966             [                       atCCATTGTTGGCC AT  CGC AACAAGAGGGATTTGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC    CT TG TG G T  T G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU807363             [                         CCATTGTTGGCC TATCTGG ACTCAGAGGGATTTGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CA591099             [                                                  AGAGGGATTTGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACGTTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU805777             [                                                 aAGAGGGATTTGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL BU808415             [                                                          TTGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGGCAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CA846051             [                                                          TTGCCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCACCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCCACATTGACAGCATGTTCG AGGCCTACA TCAGCAAa                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL BU808358             [                                                           TGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BU807931             [                                                           TGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TTAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL BU805861             [                                                           TGGCTCT CCT CTTGACGCCTGCACATCTTCAATTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG AGGG G GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAATAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU807261             [                                                           TGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU807897             [                                                           TGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG AGGG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU807856             [                                                           TGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BU806995             [                                                           TGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CA590940             [                                                           TGGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CA588629             [                                                            GTTTTA ACT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CCCTGATG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGCTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCTTTTCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAGGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL BU806980             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAAGGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL BU807194             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGGCCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CA589055             [                                                            GGCTCT CCT CTTGACGCCTGCACACCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACCGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGGTCG AGGGCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU808385             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU807778             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU807907             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G T  T G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CA589964             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC A     G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTAGA GGGAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL BU806358             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAATTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG T T  GTG CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGTTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808467             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU806348             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA590889             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTAACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU808340             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G TG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU805702             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU805960             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGTTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AATCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU806415             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CT G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU807161             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU806138             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGNCTACA TCAGCAACCTGCGCAGACAGCTC GAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU807332             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  T CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL BU805835             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CA591245             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGATGTTCCCACACG GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGAAAA  GGTGCG TTTCCTGGAAC AACAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCCGGAGGAACAGACCACCA CCCGCCTCAAAATTGACAGCATGGTCG AGGCCTACA TCAGCAACCTGGGCAGACAGTTCGGATGGGCTGGc                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU807089             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG TG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGGG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGGAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CA589850             [                                                            GGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CA588625             [                                                            GTCGGT AAC AGTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCACTTG A AAGGCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CA588547             [                                                            GTCTTT AATACTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCACTTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTTAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGGTGATGCTGCCTACATGAACAAGGGGGAACTTGAAGCCAAGGCTGATG CGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CA845978             [                                                            GCCCCT TCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTGTACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CA845844             [                                                            GCCTCT  CT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCACCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CA588663             [                                                            GGCCCTAACA CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CT AGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TCGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAAGATGTGGATGCTGCCTACCTGAACAAGGTGGGACTTGAAGCCAAGGCTGATG CGCTCCAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL BU807245             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CA588438             [                                                             GTCCT CAA ATTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCACTTGTACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGTTCCAACCATCACAGCTGT TCTAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU808171             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA846114             [                                                             GCTCT CTT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG TCAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU806301             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU807147             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CA591447             [                                                             GTTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCTCAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAAAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGGGGAACTTGAAGCCAAGGGTGATG CGCTCCAAGATGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CA846333             [                                                             GCTCT CTT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTGTTCAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CA591222             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CA591476             [                                                             GTACT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTTGAGCCAAGGCTGATG CGCTCCAGGAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CA588240             [                                                            cGCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCATCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGGAGCCAAGGCTGATG CGCTCCAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CA846071             [                                                             GTCCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCACCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACNAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CA846187             [                                                             GCTCT TCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCACCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL BU807075             [                                                             GCTCT CCT CTTGACGCCTGCACATTTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU807035             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CA591527             [                                                             GTTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCTGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTNNNTAC TNCNATGNANNCATGATCNNTCCAACCATCTCTTCTGT CCAANTCAACAGGAACCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGGAGAC CAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAAACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGATTGA GGGAGAACTGAGGAACATGCAGGGCCCTGTTGAGGCCTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAATTTGTGCTCCTGGAGAAGGGATGTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGGTGATG CGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CA845900             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCATCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAAGAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CA591313             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CA846182             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTTCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL BU807023             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL BU807287             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CA846281             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCTTCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAANGATGTTGATGCTGCCTACATGAAACAGGTGGAACTTGAAGCCAAGGCTGATG CG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL BU808362             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G T CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CA845915             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAAGTGGGACTTGAAGCCCAGGCTGATG CG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CA588950             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU808061             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCAGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL BU807310             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU806466             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAGCCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CA845998             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CA846202             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC A     G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCANGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGGACTTGAAGCCCAGGCTGATG CG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL BU808300             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL BU808332             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAAGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL BU806232             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU807818             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G TG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU808258             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAGACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU806290             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA846017             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCATCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ACCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL BU808279             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG TCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGTAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGGCGGGGCAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU808650             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CA589058             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CA589081             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G TG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU807070             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CA589217             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CT GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGGGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU808377             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU808416             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G TG GTGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU808184             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU808484             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU807104             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU808500             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCCACATTGACAGCATGTTCG AAGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU807205             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCGTCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAAGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGGTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU808216             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G TTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G T TT TTTGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTTCAACATTGACAGCATGTTCG AGGGCTACA TCAGCAACCTGCGCAAACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU806425             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL BU806531             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGCCAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU808569             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU807084             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CA591625             [                                                            cGTCCA GCG CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CCTATCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAGAATGAA ATC ACAAACCTGCAGCTGCAGAGAATGAGTCTGTGCTCCTGAAAAAGGATGTTGATGCTGCCTCCATGAACAAGGGGGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CA588961             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGGNA GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU808512             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTGTG TTCACCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACGGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G GTTG TTTGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAcg                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU806469             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGGCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA590950             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU808607             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU808283             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA846142             [                                                             GCTCT ACT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCTTCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU806977             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CA846272             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCTGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CA591314             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU806266             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGGGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU806340             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGTTCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CA846055             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCTGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG TG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CA589134             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA588238             [                                                             GTTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAANGATGTTGATGCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CA846156             [                                                             GCTCT CTT CATGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTC CTTACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAAAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CA846221             [                                                             GATCA CGT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G C CTTATA GAAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGACCTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACTTCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CA845891             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAGCCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU807030             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU806330             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU806512             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CA333198             [                                                             GCTCT CCT CTTGCCGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGNCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU807069             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CA591312             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU807955             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCGCACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU808000             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGTT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGANGAACATGCAGGGCCTTGTTGNAGAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU807796             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGANGAACATGCAGGGCCTTGTTGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU807862             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CGTGCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL BU808628             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU807937             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL BU808495             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGGCACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU807800             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGCCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGGC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG TGGGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGGGGAACATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL BU807906             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL BU808294             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAGCATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAt                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU807946             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G TG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL BU807772             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAATGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL BU807790             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAGCCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGGNA GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BU807998             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCACCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGACAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G T TT TCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CA846022             [                                                             GCCTT CAA CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCCCTTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTTCAACATTGACAGCATGGTCG AGGCCTACA TCAACAACCTGCGCAGACAGCTC GATGGGCTGGGC ACGAGAAGGGTAAGCTTGA GGGAAAACTGAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU807771             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAGCCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BU807883             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BU808600             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG G GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL BU808023             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG AGGG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCACACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CA589577             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CA846223             [                                                             GCTCG AAT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCTTCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGTTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808016             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CA590131             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGGCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGGAAGTCAAGCTTGA GGGAGAACTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CA591118             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACGACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGGCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAAGTCAAGCTTGA GGGAGAACTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CA589721             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACTA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AAGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAAGTCAAGCTTGA GGGAGAACTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU807116             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU808424             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC CAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGGTCG AGGTCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA591281             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGGNA GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU807904             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G T  GTG CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU808541             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU808501             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CA589859             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CA590097             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CA589615             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CA589612             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCGGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCCAGCTTGA GGGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU808556             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC CATGGGCTGGGCAACGAGAAGGTCAAGCTTGA AGGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CA589891             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCGTGTTCG AGGGCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU808231             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G T  G T TG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTACGCAGACAGCTC GATGGGCTGGGCAACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CA589716             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GGTT GGTGG  GTTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU808292             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU808542             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CA589727             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU806379             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTCC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CA590053             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU808304             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU808247             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU808580             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC A     G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU808145             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTCCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CA589351             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGGAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU806509             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU808276             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU807932             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAAGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CA590820             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAAGCTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU807881             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGTCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU808375             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACATTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T TGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CA590934             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU808567             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGACCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAa                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU806347             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL BU808096             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTCCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL BU808082             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU806970             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CA845860             [                                                             GCTCT TCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCCGTACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTCCTCA GGGNCGTCTATGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU808077             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGGCC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU807378             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CA590905             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CA589518             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU807943             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG TNGGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BU806472             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AGTTT T T  T T TG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGGTCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGGAACGAGAAGGTCAAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BU808288             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU806959             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU808551             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCCGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU806234             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG T T  GTG CG GCGGCGGCGGCGGCTTCAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGACTACA TCAGCAACCTGCGCAAACAGCTC GATGGGATGGGCCACGAGAAGGGTCAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BU808558             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAA GTCAAGCTTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU807876             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CA590794             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CA590046             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BU808412             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BU808410             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CA589219             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGGAACGAGAAGGTCAAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CA589600             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTAGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAC  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BU807997             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BU808240             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAC GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU808301             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU808228             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGAGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  T G TG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CA591407             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCCAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BU806507             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGTTCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BU807789             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CA846140             [                                                             GCTCT TCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCCG TCAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTCCTCA GGGNCGTCTAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU808104             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG TAGGTGG  ATTTGGCTAC TCCAATGCAGACATGATCGCTCCAACCATCACAACTGT CCAAGTCAACAAGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGGTTCGCCTCCTTCATCGACAA  GGTGCG TTTCCTGTAAC AGCAGAACAAGATGC T GGAGACC ATAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGGCTACA TCAGCAACCTGCGCATACAGCTC GATGGGCTGGGCAACGAGAAc                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU808126             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CA589994             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU808031             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTCCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CA845839             [                                                             GCTCT CTT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCTCACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGGTGATGCTGCCTACATGAAACAGGTGGAACTTGAAAGCCAGGCTGATG CGCTCCANGATGAGATCAACTTCCTCA GGGCCGTCTAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU808042             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808036             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU807917             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU806424             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808554             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCACTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808533             [                                                             GCTCT CTT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808387             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCGGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGTGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808386             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAATCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808266             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCCTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CA591162             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGGCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808211             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU807866             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCGGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808577             