| 4 |
|
#include "GList.hh" |
| 5 |
|
|
| 6 |
|
#define USAGE "Usage:\n\ |
| 7 |
< |
fqtrim [-5 <5'adapter>] [-3 <3'adapter>] [-l <minlen>] [-C] [-D] [-Q] \\\n\ |
| 8 |
< |
[-n <rename_prefix>] [-o <trimmed.fq>] [-r <discarded.lst>] <input.fq>\n\ |
| 7 |
> |
fqtrim [-5 <5'adapter>] [-3 <3'adapter>] [-l <minlen>] [-q <minqv>] [-C] [-D]\\\n\ |
| 8 |
> |
[-p {64|33}] [-n <rename_prefix>] [-o <trimmed.fq>] [-r <discarded.lst>]\\\n\ |
| 9 |
> |
[-Q] <input.fq>\n\ |
| 10 |
|
\n\ |
| 11 |
< |
Trim low quality bases at 3' end, optional adapter, filter for low complexity and\n\ |
| 12 |
< |
optionally collapse duplicates in the input fastq data.\n\ |
| 11 |
> |
Trim low quality bases at 3' end, optionally trim adapter sequence, filter\n\ |
| 12 |
> |
for low complexity and collapse duplicate reads\n\ |
| 13 |
|
\n\ |
| 14 |
|
Options:\n\ |
| 15 |
|
-n rename all the reads using the <prefix> followed by a read counter;\n\ |
| 20 |
|
(e.g. -5 CGACAGGTTCAGAGTTCTACAGTCCGACGATC)\n\ |
| 21 |
|
-3 trim the given adapter sequence at the 3' end of each read\n\ |
| 22 |
|
(e.g. -3 TCGTATGCCGTCTTCTGCTTG)\n\ |
| 23 |
< |
-l minimum \"clean\" length at the high quality 5'end that a read must\n\ |
| 24 |
< |
have in order to pass the filter (default: 16)\n\ |
| 23 |
> |
-q trim bases with quality value lower than <minq> (starting the 3' end)\n\ |
| 24 |
> |
-m maximum percentage of Ns allowed in a read after trimming (default 7)\n\ |
| 25 |
> |
-l minimum \"clean\" length after trimming that a read must have\n\ |
| 26 |
> |
in order to pass the filter (default: 16)\n\ |
| 27 |
|
-r write a simple \"trash report\" file listing the discarded reads with a\n\ |
| 28 |
|
one letter code for the reason why they were trashed\n\ |
| 29 |
+ |
-D apply a low-complexity (dust) filter and discard any read that has over\n\ |
| 30 |
+ |
50% of its length detected as low complexity\n\ |
| 31 |
|
-C collapse duplicate reads and add a prefix with their count to the read\n\ |
| 32 |
< |
name\n\ |
| 33 |
< |
-D apply a low-complexity (dust) filter and discard any read that has at\n\ |
| 34 |
< |
least half of it masked by this\n\ |
| 35 |
< |
-Q quality values in the input data are interpreted as phred64, convert\n\ |
| 31 |
< |
them to phred33\n\ |
| 32 |
> |
name (e.g. for microRNAs)\n\ |
| 33 |
> |
-p input is phred64/phred33 (use -p64 or -p33)\n\ |
| 34 |
> |
-Q convert quality values to the other Phred qv type\n\ |
| 35 |
> |
-V verbose processing\n\ |
| 36 |
|
" |
| 37 |
|
// example 3' adapter for miRNAs: TCGTATGCCGTCTTCTGCTTG |
| 38 |
+ |
|
| 39 |
+ |
//For pair ends sequencing: |
| 40 |
+ |
//3' : ACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| 41 |
+ |
//5' : GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG |
| 42 |
|
FILE* f_out=NULL; //stdout if not provided |
| 43 |
|
FILE* f_in=NULL; //input fastq (stdin if not provided) |
| 44 |
|
FILE* freport=NULL; |
| 45 |
|
bool debug=false; |
| 46 |
+ |
bool verbose=false; |
| 47 |
|
bool doCollapse=false; |
| 48 |
|
bool doDust=false; |
| 49 |
|
bool trashReport=false; |
| 50 |
< |
bool rawFormat=false; |
| 50 |
> |
//bool rawFormat=false; |
| 51 |
|
int min_read_len=16; |
| 52 |
+ |
double max_perc_N=7.0; |
| 53 |
|
int dust_cutoff=16; |
| 54 |
|
bool isfasta=false; |
| 55 |
< |
bool phred64=false; |
| 55 |
> |
bool convert_phred=false; |
| 56 |
|
GStr prefix; |
| 57 |
|
GStr adapter3; |
| 58 |
|
GStr adapter5; |
| 59 |
+ |
|
| 60 |
+ |
int qvtrim_min=0; |
| 61 |
+ |
|
| 62 |
+ |
int qv_phredtype=0; // could be 64 or 33 (0 means undetermined yet) |
| 63 |
+ |
int qv_cvtadd=0; //could be -31 or +31 |
| 64 |
+ |
|
| 65 |
|
int a3len=0; |
| 66 |
|
int a5len=0; |
| 67 |
|
// adaptor matching metrics -- for extendMatch() function |
| 68 |
< |
static const int a_m_score=2; //match score |
| 69 |
< |
static const int a_mis_score=-3; //mismatch |
| 70 |
< |
static const int a_dropoff_score=7; |
| 71 |
< |
static const int a_min_score=7; |
| 68 |
> |
const int a_m_score=2; //match score |
| 69 |
> |
const int a_mis_score=-3; //mismatch |
| 70 |
> |
const int a_dropoff_score=7; |
| 71 |
> |
const int a_min_score=8; //an exact match of 4 bases at the proper ends WILL be trimmed |
| 72 |
> |
const int a_min_chain_score=15; //for gapped alignments |
| 73 |
> |
|
| 74 |
> |
class CSegChain; |
| 75 |
> |
|
| 76 |
> |
class CSegPair { |
| 77 |
> |
public: |
| 78 |
> |
GSeg a; |
| 79 |
> |
GSeg b; //the adapter segment |
| 80 |
> |
int score; |
| 81 |
> |
int flags; |
| 82 |
> |
CSegChain* chain; |
| 83 |
> |
CSegPair(int astart=0, int aend=0, int bstart=0, int bend=0, int mscore=0):a(astart,aend),b(bstart, bend) { |
| 84 |
> |
score=mscore; |
| 85 |
> |
if (score==0) score=a.len()*a_m_score; |
| 86 |
> |
flags=0; |
| 87 |
> |
chain=NULL; |
| 88 |
> |
} |
| 89 |
> |
int len() { return a.len(); } |
| 90 |
> |
bool operator==(CSegPair& d){ |
| 91 |
> |
//return (a.start==d.a.start && a.end==d.a.end && b.start==d.b.start && b.end==d.b.end); |
| 92 |
> |
//make equal even segments that are included into one another: |
| 93 |
> |
return (d.a.start>=a.start && d.a.end<=a.end && d.b.start>=b.start && d.b.end<=b.end); |
| 94 |
> |
} |
| 95 |
> |
bool operator>(CSegPair& d){ //ordering based on b (adaptor) start coord and score |
| 96 |
> |
if (b.start==d.b.start) { |
| 97 |
> |
if (score==d.score) { |
| 98 |
> |
//just try to be consistent: |
