<<<<< Input Tree (Top_node = 29) >>>>>

( seq0020{28}:0.1529, ( seq0018{26}:0.1741, ( ( seq0015{23}:0.1492, ( seq0013{20}:0.1827, seq0014{21}:0.1659 ){22}:0.0049 ){24}:0.0297, ( ( seq0008{16}:0.0865, seq0009{17}:0.1286 ){18}:0.0335, ( ( seq0005{10}:0.0368, ( seq0006{11}:0.0286, seq0007{12}:0.0362 ){13}:0.0065 ){14}:0.0368, ( ( seq0000{1}:0.0054, seq0001{2}:0.0081 ){3}:0.0232, ( seq0002{4}:0.0189, ( seq0003{5}:0.0124, seq0004{6}:0.0108 ){7}:0.0070 ){8}:0.0270 ){9}:0.0205 ){15}:0.0703 ){19}:0.0383 ){25}:0.0314 ){27}:0.0130 ){29};


<<<<< Input MSA >>>>>

#{Sequences} = 15 .
#{Sites in the segment}_ref = 32 ,
#{Sites in the segment}_rec = 29 .


<< Correspondence between sequence IDs and sequence indices >>

Indx:	Seq_ID

0:	seq0000
1:	seq0001
2:	seq0002
3:	seq0003
4:	seq0004
5:	seq0005
6:	seq0006
7:	seq0007
8:	seq0008
9:	seq0009
10:	seq0013
11:	seq0014
12:	seq0015
13:	seq0018
14:	seq0020


<< Original Segment of the Reference Alignment: >>

(position)     00000000001111111111222222222233
               01234567890123456789012345678901
                                               
seq0000        TTCGGAC---GGGGTCTACAA----CTTGAGC
seq0001        TTCGGAC---AGGGTCTACAA----CTTGAGC
seq0002        TTCGGAC---GGGGGGTAAAG----CTTGAGC
seq0003        TTCGGAC---GGTGTGTAAAG----CTTGAGC
seq0004        TTCGGAC---GGTGTGTAAAG----CTTGAGC
seq0005        TTCGGAC---GGGGTGTACAG----CTTCA--
seq0006        TTCGGAC---GTGGTGTACAG----CTTGA--
seq0007        TTCGGAC---GTGGTGTACAG----CTTGA--
seq0008        GTCGAAC---GAGGTCTACAC-----TCCA-C
seq0009        ATCGGAC---GGGGTCTACAC----ATTCAGC
seq0013        TACGGTC---GGGGTCGCGAC----CGCGGGG
seq0014        TAGGTGCCTTGTGGTCTA-AC----CTCGAGG
seq0015        TACGGAC---GGGGTCTACACTAACCCCGAGG
seq0018        --CGGT----GTAGGCAACAC----CTCAAGA
seq0020        TTCGGTC---GTGGTATACAC----CTCAAGA


<< Original Segment of the Reconstructed Alignment: >>

(position)     00000000001111111111222222222
               01234567890123456789012345678
                                            
seq0000        TTCGGACGGGGTCT----ACAACTTGAGC
seq0001        TTCGGACAGGGTCT----ACAACTTGAGC
seq0002        TTCGGACGGGGGGT----AAAGCTTGAGC
seq0003        TTCGGACGGTGTGT----AAAGCTTGAGC
seq0004        TTCGGACGGTGTGT----AAAGCTTGAGC
seq0005        TTCGGACGGGGTGT----ACAGCTTCA--
seq0006        TTCGGACGTGGTGT----ACAGCTTGA--
seq0007        TTCGGACGTGGTGT----ACAGCTTGA--
seq0008        GTCGAACGAGGTCT----ACAC--TCCAC
seq0009        ATCGGACGGGGTCT----ACACATTCAGC
seq0013        TACGGTCGGGGTCG----CGACCGCGGGG
seq0014        TAGGTGCCTTGTGG--TCTAACCTCGAGG
seq0015        TACGGACGGGGTCTACACTAACCCCGAGG
seq0018        ---CGGTGTAGGCA----ACACCTCAAGA
seq0020        TTCGGTCGTGGTAT----ACACCTCAAGA


<<<<< Preliminary (0): Map the residue numbers onto the reference & reconstructed MSAs... >>>>>

<<<<< Preliminary (1): Map the position shifts (from reference to reconstructed) onto the Reconstructed MSA... >>>>>

<< Output of 'map_shifts_respos_bw_2msas' >>

($shift_lf, $shift_rf) = (0, -3) .

