Home
Who am I
Technology
EST Assembly
Contact

These datas are free for academic use only, please contact me for any other use.

Takifugu rubripes
cluster # 509 cluster # 509       Sequences # 2       consensus # 1


see consensus multiple alignment with clustalw

Direct access to contigs :
consensus_509#0 length = 1020 sequences # 2  

consensusID : consensus_509#0
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 2
consensus length = 1020
fasta sequence
                              [TTTCACAGTGACAAATAATGAAGTCTTTATTCACTGTGTTTGGGCTGCGTATAATAATAATTTGAATCAAACTATGACATTTTCAATAAATGTAATAAATCTCATACAGGTTCCACGTTCAATTTTAAACCCATACAGTTAGAAAAATAGTGGTCTCTTGAAGAATTCCCATTGGACGGCAGAAGGGTGAGTCTGATATAAGAAGACAGCTCCTTGTGAGAAAAGCTGCGTTCGCCGCCATACAAATAATGCATTTGTGTTTGCCTTATCAGAACGGCAGAGTATCCAAAAAGATCTTTTCCACTATGGGCGGAGGGGGGACCAGGTCCTCCAGTTTTAGATAAAAGATGCGCTGTAGGCCCTGTGTGCATAGAGTCCTCAGTTCAGGGAGTTTGCTCAGAAGACGAGAAAGGTAGTTGGACTGCGTCCGGCACACTTCTGAACCGCTTCCGCTCATGTGTTCCCTTAAGCAAGCGATGAGATGATTTTGGAATTCTTCGACCCGTTTGGGCTCCTTGAGGCCATGACGATCAGTGATAATTACTAACGCTGCCAGGCATGCAAAGAGGGAGATGTCTAAATTCATCCGGTGTAGACTTTGGGAGAAATCCATGATGGAGTCGATCCAGTCACCAAAGCTGTGAACGCACTGCAGCCGGTGGAGAACCACACCGTTGCAGAAGATCAGCTTGTTCTTCTCGGGATTTGACCTGTACGCGAGCCGCAGGATGAAGAGCTCAACAAAGGCAGATTCCAGAAGCAGCTCCTGGTCTTCTTTGCAGAAATCGGTGAATCCTGGGACCGTTTCAGCCCAGTTTCTTATTACGTCCAAAGAACCAGTCAGCAGGTCATAAAACTGCTGGATGTCACTGGCGTCCTCCTTCTCTTTTAGGTCACCGGTGCTCTCCTGGTACTTAGAGTAATCGAGCTTTTCAATGGTTGGGTTGGAGTCTAGATGAGCCCTGACAAGAGAGGCCACGATGGGACACGGGCACGGTGGAGGAGGGCTCCGTGAGAACT]