| 99 |
> |
if (b.end==d.b.end) { |
| 100 |
> |
return (a.start==d.a.start)?(a.end<d.a.end):(a.start<d.a.start); |
| 101 |
> |
} |
| 102 |
> |
return (b.end>d.b.end); |
| 103 |
> |
} |
| 104 |
> |
else return (score<d.score); |
| 105 |
> |
} |
| 106 |
> |
return (b.start>d.b.start); |
| 107 |
> |
} |
| 108 |
> |
bool operator<(CSegPair& d){ //ordering based on b (adaptor) coord |
| 109 |
> |
/*if (b.start==d.b.start && b.end==d.b.end) { |
| 110 |
> |
return (a.start==d.a.start)?(a.end<d.a.end):(a.start<d.a.start); |
| 111 |
> |
} |
| 112 |
> |
return (b.start==d.b.start)?(b.end<d.b.end):(b.start<d.b.start);*/ |
| 113 |
> |
if (b.start==d.b.start) { |
| 114 |
> |
if (score==d.score) { |
| 115 |
> |
//just try to be consistent: |
| 116 |
> |
if (b.end==d.b.end) { |
| 117 |
> |
return (a.start==d.a.start)?(a.end>d.a.end):(a.start>d.a.start); |
| 118 |
> |
} |
| 119 |
> |
return (b.end<d.b.end); |
| 120 |
> |
} |
| 121 |
> |
else return (score>d.score); |
| 122 |
> |
} |
| 123 |
> |
return (b.start<d.b.start); |
| 124 |
> |
} |
| 125 |
> |
}; |
| 126 |
> |
|
| 127 |
> |
int cmpSegEnds(pointer sa, pointer sb) { //sort by adaptor seg ends AND score |
| 128 |
> |
CSegPair& x = *(CSegPair *)sa; |
| 129 |
> |
CSegPair& y = *(CSegPair *)sb; |
| 130 |
> |
/* |
| 131 |
> |
if (x.b.end==y.b.end) { |
| 132 |
> |
if (x.b.start==y.b.start) { |
| 133 |
> |
if (x.a.end==y.a.end) { |
| 134 |
> |
if (x.a.start==y.a.start) return 0; |
| 135 |
> |
return ((x.a.start>y.a.start) ? -1 : 1); |
| 136 |
> |
} |
| 137 |
> |
else { |
| 138 |
> |
return ((x.a.end>y.a.end) ? -1 : 1); |
| 139 |
> |
} |
| 140 |
> |
} |
| 141 |
> |
else { |
| 142 |
> |
return ((x.b.start>y.b.start) ? -1 : 1); |
| 143 |
> |
} |
| 144 |
> |
} |
| 145 |
> |
else { |
| 146 |
> |
return ((x.b.end>y.b.end) ? -1 : 1); |
| 147 |
> |
} |
| 148 |
> |
*/ |
| 149 |
> |
if (x.b.end==y.b.end) { |
| 150 |
> |
if (x.score==y.score) { |
| 151 |
> |
if (x.b.start==y.b.start) { |
| 152 |
> |
if (x.a.end==y.a.end) { |
| 153 |
> |
if (x.a.start==y.a.start) return 0; |
| 154 |
> |
return ((x.a.start<y.a.start) ? -1 : 1); |
| 155 |
> |
} |
| 156 |
> |
else { |
| 157 |
> |
return ((x.a.end<y.a.end) ? -1 : 1); |
| 158 |
> |
} |
| 159 |
> |
} |
| 160 |
> |
else { |
| 161 |
> |
return ((x.b.start<y.b.start) ? -1 : 1); |
| 162 |
> |
} |
| 163 |
> |
} else return ((x.score>y.score) ? -1 : 1); |
| 164 |
> |
} |
| 165 |
> |
else { |
| 166 |
> |
return ((x.b.end>y.b.end) ? -1 : 1); |
| 167 |
> |
} |
| 168 |
> |
|
| 169 |
> |
} |
| 170 |
> |
|
| 171 |
> |
class CSegChain:public GList<CSegPair> { |
| 172 |
> |
public: |
| 173 |
> |
uint astart; |
| 174 |
> |
uint aend; |
| 175 |
> |
uint bstart; |
| 176 |
> |
uint bend; |
| 177 |
> |
int score; |
| 178 |
> |
bool endSort; |
| 179 |
> |
CSegChain(bool aln5=false):GList<CSegPair>(true,true,true) {//sorted, free elements, unique |
| 180 |
> |
//as SegPairs are inserted, they will be sorted by a.start coordinate |
| 181 |
> |
score=0; |
| 182 |
> |
astart=MAX_UINT; |
| 183 |
> |
aend=0; |
| 184 |
> |
bstart=MAX_UINT; |
| 185 |
> |
bend=0; |
| 186 |
> |
endSort=aln5; |
| 187 |
> |
if (aln5) { setSorted(cmpSegEnds); } |
| 188 |
> |
} |
| 189 |
> |
bool operator==(CSegChain& d) { |
| 190 |
> |
//return (score==d.score); |
| 191 |
> |
return (astart==d.astart && aend==d.aend && bstart==d.bstart && bend==d.bend); |
| 192 |
> |
} |
| 193 |
> |
bool operator>(CSegChain& d) { // order based on b (adaptor) coordinate |
| 194 |
> |
//return (score<d.score); |
| 195 |
> |
if (bstart==d.bstart && bend==d.bend) { |
| 196 |
> |
return (astart==d.astart)?(aend>d.aend):(astart>d.astart); |
| 197 |
> |
} |
| 198 |
> |
return (bstart==d.bstart)?(bend>d.bend):(bstart>d.bstart); |
| 199 |
> |
} |
| 200 |
> |
bool operator<(CSegChain& d) { |
| 201 |
> |
//return (score>d.score); |
| 202 |
> |
if (bstart==d.bstart && bend==d.bend) { |
| 203 |
> |
return (astart==d.astart)?(aend<d.aend):(astart<d.astart); |
| 204 |
> |
} |
| 205 |
> |
return (bstart==d.bstart)?(bend<d.bend):(bstart<d.bstart); |
| 206 |
> |
} |
| 207 |
> |
void addSegPair(CSegPair* segp) { |
| 208 |
> |
if (AddIfNew(segp)!=segp) return; |
| 209 |
> |
score+=segp->score; |
| 210 |
> |
if (astart>segp->a.start) astart=segp->a.start; |
| 211 |
> |
if (aend<segp->a.end) aend=segp->a.end; |
| 212 |
> |
if (bstart>segp->b.start) bstart=segp->b.start; |
| 213 |
> |
if (bend<segp->b.end) bend=segp->b.end; |
| 214 |
> |
} |
| 215 |
> |
//for building actual chains: |
| 216 |
> |
bool extendChain(CSegPair* segp) { //segp expected to be "Greater Than" current chain |
| 217 |
> |
int bgap=0; |
| 218 |
> |
int agap=0; |
| 219 |
> |
//if (endSort) { |
| 220 |
> |
if (bstart>segp->b.start) { |
| 221 |
> |
bgap = (int)(bstart-segp->b.end); |
| 222 |
> |
if (abs(bgap)>2) return false; |
| 223 |
> |
agap = (int)(astart-segp->a.end); |
| 224 |
> |
if (abs(agap)>2) return false; |
| 225 |
> |
} |
| 226 |
> |
else { |
| 227 |
> |
bgap = (int) (segp->b.start-bend); |
| 228 |
> |
if (abs(bgap)>2) return false; |
| 229 |
> |
agap = (int)(segp->a.start-aend); |
| 230 |
> |
if (abs(agap)>2) return false; |
| 231 |
> |
} |
| 232 |
> |
if (agap*bgap<0) return false; |
| 233 |
> |
addSegPair(segp); |
| 234 |
> |
score-=abs(agap)+abs(bgap); |
| 235 |
> |
return true; |
| 236 |
> |
} |
| 237 |
> |
}; |
| 238 |
|
|
| 239 |
|
// element in dhash: |
| 240 |
|
