<<<<< Input Tree (Top_node = 29) >>>>>

( seq0020{28}:0.1529, ( seq0018{26}:0.1741, ( ( seq0015{23}:0.1492, ( seq0013{20}:0.1827, seq0014{21}:0.1659 ){22}:0.0049 ){24}:0.0297, ( ( seq0008{16}:0.0865, seq0009{17}:0.1286 ){18}:0.0335, ( ( seq0005{10}:0.0368, ( seq0006{11}:0.0286, seq0007{12}:0.0362 ){13}:0.0065 ){14}:0.0368, ( ( seq0000{1}:0.0054, seq0001{2}:0.0081 ){3}:0.0232, ( seq0002{4}:0.0189, ( seq0003{5}:0.0124, seq0004{6}:0.0108 ){7}:0.0070 ){8}:0.0270 ){9}:0.0205 ){15}:0.0703 ){19}:0.0383 ){25}:0.0314 ){27}:0.0130 ){29};


<<<<< Input MSA >>>>>

#{Sequences} = 15 .
#{Sites in the segment}_ref = 27 ,
#{Sites in the segment}_rec = 24 .


<< Correspondence between sequence IDs and sequence indices >>

Indx:	Seq_ID

0:	seq0000
1:	seq0001
2:	seq0002
3:	seq0003
4:	seq0004
5:	seq0005
6:	seq0006
7:	seq0007
8:	seq0008
9:	seq0009
10:	seq0013
11:	seq0014
12:	seq0015
13:	seq0018
14:	seq0020


<< Original Segment of the Reference Alignment: >>

(position)     000000000011111111112222222
               012345678901234567890123456
                                          
seq0000        C---GGGGTCTACAA----CTTGAGCA
seq0001        C---AGGGTCTACAA----CTTGAGCA
seq0002        C---GGGGGGTAAAG----CTTGAGCA
seq0003        C---GGTGTGTAAAG----CTTGAGCA
seq0004        C---GGTGTGTAAAG----CTTGAGCA
seq0005        C---GGGGTGTACAG----CTTCA--T
seq0006        C---GTGGTGTACAG----CTTGA--T
seq0007        C---GTGGTGTACAG----CTTGA--T
seq0008        C---GAGGTCTACAC-----TCCA-CT
seq0009        C---GGGGTCTACAC----ATTCAGCA
seq0013        C---GGGGTCGCGAC----CGCGGGGA
seq0014        CCTTGTGGTCTA-AC----CTCGAGGA
seq0015        C---GGGGTCTACACTAACCCCGAGGA
seq0018        ----GTAGGCAACAC----CTCAAGAA
seq0020        C---GTGGTATACAC----CTCAAGAA


<< Original Segment of the Reconstructed Alignment: >>

(position)     000000000011111111112222
               012345678901234567890123
                                       
seq0000        CGGGGTCT--AC--AACTTGAGCA
seq0001        CAGGGTCT--AC--AACTTGAGCA
seq0002        CGGGGGGT--AA--AGCTTGAGCA
seq0003        CGGTGTGT--AA--AGCTTGAGCA
seq0004        CGGTGTGT--AA--AGCTTGAGCA
seq0005        CGGGGTGT--AC--AGCTTCAT--
seq0006        CGTGGTGT--AC--AGCTTGAT--
seq0007        CGTGGTGT--AC--AGCTTGAT--
seq0008        CGAGGTCT--AC--AC--TCCACT
seq0009        CGGGGTCT--AC--ACATTCAGCA
seq0013        CGGGGTCG----CGACCGCGGGGA
seq0014        CCTTGTGG--TCTAACCTCGAGGA
seq0015        CGGGGTCTACACTAACCCCGAGGA
seq0018        -GTAGGCA--AC--ACCTCAAGAA
seq0020        CGTGGTAT--AC--ACCTCAAGAA


<<<<< Preliminary (0): Map the residue numbers onto the reference & reconstructed MSAs... >>>>>

<<<<< Preliminary (1): Map the position shifts (from reference to reconstructed) onto the Reconstructed MSA... >>>>>

<< Output of 'map_shifts_respos_bw_2msas' >>

($shift_lf, $shift_rf) = (0, -3) .

[ Shifts in the Reconstructed MSA ]

(position)	    0    1    2    3    4    5    6    7    8    9   10   11   12   13   14   15   16   17   18   19   20   21   22   23

