Home
Who am I
Technology
EST Assembly
Contact

These datas are free for academic use only, please contact me for any other use.

Oryza sativa
cluster # 17382 cluster # 17382       Sequences # 81       consensus # 7


see consensus multiple alignment with clustalw

Direct access to contigs :
consensus_17382#0 length = 1656 sequences # 34  
consensus_17382#1 length = 1595 sequences # 36  
consensus_17382#2 length = 829 sequences # 7  
consensus_17382#3 length = 779 sequences # 1  
consensus_17382#4 length = 524 sequences # 1  
consensus_17382#5 length = 482 sequences # 1  
consensus_17382#6 length = 169 sequences # 1  

consensusID : consensus_17382#0
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 34
consensus length = 1656
fasta sequence
                              [AAAAAAAAAAAAAAAAAAAAACGGGAGATTGGATCGGAAGCTTCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTC-GCGCTGGCGCT-CGCGCTG-GCGTCCGTCGCCGCTGTCGCCGGCGAGG-TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC-TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA-TTCAGCAACAAGGATAAAACCC-T-GGTGC-TGCAGTTCTCTGTAAAGCATGAGCAAAAGC-TTGACTGTGGTGGT-GGATATGTCAAGTTGCTTGGT-GGTGATGTTGACCAGAAGAAATTT-GGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCA-CCAAGAAGGTCCATACTATCTTTA-CTAAGAATGACAA-GAACCATTT-GATCAAGAAGGATGT-CCCCTGCGAGACTGATCAGC-TGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAA-TCTGG-CAGCATCTA-CGAGCACTGGGATATTC-TGCCTCCGAAGCAAATCAA-GGACCCAGAAGCTAAGAAGC-CAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGA-GGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACTGGGATGATGAGGAAG-ATGGTGAGTGGACTGCACCAACCATTCCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAA-CCCTAACTACCAAGGCAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCCATACATCTATGCTTTTGACAGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTCTGTTTGACAACTTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGGCCGATGAGAAGGCTGACTCTGATGCAGAGGATGGCAAGGATTCTGATGATGAGAAGCATGTATGTAACACTCCTGCGTTTTCTTGATACCTTCTGGATTCTGGTGATGCATTTCCTGTTAACCTCCATGTGTCCTGATCACCGTCCTTCCTTTCCAGGATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTCGCGACGATGCCAGGATTTGCTAGTTCTCCCATTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGACAAGAAAGTACTCTGTAGATGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTCTCTGTAGTGTCATTTTTCCCACCACAAGAAAAAGAACTGATAACTTATTGAACAAGAGA]

[+] EMBL AK104328             [AAAAAAAAAAAAAAAAAAAAACGGGAGATTGGATCGGAAGCTTCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTC GCGCTGGCGCT CGCGCTG GCGTCCGTCGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTGCTTGGT GGTGATGTTGACCAGAAGAAATTT GGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCA CCAAGAAGGTCCATACTATCTTTA CTAAGAATGACAA GAACCATTT GATCAAGAAGGATGT CCCCTGCGAGACTGATCAGC TGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAA TCTGG CAGCATCTA CGAGCACTGGGATATTC TGCCTCCGAAGCAAATCAA GGACCCAGAAGCTAAGAAGC CAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGA GGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACTGGGATGATGAGGAAG ATGGTGAGTGGACTGCACCAACCATTCCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAA CCCTAACTACCAAGGCAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCCATACATCTATGCTTTTGACAGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTCTGTTTGACAACTTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGGCCGATGAGAAGGCTGACTCTGATGCAGAGGATGGCAAGGATTCTGATGATGAGAAGCATGTATGTAACACTCCTGCGTTTTCTTGATACCTTCTGGATTCTGGTGATGCATTTCCTGTTAACCTCCATGTGTCCTGATCACCGTCCTTCCTTTCCAGGATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTCGCGACGATGCCAGGATTTGCTAGTTCTCCCATTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGACAAGAAAGTACTCTGTAGATGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTCTCTGTAGTGTCATTTTTCCCACCACAAGAAAAAGAACTGATAACTTATTGAACAAGAGA]
[+] EMBL CB656767             [                          GATTGGATCGGAAGCTTCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTC GCGCTGGCGCT CGCGCTG GCGTCCGTCGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTGCTTGGT GGTGATGTTGACCAGAAGAAATTT GGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCA CCAAGAAGGTCCATACTATCTTTA CTAAGAATGACAA GAACCATTT GATCAAGAAGGATGT CCCCTGCGAGACTGATCAGC TGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAA TCTGG CAGCATCTA CGAGCACTGGGATATTC TGCCTCCGAAGCAAATCAA GGACCCAGAAGCTAAGAAGC CAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGA GGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCNTAGAAGCCTGAGGACTGGGATGATGAGGAAG