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACCA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808528             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808504             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808474             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808473             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGGCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808357             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCTACATTGACAGCATGTTCG AGGGCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGGAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808329             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGGCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808325             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G T CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808200             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808188             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808170             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808153             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808148             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808139             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCGTGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808065             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808056             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808070             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGGNA GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU806274             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGG CAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU807873             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCGTCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU807986             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAGCAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG GTT  T G TG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU808403             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU807807             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG TGGGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA846089             [                                                             GCTCC TTA CAAGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGC C TTAACACTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCCACTTCCTCA GGGCCGTCTAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU806295             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GACGGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA591001             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCCGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CA846267             [                                                             GCTCT CTT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ATAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGTTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTCCTCA GGGCCGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU806357             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGATG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL BU808602             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC A     G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CA589393             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL BU808179             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA590930             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTTCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGAAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL BU808519             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA845835             [                                                             GCTCT CTT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ATAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCTATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTCCTCA GGGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU805947             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CA589033             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G T CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU807047             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTAGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  T CC AT CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CA588962             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACATNGA GAAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G T CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGGCTACA TCAGCAACCTGCGCAGACAGCTC GAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU808354             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CA591642             [                                                             GTTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CCTTTCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCGGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCCGGGCCTTGTCGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCCACAACCGCGCACCTGCAGAGAATGAATCTGGGGCCCTGAAAAAGGATGATGATGCTGCCTACATGAACCAGGTGGAACTTCGACCCAGTGCTGATGCCGCTCCCGGATG GATTAACTCCCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CA590991             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGCGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU805824             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATTGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU806982             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL BU806948             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CA845912             [                                                             GCTCT TTT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU807348             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACGGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCCGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL BU806915             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTCCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCGGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU807080             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTCCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGNCTACA TCAGCAACCTGCGCAGACAGCTC GAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU805758             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC A     G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU808401             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU805951             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGGAA GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL BU807057             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CCTAT TG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CA846178             [                                                             GCTCT TCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGTGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGGAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU808432             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG  G G T  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU805840             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU808161             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL BU805897             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC A     G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG TNGGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU805826             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL BU807248             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL BU806876             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU806989             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCGCAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU807157             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGGCTACA TCAGCAACCTGCGCAGACAGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU805857             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU806874             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU807320             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG ATTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU805842             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AT CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL BU807959             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G T  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL BU807010             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AT CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL BU805943             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU805877             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGA CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CA589025             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGGCTACA TCAGCAACCTGCGCAGACAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU807090             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU807081             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU805988             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU807018             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCCCACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU807350             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AT CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CA846145             [                                                             GCTCT TCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTGTACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTACG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU807376             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU805879             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTCTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU805940             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGGCTACA TCANCAACCTGCGCAGACAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU806044             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTGCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATGGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU807432             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCCGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU806073             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGGGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG TGGGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU805837             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL BU805928             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL BU806084             