[+] EMBL CA332575             [TTTCACAGTGACAAATAATGAAGTCTTTATTCACTGTGTTTGGGCTGCGTATAATAATAATTTGAATCAAACTATGACATTTTCAATAAATGTAATAAATCTCATACAGGTTCCACGTTCAATTTTAAACCCATACAGTTAGAAAAATAGTGGTCTCTTGAAGAATTCCCATTGGACGGCAGAAGGGTGAGTCTGATATAAGAAGACAGCTCCTTGTGAGAAAAGCTGCGTTCGCCGCCATACAAATAATGCATTTGTGTTTGCCTTATCAGAACGGCAGAGTATCCAAAAAGATCTTTTCCACTATGGGCGGAGGGGGGACCAGGTCCTCCAGTTTTAGATAAAAGATGCGCTGTAGGCCCTGTGTGCATAGAGTCCTCAGTTCAGGGAGTTTGCTCAGAAGACGAGAAAGGTAGTTGGACTGCGTCCGGCACACTTCTGAACCGCTTCCGCTCATGTGTTCCCTTAAGCAAGCGATGAGATGATTTTGGAATTCTTCCACCCGTTTGGGCTCCTTGAGGCCATGACGATCAGTGATAATTACTAACGCTGCCAGGCATGCAAAGAAGGAGATGTCTAAATTCATCCGGTGTAGACTTTGGGAGAAATC                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[-] EMBL CA845387             [                                                                                                                                                                                                                                                                                                                                                                                                          GCTCAGAAGACGAGAAAGGTAGTTGGACTGCGTCCGGCACACTTCTGAACCGCTTCCGCTCATGTGTTCCCTTAAGCAAGCGATGAGATGATTTTGGAATTCTTCGACCCGTTTGGGCTCCTTGAGCCCATGACGATCAGTGATAATTACTAACGCTGCCAGGCATGCAAAGAGGGAGATGTCTAAATTCATCCGGTGTAGACTTTGGGAGAAATCCATGATGGAGTCGATCCAGTCACCAAAGCTGTGAACGCACTGCAGCCGGTGGAGAACCACACCGTTGCAGAAGATCAGCTTGTTCTTCTCGGGATTTGACCTGTACGCGAGCCGCAGGATGAAGAGCTCAACAAAGGCAGATTCCAGAAGCAGCTCCTGGTCTTCTTTGCAGAAATCGGTGAATCCTGGGACCGTTTCAGCCCAGTTTCTTATTACGTCCAAAGAACCAGTCAGCAGGTCATAAAACTGCTGGATGTCACTGGCGTCCTCCTTCTCTTTTAGGTCACCGGTGCTCTCCTGGTACTTAGAGTAATCGAGCTTTTCAATGGTTGGGTTGGAGTCTAGATGAGCCCTGACAAGAGAGGCCACGATGGGACACGGGCACGGTGGAGGAGGGCTCCGTGAGAACT]


>consensus_509#0 TTTCACAGTGACAAATAATGAAGTCTTTATTCACTGTGTTTGGGCTGCGTATAATAATAA TTTGAATCAAACTATGACATTTTCAATAAATGTAATAAATCTCATACAGGTTCCACGTTC AATTTTAAACCCATACAGTTAGAAAAATAGTGGTCTCTTGAAGAATTCCCATTGGACGGC AGAAGGGTGAGTCTGATATAAGAAGACAGCTCCTTGTGAGAAAAGCTGCGTTCGCCGCCA TACAAATAATGCATTTGTGTTTGCCTTATCAGAACGGCAGAGTATCCAAAAAGATCTTTT CCACTATGGGCGGAGGGGGGACCAGGTCCTCCAGTTTTAGATAAAAGATGCGCTGTAGGC CCTGTGTGCATAGAGTCCTCAGTTCAGGGAGTTTGCTCAGAAGACGAGAAAGGTAGTTGG ACTGCGTCCGGCACACTTCTGAACCGCTTCCGCTCATGTGTTCCCTTAAGCAAGCGATGA GATGATTTTGGAATTCTTCGACCCGTTTGGGCTCCTTGAGGCCATGACGATCAGTGATAA TTACTAACGCTGCCAGGCATGCAAAGAGGGAGATGTCTAAATTCATCCGGTGTAGACTTT GGGAGAAATCCATGATGGAGTCGATCCAGTCACCAAAGCTGTGAACGCACTGCAGCCGGT GGAGAACCACACCGTTGCAGAAGATCAGCTTGTTCTTCTCGGGATTTGACCTGTACGCGA GCCGCAGGATGAAGAGCTCAACAAAGGCAGATTCCAGAAGCAGCTCCTGGTCTTCTTTGC AGAAATCGGTGAATCCTGGGACCGTTTCAGCCCAGTTTCTTATTACGTCCAAAGAACCAG TCAGCAGGTCATAAAACTGCTGGATGTCACTGGCGTCCTCCTTCTCTTTTAGGTCACCGG TGCTCTCCTGGTACTTAGAGTAATCGAGCTTTTCAATGGTTGGGTTGGAGTCTAGATGAG CCCTGACAAGAGAGGCCACGATGGGACACGGGCACGGTGGAGGAGGGCTCCGTGAGAACT



clustalw multiple alignements is not computed in this case


Data build on Sat Aug 9 00:50:02 CEST 2003 by Hubert Wassner    (hubert.wassner@noos.fr)