[ Shifts in the Reconstructed MSA ]

(position)	    0    1    2    3    4    5    6    7    8    9   10   11   12   13   14   15   16   17   18   19   20   21   22   23   24   25   26   27   28

seq0000   	    0    0    0    0    0    0    0   -3   -3   -3   -3   -3   -3   -3    -    -    -    -    1    1    1    1   -3   -3   -3   -3   -3   -3   -3
seq0001   	    0    0    0    0    0    0    0   -3   -3   -3   -3   -3   -3   -3    -    -    -    -    1    1    1    1   -3   -3   -3   -3   -3   -3   -3
seq0002   	    0    0    0    0    0    0    0   -3   -3   -3   -3   -3   -3   -3    -    -    -    -    1    1    1    1   -3   -3   -3   -3   -3   -3   -3
seq0003   	    0    0    0    0    0    0    0   -3   -3   -3   -3   -3   -3   -3    -    -    -    -    1    1    1    1   -3   -3   -3   -3   -3   -3   -3
seq0004   	    0    0    0    0    0    0    0   -3   -3   -3   -3   -3   -3   -3    -    -    -    -    1    1    1    1   -3   -3   -3   -3   -3   -3   -3
seq0005   	    0    0    0    0    0    0    0   -3   -3   -3   -3   -3   -3   -3    -    -    -    -    1    1    1    1   -3   -3   -3   -3   -3    -    -
seq0006   	    0    0    0    0    0    0    0   -3   -3   -3   -3   -3   -3   -3    -    -    -    -    1    1    1    1   -3   -3   -3   -3   -3    -    -
seq0007   	    0    0    0    0    0    0    0   -3   -3   -3   -3   -3   -3   -3    -    -    -    -    1    1    1    1   -3   -3   -3   -3   -3    -    -
seq0008   	    0    0    0    0    0    0    0   -3   -3   -3   -3   -3   -3   -3    -    -    -    -    1    1    1    1    -    -   -2   -2   -2   -2   -3
seq0009   	    0    0    0    0    0    0    0   -3   -3   -3   -3   -3   -3   -3    -    -    -    -    1    1    1    1   -3   -3   -3   -3   -3   -3   -3
seq0013   	    0    0    0    0    0    0    0   -3   -3   -3   -3   -3   -3   -3    -    -    -    -    1    1    1    1   -3   -3   -3   -3   -3   -3   -3
seq0014   	    0    0    0    0    0    0    0    0    0    0    0    0    0    0    -    -    2    2    2    2    1    1   -3   -3   -3   -3   -3   -3   -3
seq0015   	    0    0    0    0    0    0    0   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3
seq0018   	    -    -    -    1    1    1    1   -3   -3   -3   -3   -3   -3   -3    -    -    -    -    1    1    1    1   -3   -3   -3   -3   -3   -3   -3
seq0020   	    0    0    0    0    0    0    0   -3   -3   -3   -3   -3   -3   -3    -    -    -    -    1    1    1    1   -3   -3   -3   -3   -3   -3   -3




[INFORMATION] The original $commoner_shift_flank = -3. Thus, we will shift the entire reconstructed MSA ...

<< REVISED Output of 'map_shifts_respos_bw_2msas' >>

New ($shift_lf, $shift_rf) = (0, 0) .