seq0000   	    0   -3   -3   -3   -3   -3   -3   -3    -    -   -1   -1    -    -    1    1   -3   -3   -3   -3   -3   -3   -3   -3
seq0001   	    0   -3   -3   -3   -3   -3   -3   -3    -    -   -1   -1    -    -    1    1   -3   -3   -3   -3   -3   -3   -3   -3
seq0002   	    0   -3   -3   -3   -3   -3   -3   -3    -    -   -1   -1    -    -    1    1   -3   -3   -3   -3   -3   -3   -3   -3
seq0003   	    0   -3   -3   -3   -3   -3   -3   -3    -    -   -1   -1    -    -    1    1   -3   -3   -3   -3   -3   -3   -3   -3
seq0004   	    0   -3   -3   -3   -3   -3   -3   -3    -    -   -1   -1    -    -    1    1   -3   -3   -3   -3   -3   -3   -3   -3
seq0005   	    0   -3   -3   -3   -3   -3   -3   -3    -    -   -1   -1    -    -    1    1   -3   -3   -3   -3   -3   -5    -    -
seq0006   	    0   -3   -3   -3   -3   -3   -3   -3    -    -   -1   -1    -    -    1    1   -3   -3   -3   -3   -3   -5    -    -
seq0007   	    0   -3   -3   -3   -3   -3   -3   -3    -    -   -1   -1    -    -    1    1   -3   -3   -3   -3   -3   -5    -    -
seq0008   	    0   -3   -3   -3   -3   -3   -3   -3    -    -   -1   -1    -    -    1    1    -    -   -2   -2   -2   -2   -3   -3
seq0009   	    0   -3   -3   -3   -3   -3   -3   -3    -    -   -1   -1    -    -    1    1   -3   -3   -3   -3   -3   -3   -3   -3
seq0013   	    0   -3   -3   -3   -3   -3   -3   -3    -    -    -    -    1    1    1    1   -3   -3   -3   -3   -3   -3   -3   -3
seq0014   	    0    0    0    0    0    0    0    0    -    -    2    2    2    2    1    1   -3   -3   -3   -3   -3   -3   -3   -3
seq0015   	    0   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3   -3
seq0018   	    -   -3   -3   -3   -3   -3   -3   -3    -    -   -1   -1    -    -    1    1   -3   -3   -3   -3   -3   -3   -3   -3
seq0020   	    0   -3   -3   -3   -3   -3   -3   -3    -    -   -1   -1    -    -    1    1   -3   -3   -3   -3   -3   -3   -3   -3




[INFORMATION] The original $commoner_shift_flank = -3. Thus, we will shift the entire reconstructed MSA ...

<< REVISED Output of 'map_shifts_respos_bw_2msas' >>

New ($shift_lf, $shift_rf) = (0, 0) .

[ New Shifts in the Reconstructed MSA ]

(position)	    0    1    2    3    4    5    6    7    8    9   10   11   12   13   14   15   16   17   18   19   20   21   22   23   24   25   26

seq0000   	    -    -    -    3    0    0    0    0    0    0    0    -    -    2    2    -    -    4    4    0    0    0    0    0    0    0    0
seq0001   	    -    -    -    3    0    0    0    0    0    0    0    -    -    2    2    -    -    4    4    0    0    0    0    0    0    0    0
seq0002   	    -    -    -    3    0    0    0    0    0    0    0    -    -    2    2    -    -    4    4    0    0    0    0    0    0    0    0
seq0003   	    -    -    -    3    0    0    0    0    0    0    0    -    -    2    2    -    -    4    4    0    0    0    0    0    0    0    0
seq0004   	    -    -    -    3    0    0    0    0    0    0    0    -    -    2    2    -    -    4    4    0    0    0    0    0    0    0    0
seq0005   	    -    -    -    3    0    0    0    0    0    0    0    -    -    2    2    -    -    4    4    0    0    0    0    0   -2    -    -
seq0006   	    -    -    -    3    0    0    0    0    0    0    0    -    -    2    2    -    -    4    4    0    0    0    0    0   -2    -    -
seq0007   	    -    -    -    3    0    0    0    0    0    0    0    -    -    2    2    -    -    4    4    0    0    0    0    0   -2    -    -
seq0008   	    -    -    -    3    0    0    0    0    0    0    0    -    -    2    2    -    -    4    4    -    -    1    1    1    1    0    0
seq0009   	    -    -    -    3    0    0    0    0    0    0    0    -    -    2    2    -    -    4    4    0    0    0    0    0    0    0    0
seq0013   	    -    -    -    3    0    0    0    0    0    0    0    -    -    -    -    4    4    4    4    0    0    0    0    0    0    0    0
seq0014   	    -    -    -    3    3    3    3    3    3    3    3    -    -    5    5    5    5    4    4    0    0    0    0    0    0    0    0
seq0015   	    -    -    -    3    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0
seq0018   	    -    -    -    -    0    0    0    0    0    0    0    -    -    2    2    -    -    4    4    0    0    0    0    0    0    0    0
seq0020   	    -    -    -    3    0    0    0    0    0    0    0    -    -    2    2    -    -    4    4    0    0    0    0    0    0    0    0



<<<<< Preliminary (2): Put together the mapped position shifts into some Classes ... >>>>>

<< Output of 'br_list_classes_shift_respos' >>

$commoner_shift_flank = 0 .


<<<<< Preliminary (3'): For each MINI-class of shifts, parsimoniously infer the branch(es) separating the affected sequences from the rest. >>>>>

<<<<< ADDITIONAL Preliminary Process (3.5'): Split mini-classes each of which consists of unnaturally remote sequences... >>>>>

... NO CHANGES were made ...


