<<<<< Input Tree (Top_node = 29) >>>>>

( seq0020{28}:0.1529, ( seq0018{26}:0.1741, ( ( seq0015{23}:0.1492, ( seq0013{20}:0.1827, seq0014{21}:0.1659 ){22}:0.0049 ){24}:0.0297, ( ( seq0008{16}:0.0865, seq0009{17}:0.1286 ){18}:0.0335, ( ( seq0005{10}:0.0368, ( seq0006{11}:0.0286, seq0007{12}:0.0362 ){13}:0.0065 ){14}:0.0368, ( ( seq0000{1}:0.0054, seq0001{2}:0.0081 ){3}:0.0232, ( seq0002{4}:0.0189, ( seq0003{5}:0.0124, seq0004{6}:0.0108 ){7}:0.0070 ){8}:0.0270 ){9}:0.0205 ){15}:0.0703 ){19}:0.0383 ){25}:0.0314 ){27}:0.0130 ){29};


<<<<< Input MSA >>>>>

#{Sequences} = 15 .
#{Sites in the segment}_ref = 81 ,
#{Sites in the segment}_rec = 81 .


<< Correspondence between sequence IDs and sequence indices >>

Indx:	Seq_ID

0:	seq0000
1:	seq0001
2:	seq0002
3:	seq0003
4:	seq0004
5:	seq0005
6:	seq0006
7:	seq0007
8:	seq0008
9:	seq0009
10:	seq0013
11:	seq0014
12:	seq0015
13:	seq0018
14:	seq0020


<< Original Segment of the Reference Alignment: >>

(position)     000000000011111111112222222222333333333344444444445555555555
               012345678901234567890123456789012345678901234567890123456789
                                                                           
seq0000        C-----------------------------------------------------------
seq0001        C-----------------------------------------------------------
seq0002        C-----------------------------------------------------------
seq0003        C-----------------------------------------------------------
seq0004        C-----------------------------------------------------------
seq0005        C-----------------------------------------------------------
seq0006        C-----------------------------------------------------------
seq0007        C-----------------------------------------------------------
seq0008        CATCAAATCCAGTGAGATTCTAATAGGGGAGCCCCGTTTGTTATAACGTGCGTTTAGCGC
seq0009        C-----------------------------------------------------------
seq0013        C-----------------------------------------------------------
seq0014        C-----------------------------------------------------------
seq0015        C-----------------------------------------------------------
seq0018        C-----------------------------------------------------------
seq0020        G-----------------------------------------------------------

(position)     666666666677777777778
               012345678901234567890
                                    
seq0000        ---------------------
seq0001        ---------------------
seq0002        ---------------------
seq0003        ---------------------
seq0004        ---------------------
seq0005        ---------------------
seq0006        ---------------------
seq0007        ---------------------
seq0008        TAGTGATCTGGAATCAGGCTC
seq0009        ---------------------
seq0013        ---------------------
seq0014        ---------------------
seq0015        ---------------------
seq0018        ---------------------
seq0020        ---------------------


<< Original Segment of the Reconstructed Alignment: >>

(position)     000000000011111111112222222222333333333344444444445555555555
               012345678901234567890123456789012345678901234567890123456789
                                                                           
seq0000        ------------------------------------------------------------
seq0001        ------------------------------------------------------------
seq0002        ------------------------------------------------------------
seq0003        ------------------------------------------------------------
seq0004        ------------------------------------------------------------
seq0005        ------------------------------------------------------------
seq0006        ------------------------------------------------------------
seq0007        ------------------------------------------------------------
seq0008        CATCAAATCCAGTGAGATTCTAATAGGGGAGCCCCGTTTGTTATAACGTGCGTTTAGCGC
seq0009        ------------------------------------------------------------
seq0013        ------------------------------------------------------------
seq0014        ------------------------------------------------------------
seq0015        ------------------------------------------------------------
seq0018        ------------------------------------------------------------
seq0020        ------------------------------------------------------------

(position)     666666666677777777778
               012345678901234567890
                                    
seq0000        --------------------C
seq0001        --------------------C
seq0002        --------------------C
seq0003        --------------------C
seq0004        --------------------C
seq0005        --------------------C
seq0006        --------------------C
seq0007        --------------------C
seq0008        TAGTGATCTGGAATCAGGCTC
seq0009        --------------------C
seq0013        --------------------C
seq0014        --------------------C
seq0015        --------------------C
seq0018        --------------------C
seq0020        --------------------G


<<<<< Preliminary (0): Map the residue numbers onto the reference & reconstructed MSAs... >>>>>

<<<<< Preliminary (1): Map the position shifts (from reference to reconstructed) onto the Reconstructed MSA... >>>>>

<< Output of 'map_shifts_respos_bw_2msas' >>

($shift_lf, $shift_rf) = (0, 0) .

