Bioinformatics.org
[OMICtools]
Not logged in
  • Log in
  • Bioinformatics.org
    Membership (40738+) Group hosting [?] Wiki
    Franklin Award
    Sponsorships

    Careers
    About bioinformatics
    Bioinformatics training
    Bioinformatics jobs

    Research
    All information groups
    Online databases Online analysis tools Online education tools More tools

    Development
    All software groups
    FTP repository
    SVN & CVS repositories [?]
    Mailing lists

    Forums
    News & Commentary
  • Submit
  • Archives
  • Subscribe

  • Jobs Forum
    (Career Center)
  • Submit
  • Archives
  • Subscribe
  • BIRCH: Comprehensive bioinfo. system - Support tickets

    Submit | Open tickets | Closed tickets

    [ Ticket #1161 ] newlines not deleted when reading .gde files
    Date:
    10/26/11 18:28
    Submitted by:
    B_Fristensky
    Assigned to:
    Alvare
    Category:
    bioLegato
    Priority:
    4
    Ticket group:
    Bug
    Resolution:
    Resolved
    Summary:
    newlines not deleted when reading .gde files
    Original submission:
    Many .gde files, particularly those produces by GDE prior to bioLegato, have newlines in the sequence field. For example:

    {
    name "CACHIT"
    type "DNA"
    descrip "CACHIT from >CACHIT,, 774 bases, 6B589591 checksum."
    direction 1
    strandedness 1
    sequence "
    ATTGCAGTGTATTGGGGACAAAATGGAAATGAAGGGTCTTTGCAAGATGCTTGCAACACA
    AACAACTACCAATTTGTGAACATAGCGTTTTTATCCACTTTTGGAAATGGCCAAAACCCA
    CAAATAAACCTTGCTGGCCATTGTGATCCATCCACAAATGGCTGCACAAAATTCAGTCCT
    GAAATCCAAGCTTGTCAAGCCAAAGGTATCAAAGTGTTGTTGTCGCTCGGAGGCGGAGCA
    GGAAGTTACTCTCTGAACTCCGCTGAGGAAGCGACAACACTTGCAAATTACCTTTGGAAC
    AATTTCTTGGGTGGCACGTCAACTTCAAGACCATTAGGTGATGCTGTTTTAGATGGAATT
    GATTTTGACATTGAATCTGGTGGC---CAACATTATGATGAACTTGCAAAAGCACTT---
    ---------AATGGTTTT---AGTCAACAGAAAGTTTACCTTTCTGCAGCACCACAATGT
    CCTTACCCTGACGCTCATTTGGATTCAGCTATTCAAACTGGTTTATTTGATTATGTTTGG
    GTTCAGTTTTATAATAATCCTCAATGTCAATACTCAAATGGAAACATTAACAATCTTGTT
    AATGCTTGGAATCAATGGACA---TCAAGTCAAGCTAAACAAGTGTTTTTAGGTGTGCCT
    GCTTCTGATGCTGCTGCTCCAAGTGGTGGTTTGATTCCTGCTGATGTTTTGACTTCTCAA
    GTTCTTCCTGCTATTAAGACTTCTCCTAAATATGGTGGTGTTATGATTTGGGAT"
    }

    When bioLegato reads these files, the newlines are included in the alighment, resulting in blank columns in the sequence canvas. Newlines should be stripped from the ends of these sequence lines, as they are for FASTA files.
    Please log in to add comments and receive followups via email.
    No followups have been posted
    No results for "Dependent on ticket"
    No results for "Dependent on Task"
    No other tickets are dependent on this ticket
    Ticket change history
    Field Old value Date By
    status_id Open 12/28/11 16:11 B_Fristensky
    close_date 12/31/69 19:00 12/28/11 16:11 B_Fristensky
    resolution_id Not Resolved 10/31/11 11:37 Alvare
    status_id Pending 10/26/11 18:29 B_Fristensky
    priority 5 10/26/11 18:29 B_Fristensky
    assigned_to unset 10/26/11 18:29 B_Fristensky
    resolution_id Unset 10/26/11 18:29 B_Fristensky

     

    Copyright © 2019 · Scilico, LLC