class FqDupRec { |
| 284 |
|
|
| 285 |
|
GHash<FqDupRec> dhash; //hash to keep track of duplicates |
| 286 |
|
|
| 287 |
< |
bool ntrim(GStr& rseq, GStr &rqv, int &l5, int &l3); //returns true if any trimming occured |
| 288 |
< |
|
| 287 |
> |
bool ntrim(GStr& rseq, int &l5, int &l3); //returns true if any trimming occured |
| 288 |
> |
bool qtrim(GStr& qvs, int &l5, int &l3); //return true if any trimming occured |
| 289 |
|
int dust(GStr& seq); |
| 290 |
|
bool trim_adapter3(GStr& seq, int &l5, int &l3); //returns true if any trimming occured |
| 291 |
|
bool trim_adapter5(GStr& seq, int &l5, int &l3); //returns true if any trimming occured |
| 292 |
|
|
| 293 |
< |
void convertQ64(char* q, int len); |
| 294 |
< |
void convertQ64(GStr& q); |
| 293 |
> |
void convertPhred(char* q, int len); |
| 294 |
> |
void convertPhred(GStr& q); |
| 295 |
|
|
| 296 |
|
int main(int argc, char * const argv[]) { |
| 297 |
< |
GArgs args(argc, argv, "YQRDCl:d:3:5:n:r:o:"); |
| 297 |
> |
GArgs args(argc, argv, "YQDCVl:d:3:5:m:n:r:p:q:o:"); |
| 298 |
|
int e; |
| 299 |
|
int icounter=0; //counter for input reads |
| 300 |
|
int outcounter=0; //counter for output reads |
| 303 |
|
exit(224); |
| 304 |
|
} |
| 305 |
|
debug=(args.getOpt('Y')!=NULL); |
| 306 |
< |
phred64=(args.getOpt('Q')!=NULL); |
| 306 |
> |
debug=(args.getOpt('V')!=NULL); |
| 307 |
> |
convert_phred=(args.getOpt('Q')!=NULL); |
| 308 |
|
doCollapse=(args.getOpt('C')!=NULL); |
| 309 |
|
doDust=(args.getOpt('D')!=NULL); |
| 310 |
+ |
/* |
| 311 |
|
rawFormat=(args.getOpt('R')!=NULL); |
| 312 |
|
if (rawFormat) { |
| 313 |
|
GError("Sorry, raw qseq format parsing is not implemented yet!\n"); |
| 314 |
|
} |
| 315 |
+ |
*/ |
| 316 |
|
prefix=args.getOpt('n'); |
| 317 |
|
GStr s=args.getOpt('l'); |
| 318 |
|
if (!s.is_empty()) |
| 319 |
|
min_read_len=s.asInt(); |
| 320 |
+ |
s=args.getOpt('m'); |
| 321 |
+ |
if (!s.is_empty()) |
| 322 |
+ |
max_perc_N=s.asDouble(); |
| 323 |
|
s=args.getOpt('d'); |
| 324 |
|
if (!s.is_empty()) { |
| 325 |
|
dust_cutoff=s.asInt(); |
| 326 |
|
doDust=true; |
| 327 |
|
} |
| 328 |
< |
|
| 328 |
> |
s=args.getOpt('q'); |
| 329 |
> |
if (!s.is_empty()) { |
| 330 |
> |
qvtrim_min=s.asInt(); |
| 331 |
> |
} |
| 332 |
> |
s=args.getOpt('p'); |
| 333 |
> |
if (!s.is_empty()) { |
| 334 |
> |
int v=s.asInt(); |
| 335 |
> |
if (v==33) { |
| 336 |
> |
qv_phredtype=33; |
| 337 |
> |
qv_cvtadd=31; |
| 338 |
> |
} |
| 339 |
> |
else if (v==64) { |
| 340 |
> |
qv_phredtype=64; |
| 341 |
> |
qv_cvtadd=-31; |
| 342 |
> |
} |
| 343 |
> |
else |
| 344 |
> |
GMessage("%s\nInvalid value for -p option (can only be 64 or 33)!\n",USAGE); |
| 345 |
> |
} |
| 346 |
|
if (args.getOpt('3')!=NULL) { |
| 347 |
|
adapter3=args.getOpt('3'); |
| 348 |
|
adapter3.upper(); |
| 380 |
|
GStr rseq; //current read sequence |
| 381 |
|
GStr rqv; //current read quality values |
| 382 |
|
GStr s; |
| 383 |
< |
if (rawFormat) { |
| 383 |
> |
/* if (rawFormat) { |
| 384 |
|
//TODO: implement qseq parsing here |
| 385 |
|
//if (raw type=N) then continue; //skip invalid/bad records |
| 386 |
|
|
| 387 |
|
} //raw qseq format |
| 388 |
< |
else { // FASTQ or FASTA |
| 388 |
> |
else { // FASTQ or FASTA */ |
| 389 |
|
isfasta=(l[0]=='>'); |
| 390 |
|
if (!isfasta && l[0]!='@') GError("Error: fastq record marker not detected!\n"); |
| 391 |
|
s=l; |
| 392 |
|
rname=&(l[1]); |
| 393 |
|
icounter++; |
| 189 |
– |
//GMessage("readname=%s\n",rname.chars()); |
| 394 |
|
for (int i=0;i<rname.length();i++) |
| 395 |
|
if (rname[i]<=' ') { rname.cut(i); break; } |
| 396 |
|
//now get the sequence |
| 397 |
|
if ((l=fq.getLine())==NULL) |
| 398 |
|
GError("Error: unexpected EOF after header for %s\n",rname.chars()); |
| 399 |
|
rseq=l; //this must be the DNA line |
| 400 |
< |
if (isfasta) { |
| 401 |
< |
while ((l=fq.getLine())!=NULL) { |
| 402 |
< |
//fasta can have multiple sequence lines |
| 199 |
< |
if (l[0]=='>') { |
| 400 |
> |
while ((l=fq.getLine())!=NULL) { |
| 401 |
> |
//seq can span multiple lines |
| 402 |
> |
if (l[0]=='>' || l[0]=='+') { |
| 403 |
|
fq.pushBack(); |
| 404 |
|
break; // |
| 405 |
|
} |
| 406 |
|
rseq+=l; |
| 407 |
< |
} |
| 408 |
< |
} //multi-line fasta file |
| 409 |
< |
if (!isfasta) { |
| 207 |
< |
if ((l=fq.getLine())==NULL) |
| 407 |
> |
} //check for multi-line seq |
| 408 |
> |
if (!isfasta) { //reading fastq quality values, which can also be multi-line |
| 409 |
> |
if ((l=fq.getLine())==NULL) |
| 410 |
|
GError("Error: unexpected EOF after sequence for %s\n", rname.chars()); |
| 411 |
|
if (l[0]!='+') GError("Error: fastq qv header marker not detected!\n"); |
| 412 |
|
if ((l=fq.getLine())==NULL) |
| 413 |
|
GError("Error: unexpected EOF after qv header for %s\n", rname.chars()); |
| 414 |
|
rqv=l; |
| 415 |
< |
if (rqv.length()!=rseq.length()) |
| 416 |
< |
GError("Error: qv len != seq len for %s\n", rname.chars()); |
| 417 |
< |
} |
| 418 |
< |
} //<-- FASTA or FASTQ |
| 415 |
> |
//if (rqv.length()!=rseq.length()) |
| 416 |
> |
// GError("Error: qv len != seq len for %s\n", rname.chars()); |
| 417 |
> |
while (rqv.length()<rseq.length() && ((l=fq.getLine())!=NULL)) { |
| 418 |
> |
rqv+=l; //append to qv string |
| 419 |
> |
} |
| 420 |
> |
}// fastq |
| 421 |
> |
// } //<-- FASTA or FASTQ |
| 422 |
|
rseq.upper(); |
| 423 |
|
int l5=0; |
| 424 |
|
int l3=rseq.length()-1; |
| 428 |
|