[ Shifts in the Reconstructed MSA ]

(position)	    0    1    2    3    4    5    6    7    8    9   10   11   12   13   14   15   16   17   18   19   20   21   22   23   24   25   26   27   28   29   30   31   32   33   34   35   36   37   38   39   40   41   42   43   44   45   46   47   48   49

seq0000   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -
seq0001   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -
seq0002   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -
seq0003   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -
seq0004   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -
seq0005   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -
seq0006   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -
seq0007   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -
seq0008   	    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0
seq0009   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -
seq0013   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -
seq0014   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -
seq0015   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -
seq0018   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -
seq0020   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -



(position)	   50   51   52   53   54   55   56   57   58   59   60   61   62   63   64   65   66   67   68   69   70   71   72   73   74   75   76   77   78   79   80

seq0000   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -   80
seq0001   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -   80
seq0002   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -   80
seq0003   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -   80
seq0004   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -   80
seq0005   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -   80
seq0006   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -   80
seq0007   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -   80
seq0008   	    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0    0
seq0009   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -   80
seq0013   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -   80
seq0014   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -   80
seq0015   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -   80
seq0018   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -   80
seq0020   	    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -    -   80



<<<<< Preliminary (2): Put together the mapped position shifts into some Classes ... >>>>>

<< Output of 'br_list_classes_shift_respos' >>

$commoner_shift_flank = 0 .


<<<<< Preliminary (3'): For each MINI-class of shifts, parsimoniously infer the branch(es) separating the affected sequences from the rest. >>>>>

<<<<< ADDITIONAL Preliminary Process (3.5'): Split mini-classes each of which consists of unnaturally remote sequences... >>>>>

... NO CHANGES were made ...


<<<<< Preliminary (4): Merge the MINI-classes of shifts. >>>>>

<<<<< Preliminary (5'): Identify 'trivial' MINI-blocks. >>>>>

<<<<< Preliminary (6): Identify gap-pattern blocks, calculate their Dollo parsimony scenarios, and the initial parsimony candidate scenario of each gapped segment in the segmental MSAs (reference & reconstructed). >>>>>

<<<<< Preliminary (7'): Lump together some neighboring MINI-blocks affecting the identical set of sequences. >>>>>

<< Output of 'lump_together_similar_blocks': Content of @{$composite_miniblocks} (#{composite_miniblocks} = 1) >>

Indx_cmp_miniblock	beg_cmb	end_cmb	mrca	indices,constituent,miniblocks	list,position,shifts	merger,types	indices,involved,seqs

0	80	80	29	0	80	n/a	0,1,2,3,4,5,6,7,9,10,11,12,13,14



<<<<< Preliminary (8): Reorganize the list of insertions/deletions in the initial candidate of parsimonious scenarios, for reference and reconstructed MSAs. >>>>>

<<< (1) For Reference MSA >>>

<<< (2) For Reconstructed MSA >>>

<<<<< Preliminary (9): Identify the pairs of 'equivalent' indel events in the reference & reconstructed MSAs...  >>>>>

<<<<< (i) MAIN PROCESS (1st Round)!!!: Associate each Composite 'MINI-Block' with (an) appropriate type(s) of MSA error(s)... (#{composite blocks} = 1) >>>>>


[[ Results of the Main Process (1st Round) ]]

[ Contents of @cblk_wise_cts_invlvd_indels ]

Indx_cmp_blk	#{rlv_indels}_ref	#{rlv_indels}_rec	#{rltd_indels}_ref	#{rltd_indels}_rec	#{other_involved}_ref	#{other_involved}_rec

0	1	1	0	0	0	0


[ Skipped Composite-Blocks (#{cblocks} = 0):  . ]


[ Contents of @cblk_wise_msa_errors ]

Indx_cmp_blk	Indx_error	len_cblk_ref	len_cblk_rec	Type	br1:beg1:end1:stat_ue1/br2:beg2:end2:stat_ue2/...(ref)	br1:beg1:end1:stat_ue1/br2:beg2:end2:stat_ue2/...(rec)

0	0	1	1	Shift	16:1:80:-	16:0:79:-


[ Contents of %indel_ref2assoc_cblks ]

Br:beg:end(ref)	indices,of,associated,composite-blocks

16:1:80	0


[ Contents of %indel_rec2assoc_cblks ]

Br:beg:end(rec)	indices,of,associated,composite-blocks

16:0:79	0


<<<< (ii) MAIN PROCESS (2nd Round)!!: Attempt to 'hard-link' skipped composite 'MINI-Block's to non-skipped ones, and to resolve Composite 'MINI-Block's associated with 'Complex' errors... >>>>

[[ Interim Results ]]

[ Contents of %cb2hard_linked (#{keys} = 0) ]

Indx_cmp_blk	=> [indices,cblks,hard,linked,by,the,key]



[ Contents of %cb2hard_linking (#{keys} = 0) ]

Indx_cmp_blk	=> [indices,cblks,hard,linking,the,key]



[ 'Soft-linked' pairs of composite-blocks (#{pairs} = 0) ]

Indx_cblk_A	indx_cblk_B



[[ Results of the Main Process (2nd Round) ]]

