Bioinformatics.Org Back to PrimerX homepage
Automated design of mutagenic primers for site-directed mutagenesis
Home

Primer Design:
    DNA-based
    Protein-based

Primer Characterization

Documentation

Links

ACTGCATGATGATCATGCGTCGTCGATGAT

Primer Design Based on DNA Sequence

Step 4. Since you skipped Step 2, manually change the template DNA sequence below, to incorporate the desired insertions, deletions, or substitutions.

1        10        20        30        40        50        60
|........|.........|.........|.........|.........|.........|


Step 5. The default parameters matching your desired protocol () have been entered for you below. Check and change them if necessary, and then click on "Generate primers."

      Min   Max
    Melting temp (°C):  
    GC content (%):  
    Length (bp):  
    5' flanking region (bp):  
    3' flanking region (bp):  
    
    


    Reverse primers Min   Max
    *Distance from mutation (bp):     *This refers to the distance in base pairs from the first mutated base pair in the forward primer to the 5' end of the reverse primer, when the two sequences are aligned at their complementary regions. Use negative values to signify an upstream direction (left) from the mutated base pair, and positive values for a downstream direction (right).
    Melting temp (°C):  
    GC content (%):  
    Length (bp):  
    

Back | Home | Help