|
These datas are free for academic use only, please contact me for any other use. Schistosoma mansoni see consensus multiple alignment with clustalw Direct access to contigs :
consensusID : consensus_2128#0 NCBI blastX ! send the sequence to the NCBI site ! NCBI blastN ! send the sequence to the NCBI site ! Sequences nbr = 1 consensus length = 72 fasta sequence
[GTGGAAATTTTTCCGGTGAAATTCATAATATTTAAAGAAGATAACTCCTTTTGTTTACCAGCCTTCCGCTCT]
[+] EMBL SMRAP158 [GTGGAAATTTTTCCGGTGAAATTCATAATATTTAAAGAAGATAACTCCTTTTGTTTACCAGCCTTCCGCTCT]
clustalw multiple alignements is not computed in this case |
| Copyright Thu Nov 6 12:32:27 CET 2003 Hubert Wassner (hubert.wassner@noos.fr) | ||||