} |
| 429 |
|
continue; |
| 430 |
|
} |
| 431 |
< |
if (ntrim(rseq, rqv, l5, l3)) { |
| 431 |
> |
if (ntrim(rseq, l5, l3)) { // N-trimming |
| 432 |
> |
//GMessage("before: %s\n",rseq.chars()); |
| 433 |
> |
//GMessage("after : %s (%d)\n",rseq.substr(l5,l3-l5+1).chars(),l3-l5+1); |
| 434 |
|
if (l3-l5+1<min_read_len) { |
| 435 |
|
if (trashReport) { |
| 436 |
|
fprintf(freport, "%s\tN\t%s\n", rname.chars(), rseq.chars()); |
| 441 |
|
rseq=rseq.substr(l5, l3-l5+1); |
| 442 |
|
if (!rqv.is_empty()) |
| 443 |
|
rqv=rqv.substr(l5, l3-l5+1); |
| 444 |
+ |
l5=0; |
| 445 |
+ |
l3=rseq.length()-1; |
| 446 |
|
} |
| 447 |
< |
|
| 447 |
> |
if (qvtrim_min!=0 && !rqv.is_empty() && qtrim(rqv, l5, l3)) { // qv-threshold trimming |
| 448 |
> |
if (l3-l5+1<min_read_len) { |
| 449 |
> |
if (trashReport) { |
| 450 |
> |
fprintf(freport, "%s\tQ\t%s\n", rname.chars(), rseq.chars()); |
| 451 |
> |
} |
| 452 |
> |
continue; //invalid read |
| 453 |
> |
} |
| 454 |
> |
//-- keep only the l5..l3 range |
| 455 |
> |
rseq=rseq.substr(l5, l3-l5+1); |
| 456 |
> |
if (!rqv.is_empty()) |
| 457 |
> |
rqv=rqv.substr(l5, l3-l5+1); |
| 458 |
> |
} //qv trimming |
| 459 |
|
if (a3len>0) { |
| 460 |
|
if (trim_adapter3(rseq, l5, l3)) { |
| 461 |
|
if (l3-l5+1<min_read_len) { |
| 517 |
|
rseq.chars()); |
| 518 |
|
} |
| 519 |
|
else { //fastq |
| 520 |
< |
if (phred64) convertQ64(rqv); |
| 520 |
> |
if (convert_phred) convertPhred(rqv); |
| 521 |
|
if (prefix.is_empty()) |
| 522 |
|
fprintf(f_out, "@%s\n%s\n+\n%s\n", rname.chars(), rseq.chars(),rqv.chars()); |
| 523 |
|
else |
| 563 |
|
} |
| 564 |
|
} |
| 565 |
|
else { //fastq format |
| 566 |
< |
if (phred64) convertQ64(qd->qv, qd->len); |
| 566 |
> |
if (convert_phred) convertPhred(qd->qv, qd->len); |
| 567 |
|
if (prefix.is_empty()) { |
| 568 |
|
fprintf(f_out, "@%s_x%d\n%s\n+\n%s\n", qd->firstname, qd->count, |
| 569 |
|
rseq.chars(), qd->qv); |
| 585 |
|
} |
| 586 |
|
|
| 587 |
|
FWCLOSE(f_out); |
| 588 |
+ |
//getc(stdin); |
| 589 |
|
} |
| 590 |
|
|
| 591 |
|
class NData { |
| 614 |
|
end5=1; |
| 615 |
|
end3=seqlen; |
| 616 |
|
for (int i=0;i<seqlen;i++) |
| 617 |
< |
if (rseq[i]=='N') {// if (!ichrInStr(rseq[i], "ACGT") |
| 617 |
> |
if (seq[i]=='N') {// if (!ichrInStr(rseq[i], "ACGT") |
| 618 |
|
NPos[NCount]=i; |
| 619 |
|
NCount++; |
| 620 |
|
} |
| 637 |
|
void N_analyze(int l5, int l3, int p5, int p3) { |
| 638 |
|
/* assumes feat was filled properly */ |
| 639 |
|
int old_dif, t5,t3,v; |
| 640 |
< |
if (l3-l5<min_read_len || p5>p3 ) { |
| 640 |
> |
if (l3<l5+2 || p5>p3 ) { |
| 641 |
|
feat.end5=l5+1; |
| 642 |
|
feat.end3=l3+1; |
| 643 |
|
return; |
| 669 |
|
} |
| 670 |
|
|
| 671 |
|
|
| 672 |
< |
bool ntrim(GStr& rseq, GStr &rqv, int &l5, int &l3) { |
| 673 |
< |
//count Ns in the sequence |
| 672 |
> |
bool qtrim(GStr& qvs, int &l5, int &l3) { |
| 673 |
> |
if (qvtrim_min==0 || qvs.is_empty()) return false; |
| 674 |
> |
if (qv_phredtype==0) { |
| 675 |
> |
//try to guess the Phred type |
| 676 |
> |
int vmin=256, vmax=0; |
| 677 |
> |
for (int i=0;i<qvs.length();i++) { |
| 678 |
> |
if (vmin>qvs[i]) vmin=qvs[i]; |
| 679 |
> |
if (vmax<qvs[i]) vmax=qvs[i]; |
| 680 |
> |
} |
| 681 |
> |
if (vmin<64) { qv_phredtype=33; qv_cvtadd=31; } |
| 682 |
> |
if (vmax>95) { qv_phredtype=64; qv_cvtadd=-31; } |
| 683 |
> |
if (qv_phredtype==0) { |
| 684 |
> |
GError("Error: couldn't determine Phred type, please use the -p33 or -p64 !\n"); |
| 685 |
> |
} |
| 686 |
> |
} //guessing the Phred type |
| 687 |
> |
for (l3=qvs.length()-1;l3>2;l3--) { |
| 688 |
> |
if (qvs[l3]-qv_phredtype>=qvtrim_min && qvs[l3-1]-qv_phredtype>=qvtrim_min) break; |
| 689 |
> |
} |
| 690 |
> |
//just in case, check also the 5' the end (?) |
| 691 |
> |
for (l5=0;l5<qvs.length()-3;l5++) { |
| 692 |
> |
if (qvs[l5]-qv_phredtype>=qvtrim_min && qvs[l5+1]-qv_phredtype>=qvtrim_min) break; |
| 693 |
> |
} |
| 694 |
> |
return (l5>0 || l3<qvs.length()-1); |
| 695 |
> |
} |
| 696 |
> |
|
| 697 |
> |
bool ntrim(GStr& rseq, int &l5, int &l3) { |
| 698 |
> |
//count Ns in the sequence, trim N-rich ends |
| 699 |
|
feat.init(rseq); |
| 700 |
|
l5=feat.end5-1; |
| 701 |
|
l3=feat.end3-1; |
| 702 |
|
N_analyze(feat.end5-1, feat.end3-1, 0, feat.NCount-1); |
| 703 |
< |
if (l5==feat.end5-1 && l3==feat.end3-1) |
| 704 |
< |
return false; //nothing changed |
| 703 |
> |
if (l5==feat.end5-1 && l3==feat.end3-1) { |
| 704 |
> |
if (feat.perc_N>max_perc_N) { |
| 705 |
> |
feat.valid=false; |
| 706 |
> |
l3=l5+1; |
| 707 |
> |
return true; |
| 708 |
> |
} |
| 709 |
> |
else { |
| 710 |
> |
return false; //nothing changed |
| 711 |
> |
} |
| 712 |
> |
} |
| 713 |
|
l5=feat.end5-1; |
| 714 |
|
l3=feat.end3-1; |
| 715 |
|
if (l3-l5+1<min_read_len) { |
| 717 |
|
return true; |
| 718 |
|
} |
| 719 |
|
feat.N_calc(); |
| 720 |
< |
if (feat.perc_N>6.2) { //not valid if more than 1 N per 16 bases |
| 720 |
> |
|
| 721 |
> |
if (feat.perc_N>max_perc_N) { |
| 722 |
|
feat.valid=false; |
| 723 |
|
l3=l5+1; |
| 724 |
|
return true; |
| 844 |
|
return ncount; |
| 845 |
|
} |
| 846 |
|
|
| 847 |
< |
// ------------------ adapter matching - triplet matching |
| 848 |
< |
//look for matching triplets amongst the first 9 nucleotides of the 3' adaptor |
| 849 |
< |
// or the last 9 nucleotides for the 5' adapter |
| 850 |
< |
//when a triplet match is found, simply try to extend the alignment using a drop-off scheme |