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG AGGG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU807092             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGGNA GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGACCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU807223             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL BU806155             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU805969             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG TG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGAG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU805703             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGGCTACA TCAGCAACCTGCGCAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU805736             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCT TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU805878             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCGGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU805915             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU805907             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTTCTTG C CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTCT T TT TG TG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL BU805952             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GGTT GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU806950             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL BU805723             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGC CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU806151             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU806954             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGC CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU806031             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  T CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU805787             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU807211             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC TG CG G C  G G CG GCGGCGGCTTCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU805755             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG TGGGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL BU805762             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCGGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL BU805829             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL BU807314             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CA845830             [                                                             GCTCC CTTAATTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCCG TCAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCTTGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU805864             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGGCCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CA845975             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU806004             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCCCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU805892             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAGTGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU807343             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU805973             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL BU806871             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  GTCC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL BU805953             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL BU807213             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL BU807232             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL BU807218             [                                                             GCTCT CCT CTGGACGCCTGCGCATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CA588976             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU807422             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CA589012             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GTGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCC AG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL BU805764             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG T C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACTTTGACAGCATGTTCG Aa                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL BU805991             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTCT T CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU805887             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL BU806204             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG C CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CA589207             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CA591409             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGGGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTTCTGCAGGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CA846037             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGTTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCGACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU807008             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTCGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU805783             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL BU806885             [                                                             GCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC TG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCG CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CA846065             [                                                             cCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCTTCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CA588514             [                                                              CTAT ACT CTTGACGCCTGCACATCTTCAGTTCTCCTTG GCCTCTGCTG ACAACCCTAACCGCTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGTTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CA846092             [                                                             cCTTA CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCTTCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CA846318             [                                                              CTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG C CTTAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGACGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGCTGATGCTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL BU807988             [                                                              CTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCACCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G TT GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGNCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGANG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BU807804             [                                                              CTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCCCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTCCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGGCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU806359             [                                                              CTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG T T  T T TG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG CTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL BU806522             [                                                              CTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA589421             [                                                              CTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GTTGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CA589167             [                                                              CTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATGTCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACGAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CA846342             [                                                              CTCT CTA CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCCG TCAACCCTAACCACTGCAAGCAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CA588358             [                                                             cCTCC CAG GGTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCCTTTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC AATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CA845841             [                                                             cCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGTTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAAGCTGATG CG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CA846231             [                                                            ctCTTA CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCACTTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAAACAGGTGGGACTTGAAGCCAAGGCTGAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CA846242             [                                                             cCTTT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG T CTCATCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAANGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CA846056             [                                                             cCTTT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCATCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAACCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CA846034             [                                                             cCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCATCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG GACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CA846036             [                                                             cCTCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCATTTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTCGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL BU806936             [                                                               TCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CCAACACCGCTTTGCCTCCTTCATCGACCA  GGTGCGTTTTCCTGGAAC AGCAGAACAAGATGC TGGGAGACCAAAAT GGAGTCTTCTGGAGGAAAAGACCACCC CCCCGCTCCACATTGACCGCATGTTCC AGGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CA591475             [                                                            tttTCA CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCCAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CA846328             [                                                             ctTTT ACT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCTTCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU808549             [                                                               TCT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGGACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAa                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CA845794             [                                                                CT CCC TTTTGAGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACCATCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCCAGATGAGATCAACTTCCTCA GG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CA845951             [                                                                CT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTCCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU807844             [                                                                CT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGCGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CA846014             [                                                               gCT CCTACAAGACG CTGCACATCTTCAGTTCTCCTTG G CTCGCCGT AAAA  CTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCTATTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATNGTGATGCTGCCTACATGAACAAAGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTCCTCA GGGCCGTCTATGAGGgg                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU806449             [                                                                CT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU806384             [                                                                CT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG CTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU808346             [                                                                CT CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU808361             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU807360             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCGAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGTACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL BU806429             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU807111             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCA CAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGGCTC  G CC AG CG G C  G G CG GCGGCGGCGGCCGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGGGGGAATTTGGCTACTTCCAATGGAGNCATGATCGCTTCAACCATTACAGGTGTCCCAAGTCCACAGGAGGCTGCTGGGCCCCTCTGAAACCGGGAAATCAACCCC ATATCCAGGCTGGTCGCCCACC CGGAAAGGGACAGATCTAGACCCTCCAACAACGGTTTGGCCTTCTTTATCGAAAAAGGGGGGT TTTCCCGGAACAAGCAAAAAAAGATGCTT GGAGAAC ACATGGGAGCCTCCTGGAGGGAa                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA589887             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CA846234             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT TCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTCCTCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL BU808152             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAATCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL BU807394             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCAACACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL BU806864             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC A     G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTA GATGGGCTGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL BU806549             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAATCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCCGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG AGGG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CA591645             [                                                            gtaaaT CGT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CCTAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCTCAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGAGCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCATAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGGAACGAGAAGGGTCAACTTGA GGGAAAACTGAGGAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CA845828             [                                                                 T CCT CTAGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG CCTTCCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCGGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU807396             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCTTCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG TCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CA846235             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCGAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CA846227             [                                                                 T CCC CTTGA GCCTGC CATCTTCAGTTCTCCTTG G CTCAGCTG AC CCTCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACATGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTCCTCA GGGCCGTCTATGAGGCTGAACTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA588446             [                                                             cgatT ACG CGTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCATATA AGGACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACTGTTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTCTGCCTCCTTCATCGACAA  GGTGCG GTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGGGCTCCTGAAGAAGGATGGTGAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CA845983             [                                                                 T CTT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGGACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA846000             [                                                               ctT TCA CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCACTTT ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGTAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCTAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU808367             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BU808397             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC A     G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CA591516             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCTGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCA GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACACTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAAAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGGGGAACTTGGAGCCAAGGCTGAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU806960             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU806127             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CA845857             [                                                                 T CTA CAGGACGCCTGCGCATCTTCAGTTCTCCTTG G CTCAGCTG TTAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCAGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTCCTCA GGGCCGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CA588379             [                                                             gtctT TCT ATTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCACCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGGCCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGGTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU808609             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCGTCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU806328             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTTGAAGCATGTTTC GAGGCTACA TCAGCAACCTGCGGCAACAGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU808425             [                                                                 T CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL BU807229             [                                                                   CCT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGCGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAGATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CA846076             [                                                                 c CTA CATGACGCCTGCACATCTTCAGTTCTCCTTG G CTCATCTT A AAGGGTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CA846150             [                                                            cctcaa CCG CTTGACGNCTGCACATCTTCAGNTCTCCGTG G CCATGTTG AGGACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCCAGGCTGAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CA588599             [                                                            gttcag CGT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CCCTTAAG  GAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA846359             [                                                                    CT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAANCAGGTGGAACTTGAAGCCAAGGCTGATG CG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CA845888             [                                                             cctttcaaT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCTTCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL BU806080             [                                                                     T CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G CTTG T CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGGATGTTCG AGGCCTACA TCAGCAACCTGCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CA591445             [                                                                cactgT CTTGACGCCTGCACATCTTCAGTTCTCCTTG G CT AGAAA GAAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGGGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGGTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CA588568             [                                                               cataagg CTTGACGCCTGCACATCTTCAGTTCTCCTTG G  TCCTTTA GAAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGCC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCGATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCATTTTTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCCTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGAa                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL BU806259             [                                                                        TTGACGCCTGCACATCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG TACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BU808601             [                                                                               CTGCACATCTTCAGTTCTCCTTT G  TTACATA GAAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  A CC AG CG T T  T T TT TTGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGTGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGACCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAGAAGGAACGGATCAGGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA TCCGCTCCAACATTGACAGGATGGTCG AGGTCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGATGGGCAACTAGAAAGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA846219             [                                                                                      TCTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CA588518             [                                                                                      TCNNCAGNNCNCCTTG G CTTCTTTT GAGAGCCTAACCACTGCAAACAT GA GGAAGNCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTCTTGGAC     CAGNAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGTTGT TTAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGGTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGGA AATAACAAAGGTGCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CA846174             [                                                                                       CTTCAGTTCTCCTTG G CTCAGCTC TAAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTCCTCA GGGCCGTCTAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CA846138             [                                                                                       CTTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGTTGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAANGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTCCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CA845822             [                                                                                       CTTCAGTTCTCCTTG G CTCAGCTC TCAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTCCTCA GGGGCGTCTAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CA588284             [                                                                                        TTCAGTTCTCCTTG G CTCCCTAG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCCGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCTCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGGGGAACTTGAAGCCAAGGCCGATG CG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CA845977             [                                                                                        TTCAGTTCTCCTTG G CTCACCTT ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGCCC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCTAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CA846302             [                                                                                        TTCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CA846049             [                                                                                        TTCAGTTCTCCTTG G CTCAGCCG TCAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT TCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCCAAGCTGATG CGCTCCAGGATGAGATCAACTTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CA845931             [                                                                                        TTCAGTTCTCCTTG G CTC GCAT TAAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TCTCC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCTTGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CA845957             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAAGTTCAGCTTGA NGGAGAACTGAAGAACATGCANGGCCCTTGTGANGACTTTTAGAAGAAGTATGAAG ATGAANATCAAC AACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAAGGATGTGAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CA589865             [                                                                                         TCAGTTCTCCTTG G CTCACCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGGCACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL BU807871             [                                                                                         TCAGTTCTCCTTG G CCCCGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CT T T  T T TT TTGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCCACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAAGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CA845949             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU806983             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG TG T C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGGCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CA846066             [                                                                                         TCAGTTCTCCTTG G CTCTGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CA591665             [                                                                                         TCAGTTCTCCTTG G CTCTGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CA588309             [                                                                                         TCAGTTCTCCTTG G C CTTTTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACCAGGTGGAACTTGAAGCCAAGGCTGATG CG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CA845807             [                                                                                         TCTGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT AA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL BU806268             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCCGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CA845984             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGNTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CA846070             [                                                                                         TCAGTTCTCCTTG G CTCAGCTT ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CA845838             [                                                                                         TCAGTTCTCCTTG G CTCACCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CA845979             [                                                                                         TCAGTTCTCCTTG G CTCACCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CGACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CA846194             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CA845962             [                                                                                         TCAGTTCTCCTTG G CTCAGCTGTACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCGGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAGGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AAGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAANGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CA588316             [                                                                                         TCAGTTCTCCTTG G CTCACTTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGTCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGACAACTGATGAACATGCAGGGTCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCGGAGAATGAGTTTGTGCTCCTGAACAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAAGATGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CA845895             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CA591251             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G TG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CA591364             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCAACACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AAGGCTACA TCAGCAACCTGCGCAGAAAGCTC GATGGGCTGGGGCACGAGAAa                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BU806963             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CA846353             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCACGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTTAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CA845933             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CA846344             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG TCAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CA845987             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CA846172             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CA846008             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGTG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTCCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CA846048             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTCCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU806338             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AT TT T T  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACG GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU806997             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL BU807126             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AT TG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CA846171             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T AGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTCCTCA GG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CA846193             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGCTGATG CGCTCCAGGATGAGATCAACTTCCTCA GGGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CA846105             [                                                                                         TCAGTTCTCCTTG G CTCACTTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCATGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCAACGAGAAGGTCAAGCTTGA GGGAGAACTGAGGAACATGCAGGGCCTTGTTGAGGACTTTAAGAAGAAGTATGAAG ATGAA ATCAACAAACGTGCAGCTGCAGAGAATGAGTTTGTGCTCCTGAAGAAGGATGTTGATGCTGCCTACATGAACAAGGTGGAACTTGAAGCCAAGGTTGATG CCCTCCAGGATGAGATCAACTTCCTCA GGGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL BU806900             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CA589435             [                                                                                         TCAGTTCTCCTTG G CTCCGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G T  T G TT GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATTAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTGGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU806233             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAAACTGCGCAGACAGCTC GATGGGCTGGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL BU806491             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG T C  G G CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGAAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCGACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGGCTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL BU806336             [                                                                                         TCAGTTCTCCTTG G CTCAGCTG ACAACCCTAACCACTGCAAACAT GA GGAAGTCACACTCTGTCAGAGAATACAGCACCAGCACCAGGAGGTC TGGAC     CAGTAACTTCTTTCAGTAGGACCAGCTTTGGCAACCTCGGCTCCAGTGCTGGCGGCAGCTACGGCAGCAGCAGTGGCTTCGGCAGCAGCGGCTTCGGCAGCAGCGGCTTC  G CC AG CG G C  G T CG GCGGCGGCGGCGGCTACAGCTCATCTTCAATGATCGGGGGTGG A GG T GGTGG  ATTTGGCTAC TCCAATGCAGCCATGATCGCTCCAACCATCACAGCTGT CCAAGTCAACAGGAGCCTGCT GGCCCCTCTG AACCTGGAAATCGACCCCAATATCCAGGCTGTTCGCACACA GGAAAAGGAACAGATCAAGACCCT CAACAACCGCTTTGCCTCCTTCATCGACAA  GGTGCG TTTCCTGGGAC AGCAGAACAAGATGC T GGAGACC AAAT GGAGTCTCCTGCAGGAACAGACCACCA CCCGCTCCAACATTGACAGCATGTTCG AGGCCTACA TCAGCAACCTGCGCAGACAGCTC GATGGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]