<<<<< Preliminary (4): Merge the MINI-classes of shifts. >>>>>

<<<<< Preliminary (5'): Identify 'trivial' MINI-blocks. >>>>>

<<<<< Preliminary (6): Identify gap-pattern blocks, calculate their Dollo parsimony scenarios, and the initial parsimony candidate scenario of each gapped segment in the segmental MSAs (reference & reconstructed). >>>>>

<<<<< Preliminary (7'): Lump together some neighboring MINI-blocks affecting the identical set of sequences. >>>>>

<< Output of 'lump_together_similar_blocks': Content of @{$composite_miniblocks} (#{composite_miniblocks} = 7) >>

Indx_cmp_miniblock	beg_cmb	end_cmb	mrca	indices,constituent,miniblocks	list,position,shifts	merger,types	indices,involved,seqs

0	3	3	29	5	3	n/a	0,1,2,3,4,5,6,7,8,9,10,12,14
1	3	16	21	6,9	3,5	0	11
2	13	14	29	4	2	n/a	0,1,2,3,4,5,6,7,8,9,13,14
3	15	18	20	8	4	n/a	10
4	17	18	29	7	4	n/a	0,1,2,3,4,5,6,7,8,9,11,13,14
5	21	24	16	3	1	n/a	8
6	24	24	14	0	-2	n/a	5,6,7



<<<<< Preliminary (8): Reorganize the list of insertions/deletions in the initial candidate of parsimonious scenarios, for reference and reconstructed MSAs. >>>>>

<<< (1) For Reference MSA >>>

<<< (2) For Reconstructed MSA >>>

<<<<< Preliminary (9): Identify the pairs of 'equivalent' indel events in the reference & reconstructed MSAs...  >>>>>

<<<<< (i) MAIN PROCESS (1st Round)!!!: Associate each Composite 'MINI-Block' with (an) appropriate type(s) of MSA error(s)... (#{composite blocks} = 7) >>>>>


[[ Results of the Main Process (1st Round) ]]

[ Contents of @cblk_wise_cts_invlvd_indels ]

Indx_cmp_blk	#{rlv_indels}_ref	#{rlv_indels}_rec	#{rltd_indels}_ref	#{rltd_indels}_rec	#{other_involved}_ref	#{other_involved}_rec

0
1	2	0	0	0	0	0
2	0	1	0	1	0	0
3	0	1	0	0	0	0
4	1	0	0	1	0	0
5	2	1	0	0	0	0
6	1	1	0	0	0	0


[ Skipped Composite-Blocks (#{cblocks} = 1): 0 . ]


[ Contents of @cblk_wise_msa_errors ]

Indx_cmp_blk	Indx_error	len_cblk_ref	len_cblk_rec	Type	br1:beg1:end1:stat_ue1/br2:beg2:end2:stat_ue2/...(ref)	br1:beg1:end1:stat_ue1/br2:beg2:end2:stat_ue2/...(rec)

0	Skipped!!(NO_RELEVANT_BRANCH)
1	0	12	14	Complex(???)	21:12:12:X/21:1:3:-	None
2	0	2	2	Complex(???)	None	24:15:16:-/23:11:12:-
3	0	4	4	Complex(???)	None	20:13:14:X
4	0	2	2	Complex(???)	23:15:18:-	24:15:16:-
5	0	4	4	Merge(same-type)	16:19:19:X/16:24:24:X	16:19:20:X
6	0	1	1	Shift	14:24:25:X	14:25:26:X


[ Contents of %indel_ref2assoc_cblks ]

Br:beg:end(ref)	indices,of,associated,composite-blocks

26:0:0	{Equivalent to '26:3:3'(rec)}
21:1:3	1
21:12:12	1
23:15:18	4
16:19:19	5
16:24:24	5
14:24:25	6


[ Contents of %indel_rec2assoc_cblks ]

Br:beg:end(rec)	indices,of,associated,composite-blocks

26:3:3	{Equivalent to '26:0:0'(ref)}
23:11:12	2
20:13:14	3
24:15:16	2,4
16:19:20	5
14:25:26	6


<<<< (ii) MAIN PROCESS (2nd Round)!!: Attempt to 'hard-link' skipped composite 'MINI-Block's to non-skipped ones, and to resolve Composite 'MINI-Block's associated with 'Complex' errors... >>>>

[[ Interim Results ]]

[ Contents of %cb2hard_linked (#{keys} = 1) ]

Indx_cmp_blk	=> [indices,cblks,hard,linked,by,the,key]

0	=> [1],


[ Contents of %cb2hard_linking (#{keys} = 1) ]

Indx_cmp_blk	=> [indices,cblks,hard,linking,the,key]

1	=> [0],


[ 'Soft-linked' pairs of composite-blocks (#{pairs} = 1) ]

Indx_cblk_A	indx_cblk_B

2	4


[[ Results of the Main Process (2nd Round) ]]

[ For the 1 th pair: (2, 4) ]