| 851 |
< |
// check minimum score and |
| 597 |
< |
// for 3' adapter trimming: |
| 847 |
> |
|
| 848 |
> |
// ------------------ adapter matching - simple k-mer seed & extend, no indels for now |
| 849 |
> |
//when a k-mer match is found, simply try to extend the alignment using a drop-off scheme |
| 850 |
> |
//check minimum score and |
| 851 |
> |
//for 3' adapter trimming: |
| 852 |
|
// require that the right end of the alignment for either the adaptor OR the read must be |
| 853 |
|
// < 3 distance from its right end |
| 854 |
|
// for 5' adapter trimming: |
| 855 |
|
// require that the left end of the alignment for either the adaptor OR the read must |
| 856 |
< |
// be at coordinate 0 |
| 856 |
> |
// be at coordinate < 3 from start |
| 857 |
|
|
| 858 |
|
bool extendMatch(const char* a, int alen, int ai, |
| 859 |
< |
const char* b, int blen, int bi, int mlen, int& l5, int& l3, bool end5=false) { |
| 859 |
> |
const char* b, int blen, int bi, int mlen, int& l5, int& l3, CSegChain& segs, bool end5=false) { |
| 860 |
|
//so the alignment starts at ai in a, bi in b, with a perfect match of length mlen |
| 861 |
< |
//if (debug) |
| 862 |
< |
// GStr dbg(b); |
| 863 |
< |
//GMessage(">> in %s\n\textending hit: %s at position %d\n", a, (dbg.substr(ai, mlen)).chars(), ai); |
| 861 |
> |
#ifdef DEBUG |
| 862 |
> |
GStr dbg(b); |
| 863 |
> |
#endif |
| 864 |
> |
//if (debug) { |
| 865 |
> |
// GMessage(">> in %s\n\textending hit: %s at position %d\n", a, (dbg.substr(bi, mlen)).chars(), ai); |
| 866 |
> |
// } |
| 867 |
|
int a_l=ai; //alignment coordinates on a |
| 868 |
|
int a_r=ai+mlen-1; |
| 869 |
|
int b_l=bi; //alignment coordinates on b |
| 927 |
|
int mmovh3=(a_ovh3<b_ovh3)? a_ovh3 : b_ovh3; |
| 928 |
|
int mmovh5=(a_l<b_l)? a_l : b_l; |
| 929 |
|
//if (debug) GMessage(" after r-extend: %*s%s\t\t(score=%d)\n",a_l," ",dbg.substr(b_l,b_r-b_l+1).chars(),maxscore); |
| 930 |
+ |
#ifdef DEBUG |
| 931 |
+ |
if (debug) GMessage(" extended to: %*s\n",a_r+1,dbg.substr(b_l,b_r-b_l+1).chars()); |
| 932 |
+ |
#endif |
| 933 |
|
if (maxscore>=a_min_score && mmovh3<2 && mmovh5<2) { |
| 934 |
|
if (a_l<a_ovh3) { |
| 935 |
|
//adapter closer to the left end (typical for 5' adapter) |
| 943 |
|
} |
| 944 |
|
return true; |
| 945 |
|
} |
| 946 |
+ |
else { //keep this segment pair for later (gapped alignment) |
| 947 |
+ |
segs.addSegPair(new CSegPair(a_l+1, a_r+1, b_l+1, b_r+1, maxscore)); |
| 948 |
+ |
//this will also update min & max coordinates in segs (segs.astart, .aend, .bstart, .bend) |
| 949 |
+ |
} |
| 950 |
|
//do not trim: |
| 951 |
|
l5=0; |
| 952 |
|
l3=alen-1; |
| 953 |
|
return false; |
| 954 |
|
} |
| 955 |
|
|
| 956 |
+ |
/* |
| 957 |
+ |
int getWordValue(const char* s, int wlen) { |
| 958 |
+ |
int r=0; |
| 959 |
+ |
while (wlen--) { r+=(((int)s[wlen])<<wlen) } |
| 960 |
+ |
return r; |
| 961 |
+ |
} |
| 962 |
+ |
*/ |
| 963 |
+ |
int get3mer_value(const char* s) { |
| 964 |
+ |
return (s[0]<<16)+(s[1]<<8)+s[2]; |
| 965 |
+ |
} |
| 966 |
+ |
|
| 967 |
+ |
int w3_match(int qv, const char* str, int slen, int start_index=0) { |
| 968 |
+ |
if (start_index>=slen || start_index<0) return -1; |
| 969 |
+ |
for (int i=start_index;i<slen-3;i++) { |
| 970 |
+ |
int rv=get3mer_value(str+i); |
| 971 |
+ |
if (rv==qv) return i; |
| 972 |
+ |
} |
| 973 |
+ |
return -1; |
| 974 |
+ |
} |
| 975 |
+ |
|
| 976 |
+ |
int w3_rmatch(int qv, const char* str, int slen, int end_index=-1) { |
| 977 |
+ |
if (end_index>=slen) return -1; |
| 978 |
+ |
if (end_index<0) end_index=slen-1; |
| 979 |
+ |
for (int i=end_index-2;i>=0;i--) { |
| 980 |
+ |
int rv=get3mer_value(str+i); |
| 981 |
+ |
if (rv==qv) return i; |
| 982 |
+ |
} |
| 983 |
+ |
return -1; |
| 984 |
+ |
} |
| 985 |
+ |
|
| 986 |
+ |
int fast4match(int32 qv, const char* str, int slen, int start_index=0) { |
| 987 |
+ |
if (start_index>=slen || start_index<0) return -1; |
| 988 |
+ |
for (int i=start_index;i<slen-4;i++) { |
| 989 |
+ |
int32* rv=(int32*)(str+i); |
| 990 |
+ |
if (*rv==qv) return i; |
| 991 |
+ |
} |
| 992 |
+ |
return -1; |
| 993 |
+ |
} |
| 994 |
+ |
|
| 995 |
+ |
int fast4rmatch(int32 qv, const char* str, int slen, int end_index=-1) { |
| 996 |
+ |
if (end_index>=slen) return -1; |
| 997 |
+ |
if (end_index<0) end_index=slen-1; |
| 998 |
+ |
for (int i=end_index-3;i>=0;i--) { |
| 999 |
+ |
int32* rv=(int32*)(str+i); |
| 1000 |
+ |
if (*rv==qv) return i; |
| 1001 |
+ |
} |
| 1002 |
+ |
return -1; |
| 1003 |
+ |
} |
| 1004 |
+ |
|
| 1005 |
+ |
#ifdef DEBUG |
| 1006 |
+ |
void dbgPrintChain(CSegChain& chain, const char* aseq) { |
| 1007 |
+ |
GStr s(aseq); |
| 1008 |
+ |
for (int i=0;i<chain.Count();i++) { |
| 1009 |
+ |
CSegPair& seg=*chain[i]; |
| 1010 |
+ |
GMessage(" dbg chain seg%d: %*s [%d-%d:%d-%d]\n",i,seg.a.start-1+seg.len(), |
| 1011 |
+ |
s.substr(seg.b.start-1, seg.len()).chars(), seg.b.start,seg.b.end,seg.a.start,seg.a.end); |
| 1012 |
+ |
} |
| 1013 |
+ |
} |
| 1014 |
+ |
#endif |
| 1015 |
+ |
|
| 1016 |
|
bool trim_adapter3(GStr& seq, int&l5, int &l3) { |
| 1017 |
|
int rlen=seq.length(); |
| 1018 |
|
l5=0; |
| 1026 |
|
} |
| 1027 |
|
else { |
| 1028 |
|
l5=0; |
| 1029 |
< |
l3=fi-1; |
| 1029 |
> |
l3=fi-1; |
| 1030 |
|
} |
| 1031 |
|
return true; |
| 1032 |
|
} |
| 1033 |
+ |
#ifdef DEBUG |
| 1034 |
+ |
if (debug) GMessage(">TRIM3 >> Read: %s\n",seq.chars()); |
