DNA Pattern Find

DNA Pattern Find accepts a sequence along with a set of search patterns and returns the number and positions of sites that match the patterns. The search patterns can contain "wild cards", allowing you to detect a variety of similar sequences using a single pattern.

Paste the raw or FASTA sequence into the text area below.
>sample sequence cggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcgtaatacgactcactatagggcgaattggagctccaccgcggtggcggccgctctagaactagtggatcccccgggctgcaggaattcgatatcaagcttatcgataccgtcgacctcgagggggggcccggtacccagcttttgttccctttagtgagggttaattgcgcgcttg

Enter the patterns in the 5' to 3' direction. An example pattern is: /ac[gt]agcct/ (My pattern's name). The two slashes mark the boundary of the pattern and the round brackets surround the name of the pattern. The square brackets surround possible bases at a degenerate site. You can enter multiple patterns separated by commas. Incorrect entry of the patterns may produce errors. DNA Pattern Find automatically constructs a reverse-complement version of each pattern sequence so that matches on the reverse strand can be detected.
/TAATAC[GC]ACTCACTA[TC]AGGG/ (T7 Primer with degeneracies), /ATTAACCCT[CT]ACTAAA[GC]/ (T3 Primer with degeneracies)

[home]