[ New Shifts in the Reconstructed MSA ]

(position)	    0    1    2    3    4    5    6    7    8    9   10   11   12   13   14   15   16   17   18   19   20   21   22   23   24   25   26   27   28   29   30   31

seq0000   	    -    -    -    3    3    3    3    3    3    3    0    0    0    0    0    0    0    -    -    -    -    4    4    4    4    0    0    0    0    0    0    0
seq0001   	    -    -    -    3    3    3    3    3    3    3    0    0    0    0    0    0    0    -    -    -    -    4    4    4    4    0    0    0    0    0    0    0
seq0002   	    -    -    -    3    3    3    3    3    3    3    0    0    0    0    0    0    0    -    -    -    -    4    4    4    4    0    0    0    0    0    0    0
seq0003   	    -    -    -    3    3    3    3    3    3    3    0    0    0    0    0    0    0    -    -    -    -    4    4    4    4    0    0    0    0    0    0    0
seq0004   	    -    -    -    3    3    3    3    3    3    3    0    0    0    0    0    0    0    -    -    -    -    4    4    4    4    0    0    0    0    0    0    0
seq0005   	    -    -    -    3    3    3    3    3    3    3    0    0    0    0    0    0    0    -    -    -    -    4    4    4    4    0    0    0    0    0    -    -
seq0006   	    -    -    -    3    3    3    3    3    3    3    0    0    0    0    0    0    0    -    -    -    -    4    4    4    4    0    0    0    0    0    -    -
seq0007   	    -    -    -    3    3    3    3    3    3    3    0    0    0    0    0    0    0    -    -    -    -    4    4    4    4    0    0    0    0    0    -    -
seq0008   	    -    -    -    3    3    3    3    3    3    3    0    0    0    0    0    0    0    -    -    -    -    4    4    4    4    -    -    1    1    1    1    0
seq0009   	    -    -    -    3    3    3    3    3    3    3    0    0    0    0    0    0    0    -    -    -    -    4    4    4    4    0    0    0    0    0    0    0
seq0013   	    -    -    -    3    3    3    3    3    3    3    0    0    0    0    0    0    0    -    -    -    -    4    4    4    4    0    0    0    0    0    0    0
seq0014   	    -    -    -    3    3    3    3    3    3    3    3    3    3    3    3    3    3    -    -    5    5    5    5    4    4    0    0    0    0    0    0    0
seq0015   	    -    -    -    3    3    3    3    3    3    3    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0
seq0018   	    -    -    -    -    -    -    4    4    4    4    0    0    0    0    0    0    0    -    -    -    -    4    4    4    4    0    0    0    0    0    0    0
seq0020   	    -    -    -    3    3    3    3    3    3    3    0    0    0    0    0    0    0    -    -    -    -    4    4    4    4    0    0    0    0    0    0    0



<<<<< Preliminary (2): Put together the mapped position shifts into some Classes ... >>>>>

<< Output of 'br_list_classes_shift_respos' >>

$commoner_shift_flank = 0 .


<<<<< Preliminary (3'): For each MINI-class of shifts, parsimoniously infer the branch(es) separating the affected sequences from the rest. >>>>>

<<<<< ADDITIONAL Preliminary Process (3.5'): Split mini-classes each of which consists of unnaturally remote sequences... >>>>>

... NO CHANGES were made ...


<<<<< Preliminary (4): Merge the MINI-classes of shifts. >>>>>

<<<<< Preliminary (5'): Identify 'trivial' MINI-blocks. >>>>>

<<<<< Preliminary (6): Identify gap-pattern blocks, calculate their Dollo parsimony scenarios, and the initial parsimony candidate scenario of each gapped segment in the segmental MSAs (reference & reconstructed). >>>>>

<<<<< Preliminary (7'): Lump together some neighboring MINI-blocks affecting the identical set of sequences. >>>>>

<< Output of 'lump_together_similar_blocks': Content of @{$composite_miniblocks} (#{composite_miniblocks} = 6) >>

Indx_cmp_miniblock	beg_cmb	end_cmb	mrca	indices,constituent,miniblocks	list,position,shifts	merger,types	indices,involved,seqs

0	3	9	29	2	3	n/a	0,1,2,3,4,5,6,7,8,9,10,12,14
1	3	22	21	3,7	3,5	0	11
2	6	9	26	5	4	n/a	13
3	21	24	29	4	4	n/a	0,1,2,3,4,5,6,7,8,9,10,13,14
4	23	24	21	6	4	n/a	11
5	27	30	16	1	1	n/a	8



<<<<< Preliminary (8): Reorganize the list of insertions/deletions in the initial candidate of parsimonious scenarios, for reference and reconstructed MSAs. >>>>>