| 1035 |
+ |
#endif |
| 1036 |
+ |
|
| 1037 |
|
//also, for fast detection of other adapter-only reads that start past |
| 1038 |
|
// the beginning of the adapter sequence, try to see if the first a3len-4 |
| 1039 |
< |
// characters of the read are a substring of the adapter |
| 1040 |
< |
GStr rstart=seq.substr(0,a3len-4); |
| 1041 |
< |
if ((fi=adapter3.index(rstart))>=0) { |
| 1042 |
< |
l3=rlen-1; |
| 1043 |
< |
l5=a3len-4; |
| 1044 |
< |
while (fi+l5<a3len && l5<l3 && adapter3[fi+l5]==seq[l5]) l5++; |
| 1045 |
< |
return true; |
| 1039 |
> |
// bases of the read are a substring of the adapter |
| 1040 |
> |
if (rlen>a3len-3) { |
| 1041 |
> |
GStr rstart=seq.substr(1,a3len-4); |
| 1042 |
> |
if ((fi=adapter3.index(rstart))>=0) { |
| 1043 |
> |
l3=rlen-1; |
| 1044 |
> |
l5=a3len-4; |
| 1045 |
> |
while (fi+l5<a3len && l5<l3 && adapter3[fi+l5]==seq[l5]) l5++; |
| 1046 |
> |
return true; |
| 1047 |
> |
} |
| 1048 |
> |
} |
| 1049 |
> |
CSegChain a3segs; //no chains here, just an ordered collection of segment pairs |
| 1050 |
> |
//check the easy cases - 11 bases exact match at the end |
| 1051 |
> |
int fdlen=11; |
| 1052 |
> |
if (a3len<16) { |
| 1053 |
> |
fdlen=a3len>>1; |
| 1054 |
|
} |
| 1055 |
< |
|
| 1056 |
< |
//another easy case: first half of the adaptor matches |
| 1057 |
< |
int a3hlen=a3len>>1; |
| 1058 |
< |
GStr ahalf=adapter3.substr(0, a3hlen); |
| 1059 |
< |
if ((fi=seq.index(ahalf))>=0) { |
| 1060 |
< |
extendMatch(seq.chars(), rlen, fi, |
| 1061 |
< |
adapter3.chars(), a3len, 0, a3hlen, l5,l3); |
| 1062 |
< |
return true; |
| 1055 |
> |
if (fdlen>4) { |
| 1056 |
> |
//check if we're lucky enough to have the last 11 bases of the read a part of the adapter |
| 1057 |
> |
GStr rstart=seq.substr(-fdlen-3,fdlen); |
| 1058 |
> |
if ((fi=adapter3.index(rstart))>=0) { |
| 1059 |
> |
#ifdef DEBUG |
| 1060 |
> |
if (debug) GMessage(" W11match found: %*s\n", rlen-3, (adapter3.substr(fi,fdlen)).chars()); |
| 1061 |
> |
#endif |
| 1062 |
> |
if (extendMatch(seq.chars(), rlen, rlen-fdlen-3, |
| 1063 |
> |
adapter3.chars(), a3len, fi, fdlen, l5,l3, a3segs)) |
| 1064 |
> |
return true; |
| 1065 |
> |
} |
| 1066 |
> |
//another easy case: first 11 characters of the adaptor found as a substring of the read |
| 1067 |
> |
GStr bstr=adapter3.substr(0, fdlen); |
| 1068 |
> |
if ((fi=seq.rindex(bstr))>=0) { |
| 1069 |
> |
#ifdef DEBUG |
| 1070 |
> |
if (debug) GMessage(" A11match found: %*s\n", fi+fdlen, bstr.chars()); |
| 1071 |
> |
#endif |
| 1072 |
> |
if (extendMatch(seq.chars(), rlen, fi, |
| 1073 |
> |
adapter3.chars(), a3len, 0, fdlen, l5,l3, a3segs)) |
| 1074 |
> |
return true; |
| 1075 |
> |
} |
| 1076 |
> |
} //tried to match 11 bases first |
| 1077 |
> |
|
| 1078 |
> |
//no easy cases, so let's do the wmer hashing for the first 12 bases of the adaptor |
| 1079 |
> |
//-- only extend if the match is in the 3' (ending) region of the read |
| 1080 |
> |
int wordSize=3; |
| 1081 |
> |
int hlen=12; |
| 1082 |
> |
if (hlen>a3len-wordSize) hlen=a3len-wordSize; |
| 1083 |
> |
int imin=rlen>>1; //last half of the read, left boundary for the wmer match |
| 1084 |
> |
if (imin<a3len) { imin=GMIN(a3len, rlen-wordSize); } |
| 1085 |
> |
imin=rlen-imin; |
| 1086 |
> |
for (int iw=0;iw<hlen;iw++) { |
| 1087 |
> |
//int32* qv=(int32*)(adapter3.chars()+iw); |
| 1088 |
> |
int qv=get3mer_value(adapter3.chars()+iw); |
| 1089 |
> |
fi=-1; |
| 1090 |
> |
//while ((fi=fast4rmatch(*qv, seq.chars(), rlen, fi))>=0 && fi>=imin) { |
| 1091 |
> |
while ((fi=w3_rmatch(qv, seq.chars(), rlen, fi))>=0 && fi>=imin) { |
| 1092 |
> |
//GMessage(" ... fi=%d after w3_rmatch() (imin=%d)\n", fi, imin); |
| 1093 |
> |
|
| 1094 |
> |
#ifdef DEBUG |
| 1095 |
> |
if (debug) GMessage(" Wmatch found: %*s\n", fi+wordSize, (adapter3.substr(iw,wordSize)).chars()); |
| 1096 |
> |
#endif |
| 1097 |
> |
if (extendMatch(seq.chars(), rlen, fi, adapter3.chars(), |
| 1098 |
> |
a3len, iw, wordSize, l5,l3, a3segs)) return true; |
| 1099 |
> |
fi--; |
| 1100 |
> |
if (fi<imin) break; |
| 1101 |
> |
} |
| 1102 |
> |
} //for each wmer in the first hlen bases of the adaptor |
| 1103 |
> |
/* |
| 1104 |
> |
//couldn't find a good trimming extension, hash 12 more bases of the adapter to collect more segment pairs there |
| 1105 |
> |
//but only do this if we already have segment pairs collected in the last 12 bases of the adapter |
| 1106 |
> |
if (a3segs.bstart>3 || a3segs.bend<(uint)(hlen-wordSize)) return false; |
| 1107 |
> |
int hlen2=a3len-wordSize; |
| 1108 |
> |
//if (hlen2>a3len-4) hlen2=a3len-4; |
| 1109 |
> |
if (hlen2>hlen) { |
| 1110 |
> |
#ifdef DEBUG |
| 1111 |
> |
if (debug && a3segs.Count()>0) { |
| 1112 |
> |
GMessage(" >>>>>2nd. hash: %s\n",seq.chars()); |
| 1113 |
> |
} |
| 1114 |
> |
#endif |
| 1115 |
> |
for (int iw=hlen;iw<hlen2;iw++) { |
| 1116 |
> |
//int* qv=(int32 *)(adapter3.chars()+iw); |
| 1117 |
> |
int qv=get3mer_value(adapter3.chars()+iw); |
| 1118 |
> |
fi=-1; |
| 1119 |
> |
//while ((fi=fast4rmatch(*qv, seq.chars(), rlen, fi))>=0 && fi>=imin) { |
| 1120 |
> |
while ((fi=w3_rmatch(qv, seq.chars(), rlen, fi))>=0 && fi>=imin) { |
| 1121 |
> |
extendMatch(seq.chars(), rlen, fi, adapter3.chars(), |
| 1122 |
> |
a3len, iw, wordSize, l5,l3, a3segs); |
| 1123 |
> |
fi--; |
| 1124 |
> |
if (fi<imin) break; |
| 1125 |
> |
} |
| 1126 |
> |
} //for each wmer between hlen2 and hlen bases of the adaptor |
| 1127 |
> |
} |
| 1128 |
> |
//lastly, analyze collected a3segs for a possible gapped alignment: |
| 1129 |
> |
GList<CSegChain> segchains(false,true,false); |
| 1130 |
> |
#ifdef DEBUG |
| 1131 |
> |
if (debug && a3segs.Count()>0) { |
| 1132 |
> |
GMessage(">>>>>>>>> Read: %s\n",seq.chars()); |
| 1133 |
|
} |
| 1134 |
< |
//no easy cases, so let's do the word hashing |
| 1135 |
< |
for (int iw=0;iw<6;iw++) { |
| 1136 |
< |
GStr aword=adapter3.substr(iw,3); |
| 1137 |
< |
if ((fi=seq.index(aword))>=0 && rlen-fi>3) { |
| 1138 |
< |
if (extendMatch(seq.chars(), rlen, fi, adapter3.chars(), |
| 1139 |
< |
a3len, iw, 3, l5,l3)) return true; |
| 1134 |
> |
#endif |
| 1135 |
> |
for (int i=0;i<a3segs.Count();i++) { |
| 1136 |
> |
if (a3segs[i]->chain==NULL) { |
| 1137 |
> |
if (a3segs[i]->b.start>3) continue; //don't start a hopeless chain |
| 1138 |
> |
CSegChain* newchain=new CSegChain(); |
| 1139 |
> |
newchain->setFreeItem(false); |
| 1140 |
> |
newchain->addSegPair(a3segs[i]); |
| 1141 |
> |
a3segs[i]->chain=newchain; |
| 1142 |
> |
segchains.Add(newchain); //just to free them when done |
| 1143 |
> |
} |
| 1144 |
> |
for (int j=i+1;j<a3segs.Count();j++) { |
| 1145 |
> |
CSegChain* chain=a3segs[i]->chain; |
| 1146 |
> |
if (chain->extendChain(a3segs[j])) { |
| 1147 |
> |
a3segs[j]->chain=chain; |
| 1148 |
> |
#ifdef DEBUG |
| 1149 |
> |
if (debug) dbgPrintChain(*chain, adapter3.chars()); |
| 1150 |
> |
#endif |
| 1151 |
> |
//save time by checking here if the extended chain is already acceptable for trimming |
| 1152 |
> |
if (chain->aend>(uint)(rlen-4) && chain->bstart<4 && chain->score>a_min_chain_score) { |
| 1153 |
> |
l5=0; |
| 1154 |
> |
l3=chain->astart-2; |
| 1155 |
> |
#ifdef DEBUG |
| 1156 |
> |
if (debug && a3segs.Count()>0) { |
| 1157 |
> |
GMessage(">>> >> trimmed-3: %*s\n",l3-l5+1,seq.substr(l5,l3-l5+1).chars()); |
| 1158 |
> |
} |
| 1159 |
> |
#endif |
| 1160 |
> |
return true; |
| 1161 |
> |
} |
| 1162 |
> |
} //chain can be extended |
| 1163 |
|
} |
| 1164 |
< |
} |
| 1164 |
> |
} //collect segment alignments into chains |
| 1165 |
> |
*/ |
| 1166 |
|
return false; //no adapter parts found |
| 1167 |
|
} |
| 1168 |
|
|
| 1184 |
|
} |
| 1185 |
|
return true; |
| 1186 |
|
} |
| 1187 |
< |
//for fast detection of adapter-rich reads, check if the first 12 |
| 1188 |
< |
//characters of the read are a substring of the adapter |
| 1189 |
< |
GStr rstart=seq.substr(1,12); |
| 1190 |
< |
if ((fi=adapter5.index(rstart))>=0) { |
| 1191 |
< |
//l3=rlen-1; |
| 1192 |
< |
//l5=a5len-4; |
| 1193 |
< |
//while (fi+l5<a5len && l5<l3 && adapter5[fi+l5]==seq[l5]) l5++; |
| 1194 |
< |
//return true; |
| 1195 |
< |
//if (debug) GMessage(" first 12char of the read match adaptor!\n"); |
| 1196 |
< |
extendMatch(seq.chars(), rlen, 1, |
| 767 |
< |
adapter5.chars(), a5len, fi, 12, l5,l3, true); |
| 768 |
< |
return true; |
| 1187 |
> |
#ifdef DEBUG |
| 1188 |
> |
if (debug) GMessage(">TRIM5 >> Read: %s\n",seq.chars()); |
| 1189 |
> |
#endif |
| 1190 |
> |
|
| 1191 |
> |
CSegChain a5segs(true); //list of segment pairs to analyze later if no extendMatch succeeded |
| 1192 |
> |
|
| 1193 |
> |
//try the easy way out first - look for an exact match of 11 bases |
| 1194 |
> |
int fdlen=11; |
| 1195 |
> |
if (a5len<16) { |
| 1196 |
> |
fdlen=a5len>>1; |
| 1197 |
|
} |
| 1198 |
< |
|
| 1199 |
< |
//another easy case: last 12 characters of the adaptor found as a substring of the read |
| 1200 |
< |
int aplen=12; |
| 1201 |
< |
int apstart=a5len-aplen-2; |
| 1202 |
< |
if (apstart<0) { apstart=0; aplen=a5len-1; } |
| 1203 |
< |
GStr bstr=adapter5.substr(apstart, aplen); |
| 1204 |
< |
if ((fi=seq.index(bstr))>=0) { |
| 1205 |
< |
//if (debug) GMessage(" last 12char of adaptor match the read!\n"); |
| 1206 |
< |
extendMatch(seq.chars(), rlen, fi, |
| 1207 |
< |
adapter5.chars(), a5len, apstart, aplen, l5,l3,true); |
| 1208 |
< |
return true; |
| 1198 |
> |
if (fdlen>4) { |
| 1199 |
> |
GStr rstart=seq.substr(1,fdlen); //skip the first base as it's sometimes bogus |
| 1200 |
> |
if ((fi=adapter5.index(rstart))>=0) { |
| 1201 |
> |
#ifdef DEBUG |
| 1202 |
> |
if (debug) GMessage(" W11match found: %*s\n", 1+fdlen, (adapter3.substr(fi,fdlen)).chars()); |
| 1203 |
> |
#endif |
| 1204 |
> |
if (extendMatch(seq.chars(), rlen, 1, |
| 1205 |
> |
adapter5.chars(), a5len, fi, fdlen, l5,l3, a5segs, true)) |
| 1206 |
> |
return true; |
| 1207 |
> |
} |
| 1208 |
> |
//another easy case: last 11 characters of the adaptor found as a substring of the read |
| 1209 |
> |
GStr bstr=adapter5.substr(-fdlen); |
| 1210 |
> |
if ((fi=seq.index(bstr))>=0) { |
| 1211 |
> |
#ifdef DEBUG |
| 1212 |
> |
if (debug) GMessage(" A11match found: %*s\n", fi+fdlen, bstr.chars()); |
| 1213 |
> |
#endif |
| 1214 |
> |
if (extendMatch(seq.chars(), rlen, fi, |
| 1215 |
> |
adapter5.chars(), a5len, a5len-fdlen, fdlen, l5,l3,a5segs,true)) |
| 1216 |
> |
return true; |
| 1217 |
> |
} |
| 1218 |
> |
} //tried to matching at most 11 bases first |
| 1219 |
> |
|
| 1220 |
> |
//-- no easy cases, do the wmer hashing for the last 12 bases of the adaptor |
| 1221 |
> |
//-- only extend a wmer if it matches in the 5' (beginning) region of the read |
| 1222 |
> |
int wordSize=3; |
| 1223 |
> |
int hlen=12; |
| 1224 |
> |
if (hlen>a5len-wordSize) hlen=a5len-wordSize; |