<<< (1) For Reference MSA >>>

<<< (2) For Reconstructed MSA >>>

<<<<< Preliminary (9): Identify the pairs of 'equivalent' indel events in the reference & reconstructed MSAs...  >>>>>

<<<<< (i) MAIN PROCESS (1st Round)!!!: Associate each Composite 'MINI-Block' with (an) appropriate type(s) of MSA error(s)... (#{composite blocks} = 6) >>>>>


[[ Results of the Main Process (1st Round) ]]

[ Contents of @cblk_wise_cts_invlvd_indels ]

Indx_cmp_blk	#{rlv_indels}_ref	#{rlv_indels}_rec	#{rltd_indels}_ref	#{rltd_indels}_rec	#{other_involved}_ref	#{other_involved}_rec

0
1	2	0	0	0	0	0
2	2	1	0	0	0	0
3	1	0	0	1	0	0
4	1	0	0	0	0	0
5	2	1	0	0	0	0


[ Skipped Composite-Blocks (#{cblocks} = 1): 0 . ]


[ Contents of @cblk_wise_msa_errors ]

Indx_cmp_blk	Indx_error	len_cblk_ref	len_cblk_rec	Type	br1:beg1:end1:stat_ue1/br2:beg2:end2:stat_ue2/...(ref)	br1:beg1:end1:stat_ue1/br2:beg2:end2:stat_ue2/...(rec)

0	Skipped!!(NO_RELEVANT_BRANCH)
1	0	18	20	Complex(???)	21:18:18:X/21:7:9:-	None
2	0	4	4	Merge(same-type)	26:0:1:X/26:6:6:X	26:3:5:X
3	0	4	4	Complex(???)	23:21:24:-	24:19:20:-
4	0	2	2	Complex(???)	21:18:18:X	None
5	0	4	4	Merge(same-type)	16:25:25:X/16:30:30:X	16:25:26:X


[ Contents of %indel_ref2assoc_cblks ]

Br:beg:end(ref)	indices,of,associated,composite-blocks

26:0:1	2
26:6:6	2
21:7:9	1
21:18:18	1,4
23:21:24	3
16:25:25	5
16:30:30	5
14:30:31	None


[ Contents of %indel_rec2assoc_cblks ]

Br:beg:end(rec)	indices,of,associated,composite-blocks

26:3:5	2
23:17:18	None
24:19:20	3
20:19:20	None
16:25:26	5
14:30:31	None


<<<< (ii) MAIN PROCESS (2nd Round)!!: Attempt to 'hard-link' skipped composite 'MINI-Block's to non-skipped ones, and to resolve Composite 'MINI-Block's associated with 'Complex' errors... >>>>

[[ Interim Results ]]

[ Contents of %cb2hard_linked (#{keys} = 1) ]

Indx_cmp_blk	=> [indices,cblks,hard,linked,by,the,key]

0	=> [1],


[ Contents of %cb2hard_linking (#{keys} = 1) ]

Indx_cmp_blk	=> [indices,cblks,hard,linking,the,key]

1	=> [0],


[ 'Soft-linked' pairs of composite-blocks (#{pairs} = 1) ]

Indx_cblk_A	indx_cblk_B

1	4


[[ Results of the Main Process (2nd Round) ]]

[ For the 1 th pair: (1, 4) ]


{ The representative path is: 4  -> 1 }


( Rough frameworks of the 1st- & 2nd-moved c-blocks )

Subject_c-block	beg_cb	end_cb	shift_le	shift_re	rlv_branch	indices,invlvd,seqs,le	indices,invlvd,seqs,re

1st(intermediate)	23	24	4	4	21	11	11
2nd(reconstructed)	3	22	3	5	21	0,1,2,3,4,5,6,7,8,9,10,11,12,14	11


( Errors associated with the c-blocks )

Subject_c-block	Type	br1:beg1:end1:stat_ue1/br2:beg2:end2:stat_ue2/...(before)	br1:beg1:end1:stat_ue1/br2:beg2:end2:stat_ue2/...(after)

1st(intermediate)	Complex(???)	21:18:18:X	21:21:22:X
2nd(reconstructed)	Complex(???)	21:21:22:X/20:17:17:X	None