| 1225 |
> |
int imax=rlen>>1; //first half of the read, right boundary for the wmer match |
| 1226 |
> |
if (imax<a5len) { imax=GMIN(a5len, rlen-wordSize); } |
| 1227 |
> |
for (int iw=0;iw<=hlen;iw++) { |
| 1228 |
> |
int apstart=a5len-iw-wordSize; |
| 1229 |
> |
fi=0; |
| 1230 |
> |
//int* qv=(int32 *)(adapter5.chars()+apstart); |
| 1231 |
> |
int qv=get3mer_value(adapter5.chars()+apstart); |
| 1232 |
> |
//while ((fi=fast4match(*qv, seq.chars(), rlen, fi))>=0 && fi<=imax) { |
| 1233 |
> |
while ((fi=w3_match(qv, seq.chars(), rlen, fi))>=0 && fi<=imax) { |
| 1234 |
> |
#ifdef DEBUG |
| 1235 |
> |
if (debug) GMessage(" Wmatch found: %*s\n", fi+wordSize, (adapter5.substr(apstart,wordSize)).chars()); |
| 1236 |
> |
#endif |
| 1237 |
> |
if (extendMatch(seq.chars(), rlen, fi, adapter5.chars(), |
| 1238 |
> |
a5len, apstart, wordSize, l5,l3, a5segs, true)) return true; |
| 1239 |
> |
fi++; |
| 1240 |
> |
if (fi>imax) break; |
| 1241 |
> |
} |
| 1242 |
> |
} //for each wmer in the last hlen bases of the adaptor |
| 1243 |
> |
/* |
| 1244 |
> |
|
| 1245 |
> |
//couldn't find a good trimming extension, hash 12 more bases of the adapter to collect more segment pairs there |
| 1246 |
> |
//but only do this if we already have segment pairs collected in the last 12 bases of the adapter |
| 1247 |
> |
if (a5segs.bend<(uint)(a5len-3) || a5segs.bstart>(uint)(a5len-hlen+4)) return false; |
| 1248 |
> |
int hlen2=a5len-wordSize; |
| 1249 |
> |
//if (hlen2>a5len-wordSize) hlen2=a5len-wordSize; |
| 1250 |
> |
#ifdef DEBUG |
| 1251 |
> |
if (debug && a5segs.Count()>0) { |
| 1252 |
> |
GMessage(" >>>>>2nd. hash: %s\n",seq.chars()); |
| 1253 |
> |
} |
| 1254 |
> |
#endif |
| 1255 |
> |
if (hlen2>hlen) { |
| 1256 |
> |
for (int iw=hlen+1;iw<=hlen2;iw++) { |
| 1257 |
> |
int apstart=a5len-iw-wordSize; |
| 1258 |
> |
fi=0; |
| 1259 |
> |
//int* qv=(int32 *)(adapter5.chars()+apstart); |
| 1260 |
> |
int qv=get3mer_value(adapter5.chars()+apstart); |
| 1261 |
> |
//while ((fi=fast4match(*qv, seq.chars(), rlen, fi))>=0 && fi<=imax) { |
| 1262 |
> |
while ((fi=w3_match(qv, seq.chars(), rlen, fi))>=0 && fi<=imax) { |
| 1263 |
> |
extendMatch(seq.chars(), rlen, fi, adapter5.chars(), |
| 1264 |
> |
a5len, apstart, wordSize, l5,l3, a5segs, true); |
| 1265 |
> |
fi++; |
| 1266 |
> |
if (fi>imax) break; |
| 1267 |
> |
} |
| 1268 |
> |
} //for each wmer between hlen2 and hlen bases of the adaptor |
| 1269 |
> |
} |
| 1270 |
> |
if (a5segs.bend<(uint)(a5len-3) || a5segs.bstart>(uint)(a5len-hlen+4)) return false; |
| 1271 |
> |
// lastly, analyze collected a5segs for a possible gapped alignment: |
| 1272 |
> |
GList<CSegChain> segchains(false,true,false); |
| 1273 |
> |
#ifdef DEBUG |
| 1274 |
> |
if (debug && a5segs.Count()>0) { |
| 1275 |
> |
GMessage(">>>>>>>>> Read: %s\n",seq.chars()); |
| 1276 |
|
} |
| 1277 |
< |
//no easy cases, find a triplet match as a seed for alignment extension |
| 1278 |
< |
//find triplets at the right end of the adapter |
| 1279 |
< |
for (int iw=0;iw<6;iw++) { |
| 1280 |
< |
apstart=a5len-iw-4; |
| 1281 |
< |
GStr aword=adapter5.substr(apstart,3); |
| 1282 |
< |
if ((fi=seq.index(aword))>=0) { |
| 1283 |
< |
//if (debug) GMessage("extending wmatch :%*s\n", fi+3, aword.chars()); |
| 1284 |
< |
if (extendMatch(seq.chars(), rlen, fi, adapter5.chars(), |
| 1285 |
< |
a5len, apstart, 3, l5,l3,true)) { |
| 1286 |
< |
return true; |
| 1287 |
< |
} |
| 1277 |
> |
#endif |
| 1278 |
> |
for (int i=0;i<a5segs.Count();i++) { |
| 1279 |
> |
if (a5segs[i]->chain==NULL) { |
| 1280 |
> |
if (a5segs[i]->b.end<(int)(a5len-4)) continue; //don't start a hopeless chain |
| 1281 |
> |
CSegChain* newchain=new CSegChain(true); |
| 1282 |
> |
newchain->setFreeItem(false); |
| 1283 |
> |
newchain->addSegPair(a5segs[i]); |
| 1284 |
> |
a5segs[i]->chain=newchain; |
| 1285 |
> |
segchains.Add(newchain); //just to free them when done |
| 1286 |
> |
} |
| 1287 |
> |
for (int j=i+1;j<a5segs.Count();j++) { |
| 1288 |
> |
CSegChain* chain=a5segs[i]->chain; |
| 1289 |
> |
if (chain->extendChain(a5segs[j])) { |
| 1290 |
> |
a5segs[j]->chain=chain; |
| 1291 |
> |
#ifdef DEBUG |
| 1292 |
> |
if (debug) dbgPrintChain(*chain, adapter5.chars()); |
| 1293 |
> |
#endif |
| 1294 |
> |
//save time by checking here if the extended chain is already acceptable for trimming |
| 1295 |
> |
if (chain->bend>(uint)(a5len-3) && chain->astart<4 && chain->score>a_min_chain_score) { |
| 1296 |
> |
l5=chain->aend; |
| 1297 |
> |
l3=rlen-1; |
| 1298 |
> |
return true; |
| 1299 |
> |
} |
| 1300 |
> |
} //chain can be extended |
| 1301 |
|
} |
| 1302 |
< |
} |
| 1302 |
> |
} //collect segment alignments into chains |
| 1303 |
> |
*/ |
| 1304 |
|
return false; //no adapter parts found |
| 1305 |
|
} |
| 1306 |
|
|
| 1307 |
< |
//conversion of phred64 to phread33 |
| 1308 |
< |
void convertQ64(GStr& q) { |
| 1309 |
< |
for (int i=0;i<q.length();i++) q[i]-=31; |
| 1307 |
> |
//convert qvs to/from phred64 from/to phread33 |
| 1308 |
> |
void convertPhred(GStr& q) { |
| 1309 |
> |
for (int i=0;i<q.length();i++) q[i]+=qv_cvtadd; |
| 1310 |
|
} |
| 1311 |
|
|
| 1312 |
< |
void convertQ64(char* q, int len) { |
| 1313 |
< |
for (int i=0;i<len;i++) q[i]-=31; |
| 1312 |
> |
void convertPhred(char* q, int len) { |
| 1313 |
> |
for (int i=0;i<len;i++) q[i]+=qv_cvtadd; |
| 1314 |
|
} |
| 1315 |
|
|