ATGGTGAGTGGACTGCACCAACCATTCCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CA753600             [                              GGATCGGAAGCTTCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTC GCGCTGGCGCT CGCGCTG GCGTCCGTCGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCCGCGGAGTACCCAGAA TTCAGCAACCAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTTCAGTNGCCTGGT GGTGATGTTGACCAGAAGAAATTTGGGTGGGGACCCCCCGTACAGCATAATGTTTGGACCAGACATCTGTGGGTACCGCA CCAAGAAGGTTCCTTCTATCTTTACCTAGGAGTGACCA GACCCCTTTGGATCCNGAGGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CA752730             [                             ccGATCGGAAGCTTCTAGAAGTTTCCGTGGG GATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTC GCGCTGGCGCT CGCGCTG GCGTCCGTCGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTGCTTGGT GGTGATGTTGACCAGAAGAAATTT GGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCA CCAAGAAGGTCCAT CTATCTTTA CTAAGAATGACAA GAACCATTT GATCAAGAAGGATGT  CCCTGTGAGACTGATCAGCTTGTCCCATGTGT CACTTTGATCATCCGTCCTGATGCTACATACACCATACTCA TGGCAATGTTGAGAAACAATTTTGG CAGCATTTA CGAGCACTGGGATATTCTTGCCTTCGAAGCAAATCAAGGGCCCCAGAAc                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL C93553               [                             ccGATCGGAAGCTTCTAGAAGTTTCCGTGGGCGATGGCGATCCG GCGAGGTCCTCCTCCTACGCCGCCGC GCTCT  GCGCTGGC CTNCGCG TGTGCGTCCGTCG CGCTGTCGCCGGC AGGATCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTNGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAa                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB656494             [                               GATCGGAAGCTTCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTC GCGCTGGCGCT CGCGCTG GCGTCCGTCGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTGCTTGGT GGTGATGTTGACCAGAAGAAATTT GGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCA CCAAGAAGGTCCATACTATCTTTA CTAAGAATGACAA GAACCATTT GATCAAGAAGGATGT CCCCTGCGAGACTGATCAGC TGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAA TCTGG CAGCATCTA CGAGCACTGGGATATTC TGCCTCCGAAGCAAATCAA GGACCCAGAAGCTAAGAAGC CAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGA GGACAAGAAGCCTGAGGGATACGATGATATTCCC AGGAAATCCCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL C72767               [                               GATCGGAAGCTTCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGTTC GCGCTGGCGCT CGCGCTG GCGTCCGTCGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCCNG GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTNCTTGGT GGTNATGTTGACCAGAAG AATTT TGTNGGGAAAC CCGTA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB649259             [                               GATCCGCAGCTTCTATAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTC GCGCTGGCGCT CGCGCTG GCGTCCGTCGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTGCTTGGT GGTGATGTTGACCAGAAGAAATTT GGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCA CCAAGAAGGTCCATACTATCTTTA CTAAGAATGACAA GAACCATTT GATCAAGAAGGATGT CCCCTGCGAGACTGATCAGC TGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAA TCTGG CAGCATCTA CGAGCACTGGGATATTC TGCCTCCGAAGCAAATCAA GGACCCAGAAGCTAAGAAGC CAGAGGACTGGGATGACAAGGAGTA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL C28962               [                                  CGGAAGCTTCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCNAGGTCCTCCTCCTACGCCGCCGCGGNGTNC GCGCTGGCGCT CGCNCTG GCGTCCNTNGCCGCTGTCGCCGGCNAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGNAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTAAGGACAAAGGTATnc                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CF322562             [                                     gAGCTTCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTC GCGCTGGCGCT CGCGCTG GCGTCCGTCGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTGCTTGGTGGGTGATGTTGACCAGAAGAAATTT GGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCA CCAAGAAGGTCCATACTATCTTTA CTAAGAATGACAA GAACCATTT GATCAAGAAGGATGT CCCCTGCGAGACTGATCAGC TG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL AU184528             [                                       GCTTCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTC GCGCTGGCGCT CGCGCTG GCGTCCGTCGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTGCTTGGT GGTGATGTTGACCAGAAGAAATTT GGTGGGGACAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB669351             [                                       GCTTCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTC GCGCTGGCGCT CGCGCTG GCGTCCGTCGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTGCTTGGT GGTGATGTTGACCAGAAGAAATTT GGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCA CCAAGAAGGTCCATACTATCTTTA CTAAGAATGACAA GAACCATTT GATCAAGAAGGATGT CCCCTGCGAGACTGATCAGC TGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAA TCTGG CAGCATCTA CGAGCACTGGGATATTC TGCCTCCGAAGCAAATCAA GGACCCAGAAGCTAAGAAGC CAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGA GGACAAGAAGCCTGAGGGATA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL C28712               [                                       GCTTCTAGAAGTTTCCGTGGGCGATGGNGATCCGCGCGAGGTCCTCCTCCTANGCNGCCGCGGNGTNC GCGCTGGCGCT CGCGGTG GCGNCCGTCGCCGCTGTCGCCGGNGANG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTNAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTNAGCAACAAGGATAAAACCC T GGTGCTTGCAGTTCTCTGTAAAGCATGAGCAAAAGCTTTGACTGTGGTGGT GGATATGTCAAGTTTCTTNGT GGTGATGTTGACCAGAAGAAATTT  GTGGGG CANACCGTACAGCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL AU064480             [                                         TTCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGC GTC GCGCTGGCGCN CGCGCTG GCGTCCGTNGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGANCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL AU161312             [                                         TTCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGC GTC GCGCTGGCGCT CGCGCTG GCGTCCGTCGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL AU064483             [                                         TTCTAGAAGTNTCCGTGGGCGAAGGCGANCCGCGCNAGGNCCTCCTCCTACGCCGCCGCGGC GTC GCGCTGGCGCN CGCGCTG GCGTCCGTNGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCTGAGT NCCAGAA TTCAGCAACNAGGAT AAACCC TNGGTGC TGCAGTTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL C28727               [                                          TCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTCTGTGCTGGCGCT CGCGNTG GCGTCCGTNGCCGCTGTCGCCGGAGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAATTTCAGCAACANGGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB628320             [                                           CTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTC GCGCTGGCGCT CGCGCTG GCGTCCGTCGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTGCTTGGT GGTGATGTTGACCAGAAGAAATTT GGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCA CCAAGAAGGTCCATACTATCTTTA CTAAGAATGACAA GAACCATTT GATCAAGAAGGATGT CCCCTGTGAGACTGATCAGC TGTCCCATGTGTACACTTTGATCATCCGTCCTGATGCTACATACACCATACTCATTGACAATGTTGAGAAGCAA TCTGG CAGCATCTA CGAGCACTGGGATATTC TGCCTCCGAAGCAAATCAA GGACCCAGAAGCTAAGAAGC CAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCCGA GGACAAGAAGCCTGAGGGATATGATGATATTCCC AGGAAATCCCTGACCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB654928             [                                           CTAGAACTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTC GCGCTGGCGCT CGCGCTG GCGTCCGTCGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTGCTTGGT GGTGATGTTGACCAGAAGAAATTT GGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCA CCAAGAAGGTCCATACTATCTTTA CTAAGAATGACAA GAACCATTT GATCAAGAAGGATGT CCCCTGCGAGACTGATCAGC TGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAA TCTGG CAGCATCTA CGAGCACTGGGATATTC TGCCTCCGAAGCAAATCAA GGACCCAGAAGCTAAGAAGC CAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGA GGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCNTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL OSR18211A            [                                           CTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCNAGGTCCTCCTCCTACGCCGCCGCGGCGGTC GCNCTGGCGCT CNCNCTG GCGTCCGTNGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTGCTTGGT GGTGAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL C91804               [                                             AGAAGTTTCCGTGGGCGATGGCGATCCGCGCNAGGTCCTCCTCCTACGCCGCCGCGGCGGTC GCGCTGGCGCT CGCGCTG GCGTCCGTCGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGANCCTGAGGACAAAGGTATCCAAACCTCTTAGGACTACAGGTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL AU068604             [                                                AGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGC GTC GCGCTGGCGCT CGCGCTG GCGTCCGTCGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATCTTGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CB659444             [                                                         GGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTC GCGCTGGCGCT CGCGCTG GCGTCCGTCGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTGCTTGGT GGTGATGTTGACCAGAAGAAATTT GGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCA CCAAGAAGGTCCATACTATCTTTA CTAAGAATGACAA GAACCATTT GATCAAGAAGGATGT CCCCTGCGAGACTGATCAGC TGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAA TCTGG CAGCATCTA CGAGCACTGGGATATTC TGCCTCCGAAGCAAATCAA GGACCCAGAAGCTAAGAAGC CAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGAGGGAC AGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACTGGGATGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL C28257               [                                                                 GCGATCCGCGCGAGGTCCTCCTCCTACGCNGCCGCGGCGGTC GCNCTGGCGCT CGCNCTG GCGTCCGTNGCCGCTGTCGCCGGCGAGG NCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTNAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTGCTTGGT GGTGATGTTGACCAGAAGAAATTT TGTGGGGACACACCGTACAGCATTATGTTTNGNCCAGACATCTGTNGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CF323995             [                                                                   GATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTC GCGCTGGCGCT CGCGCTG GCGTCCGTCGCCGCTGTCGCCGGCGAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTGCTTGGTGGGTGATGTTGACCAGAAGAAATTT GGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCA CCAAGAAGGTCCATACTATCTTTA CTAAGAATGACAA GAACCATTT GATCAAGAAGGATGT CCCCTGCGAGACTGATCAGC TGTCCCATGTGTACACTNTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAA TCTGG CAGCATCTA CGAGCACTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB671653             [                                                                                                                                                  GCCGGCCAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGACAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTGCTTGGT GGTGATGTTGACCAGAAGAAATTT GGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCA CCAAGAAGGTCCATACTATCTTTA CTAAGAATGACAA GAACCATTT GATCAAGAAGGATGT CCCCTGCGAGACTGATCAGC TGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAA TCTGG CAGCATCTA CGAGCACTGGGATATTC TGCCTCCGAAGCAAATCAA GGACCCAGAAGCTAAGAAGC CAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGA GGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACTGGGATGATGAGGAAG ATGGTGAGTGGACTGCACCAACCATTCCTAACCCTGAGTACAAGGGACCATGGAAagc                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB671517             [                                                                                                                                                  GCCGGCCAGG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTGCTTGGT GGTGATGTTGACCAGAAGAAATTT GGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCA CCAAGAAGGTCCATACTATCTTTA CTAAGAATGACAA GAACCATTT GATCAAGAAGGATGT CCCCTGCGAGACTGATCAGC TGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAA TCTGG CAGCATCTA CGAGCACTGGGATATTC TGCCTCCGAAGCAAATCAA GGACCCAGAAGCTAAGAAGC CAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGA GGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACTGGGATGATGAGGAAG ATGGTGAGTGGACTGCACCAACCATTCCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCCTAACTACCAAGGCAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCCATACATC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL AU078600             [                                                                                                                                                          GG TCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATC TGGGAAGTGGAATGGAGATCCTNAGGACAAAGGTATCCAAACCTCTNAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGTGGGATATGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CF324022             [                                                                                                                                                                                                                                                                                                                                          gGCGGAGTACCCAGAA TTCAGCAACAAGGATAAAACCC T GGTGC TGCAGTTCTCTGTAAAGCATGAGCAAAAGC TTGACTGTGGTGGT GGATATGTCAAGTTGCTTGGT GGTGATGTTGACCAGAAGAAATTT GGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCA CCAAGAAGGTCCATACTATCTTTA CTAAGAATGACAA GAACCATTT GATCAAGAAGGATGT CCCCTGCGAGACTGATCAGC TGTCCCATGTGTACAATGTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAA TCTGG CAGCATCTA CGAGCACTGGGATATTC TGCCTCCGAAGCAAATCAA GGACCCAGAAGCTAAGAAGC CAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGA GGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL AU094067             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCTGTGGNTACAGCACCCAAGAAGGTCNATACTATCTTTA CTAAGNATGACAAGGAACCATTT GATCAAGAAGGATGTCCCCCTGCGAGACTGATCAGC TGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAA TCTGG CAGCATCTA CGAGCACTGGGATATTC TGCCTCCGAAGCAAATCAA GGACCCAGAAGCTAAGAAGC CAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGA GGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACTGGGATGATGAGGAAG ATGGTGAGTGGACTGCACCAACCATTCCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAA CCCTAACTACCAAGGCAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCCATACATCTATGCTTTTGACAGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTCTGTTTGACAACTTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CF322636             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATCTTTA CTAAGAATGACAA GAACCATTT GATCAAGAAGGATGT CCCCTGCGAGACTGATCAGC TGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAA TCTGG CAGCATCTA CGAGCACTGGGATATTC TGCCTCCGAAGCAAATCAA GGACCCAGAAGCTAAGAAGC CAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGA GGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACTGGGATGATGAGGAAGAATGGTGAGTGGACTGCACCAACCATTCCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAA CCCTAACTACCAAGGCAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCCATACATCTATGCTTTTGACAGCCTGAAGTACATT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CF322858             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTA CTAAGAATGACAA GAACCATTT GATCAAGAAGGATGT CCCCTGCGAGACTGATCAGC TGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAA TCTGG CAGCATCTA CGAGCACTGGGATATTC TGCCTCCGAAGCAAATCAA GGACCCAGAAGCTAAGAAGC CAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGA GGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACTGGGATGATGAGGAAGAATGGTGAGTGGACTGCACCAACCATTCCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAA CCCTAACTACCAAGGCAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCCATACATCTATGCTTTTGACAGCCTGAAGTACAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL AU166115             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGNCAATGTTGAG ACCAA TTTGGCCAGCNTCTACCGACCACTGGGATATTC TGCCTCCGAAGCAAATCAA GGACCCAGAAGCTAAGAAGCNCAGAGGACTGGGATGACAAGGAGTACATTCCTGNCCCTGA GGACAAGAAGCCTGAGGGATNCGATGATATTCCCAAGGAAATCCCTGNCCCTGATGCTAAGAAGCCTGAGGACTGGGATGATGAGGAAG ATGGTGAGTGGACTGCACCAACCATTCCTAACCCTGAGTACAAGGGNCCATGGAAGCAAAAGAAAATCAAGAA CCCTAACTACCAAGGCAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCCATACATCTATGCTTTTGACAGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTCTGTTTGACAACTTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL AU184277             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGAGTACATTCCTGACCCTGA GGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACTGGGATGATGAGGAAG ATGGTGAGTGGACTGCACCAACCATTCCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAA CCCTAACTACCAAGGCAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCCATACATCTATGCTTTTGACAGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTCTGTTTGACAACTTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]


>consensus_17382#0 AAAAAAAAAAAAAAAAAAAAACGGGAGATTGGATCGGAAGCTTCTAGAAGTTTCCGTGGG CGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTCGCGCTGGCGCTCG CGCTGGCGTCCGTCGCCGCTGTCGCCGGCGAGGTCTTCTTCCAGGAGAAGTTCGAAGATG GATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAAT GGAACCACACATCTGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTG AGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAATTCAGCAACAAGGATAAAA CCCTGGTGCTGCAGTTCTCTGTAAAGCATGAGCAAAAGCTTGACTGTGGTGGTGGATATG TCAAGTTGCTTGGTGGTGATGTTGACCAGAAGAAATTTGGTGGGGACACACCGTACAGCA TTATGTTTGGACCAGACATCTGTGGGTACAGCACCAAGAAGGTCCATACTATCTTTACTA AGAATGACAAGAACCATTTGATCAAGAAGGATGTCCCCTGCGAGACTGATCAGCTGTCCC ATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTG AGAAGCAATCTGGCAGCATCTACGAGCACTGGGATATTCTGCCTCCGAAGCAAATCAAGG ACCCAGAAGCTAAGAAGCCAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGAGG ACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGA AGCCTGAGGACTGGGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATTCCTAACC CTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAAGGCAAAT GGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCCATACATCTATGCTTTTG ACAGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTCTGTTTGACA ACTTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCA AGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGG AAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGG ACAAGGCCGATGAGAAGGCTGACTCTGATGCAGAGGATGGCAAGGATTCTGATGATGAGA AGCATGTATGTAACACTCCTGCGTTTTCTTGATACCTTCTGGATTCTGGTGATGCATTTC CTGTTAACCTCCATGTGTCCTGATCACCGTCCTTCCTTTCCAGGATGAGCTCTAAGATGG TGAGGATGAAGAATGGAGGCCGCCTTCGCGACGATGCCAGGATTTGCTAGTTCTCCCATT GTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGACAAGAAAGTACTCTGTAGATGAGC ATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTCTCTGTAGTGTCATTTTTCCCACC ACAAGAAAAAGAACTGATAACTTATTGAACAAGAGA



consensusID : consensus_17382#1
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 36
consensus length = 1595
fasta sequence
                              [GCCGCGCTTCCGCCGCTGCAGCCGATACGGGAGATTGGATCGGAAGCTTCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGT-CGCGCTGGCGCTCGCGCTGGCGTCCGTCGCCGCTGTCGCCGGCGAGGTCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATCTGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAATTCAGCAACAAGGATAAAACCCTGGTGCTGCAGTTCTCTGTAAAGCATGAGC-AAAAGCTTGACTGTGG-TGGTGGATATGTCAAGTTGCTTGGTGGTGATGTTGACCAGAAGAAATTTGGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCACCAAGAAGGTCCATACTATCTTTACTAAGAATGACAAGAACCATTTGATCAAGAAGGATGTCCCCTGCGAGACTGATCAGCTGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAATCTGGCAGCATCTACGAGCACTGGGATATTCTGCCTCCGAAGCAAATCAAGGACCCAGAAGCTAAGAAGCCAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGAGGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACT-GGGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATT-CCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAAGG-CAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCC-ATACATCTATGCTTTTGACAG-CCTGAAGTACATTGG-CATTGAGTTGTG-GCAGGTC-AAATCAGGTACTCTGTTTGACAACTTCCTTATT-ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG--CCGATGAGAAGGC-TG-ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA-TGAGAAGCATGATGAGCTCTAAGATGGTGA-GGATGAAGAATGGAGGCCGCC-TTCGCGACGATGCCAGGA-TTTGCT-AG-TTCTCCCA-T-T-GTT-ATGAAGTTCCCTTTTT-C-GTGAT-CAGAAAC-TTGA-CA-A-GAAAGTA-CTCTGTA-GATGA-GCA-TTGC-TGAGGAACTTTAATTTGGTCTTTGTAGC-TCTCTCTGTAGTGTCATTTTTCCCACCA-CA-AGAAAAAGAACTGA-TAACTTATTGAACAAGAGAAATCTTTTGCACAAAAAAAAAAAAAAANAAA]

[+] EMBL AK065341             [GCCGCGCTTCCGCCGCTGCAGCCGATACGGGAGATTGGATCGGAAGCTTCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGT CGCGCTGGCGCTCGCGCTGGCGTCCGTCGCCGCTGTCGCCGGCGAGGTCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATCTGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAATTCAGCAACAAGGATAAAACCCTGGTGCTGCAGTTCTCTGTAAAGCATGAGC AAAAGCTTGACTGTGG TGGTGGATATGTCAAGTTGCTTGGTGGTGATGTTGACCAGAAGAAATTTGGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCACCAAGAAGGTCCATACTATCTTTACTAAGAATGACAAGAACCATTTGATCAAGAAGGATGTCCCCTGCGAGACTGATCAGCTGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAATCTGGCAGCATCTACGAGCACTGGGATATTCTGCCTCCGAAGCAAATCAAGGACCCAGAAGCTAAGAAGCCAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGAGGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACT GGGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATT CCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAAGG CAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCC ATACATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAACTTATTGAACAAGAGAAAT                            ]
[+] EMBL OSR19501A            [                  CAGCCGATACGGGAGATTGGATCGGAAGCTTCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTNCGCGCTGGCGCTCGCGCTGGCGTCCGTCGCCGCTGTCGCCGGCGAGGTCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATCTGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTNAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAATTCAGCAACAAGGNTAAAACCCTGGTGCTGCAGTTCTCTNTAAAGCATGNGCAAAAAGTTTNACTTTGGTTGGTNGATAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL AK099348             [                           CGGGAGATTGGATCGGAAGCTTCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGT CGCGCTGGCGCTCGCGCTGGCGTCCGTCGCCGCTGTCGCCGGCGAGGTCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAATCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATCTGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAATTCAGCAACAAGGATAAAACCCTGGTGCTGCAGTTCTCTGTAAAGCATGAGC AAAAGCTTGACTGTGG TGGTGGATATGTCAAGTTGCTTGGTGGTGATGTTGACCAGAAGAAATTTGGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCACCAAGAAGGTCCATACTATCTTTACTAAGAATGACAAGAACCATTTGATCAAGAAGGATGTCCCCTGCGAGACTGATCAGCTGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAATCTGGCAGCATCTACGAGCACTGGGATATTCTGCCTCCGAAGCAAATCAAGGACCCAGAAGCTAAGAAGCCAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGAGGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACT GGGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATT CCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAAGG CAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCC ATACATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAACTTATTGAACAAGAGA                               ]
[+] EMBL AK104826             [                            GGGAGATTGGATCGGAAGCTTCTAGAAGTTTCCGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGT CGCGCTGGCGCTCGCGCTGGCGTCCGTCGCCGCTGTCGCCGGCGAGGTCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATCTGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAATTCAGCAACAAGGATAAAACCCTGGTGCTGCAGTTCTCTGTAAAGCATGAGC AAAAGCTTGACTGTGG TGGTGGATATGTCAAGTTGCTTGGTGGTGATGTTGACCAGAAGAAATTTGGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCACCAAGAAGGTCCATACTATCTTTACTAAGAATGACAAGAACCATTTGATCAAGAAGGATGTCCCCTGCGAGACTGATCAGCTGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACAATGTTGAGAAGCAATCTGGCAGCATCTACGAGCACTGGGATATTCTGCCTCCGAAGCAAATCAAGGACCCAGAAGCTAAGAAGCCAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGAGGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACT GGGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATT CCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAGGAACCCTAACTACCAAGG CAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCC ATACATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGGAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAA                                               ]
[+] EMBL AB021259             [                                              CTTCTAGAAGTTT CGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGT CGCGCTGGCGCTCGCGCTGGCGTCCGTCGCCGCTGTCGCCGGCGAGGTCTTCTTCCAGGAGAAGTTCGAAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTGGTGAATGGAACCACACATCTGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAACCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAATTCAGCAACAAGGATAAAACCCTGGTGCTGCAGTTCTCTGTAAAGCATGAGC AAAAGCTTGACTGTGG TGGTGGATATGTCAAGTTGCTTGGTGGTGATGTTGACCAGAAGAAATTTGGTGGGGACACACCGTACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCACCAAGAAGGTCCATACTATCTTTACTAAGAATGACAAGAACCATTTGATCAAGAAGGATGTCCCCTGCGAGACTGATCAGCTGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACAGCATACTTATTGACAATGTTGAGAAGCAATCTGGCAGCATCTACGAGCACTGGGATATTCTGCCTCCGAAGCAAATCAAGGACCCAGAAGCTAAGAAGCCAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGAGGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGG CTGGGGCTGATGAGGAAGATGGTGAGTGGACTGCACCAACCATC CGTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAGGG CAAATGGAAGCCGCCGATGATCGCCACCCCAGACTTCCAAGATGATCC TTACATCTACGCCTTTGACAG CCTGAAGTCCATTGG AATTGAGTTGTG GCAGGTC AAATCAGGGACTCTGTTTGACAACATTCTGATT ACTGACGATGCTGCTTTGGCCAAGACATTCGCAGAGGAGACATGGGCCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGCGTCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAACTTATTGAACAAGAGAAA        AAAAAAAAAAAAAActcna  ]
[+] EMBL CB634349             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGCACATCAAGGACCCAGAAGCTAAGAAGCCAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCCGAGGACAAGAAGCCTGAGGGATATGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACT GCGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATT CCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAAGG CAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCC ATACATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTTGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAG   CTCTCTGTAGTG                                                                                    ]
[-] EMBL CB656768             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGACCCAGAAGCTAAGAAGCCAGAGGACTGGGATGACAAGGAGTACATTCCTGACCCTGAGGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACT GGGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATT CCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAAGG CAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCC ATACATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCCCCA CA AGAAAAAGAACTGA TAAC                                              ]
[-] EMBL CB649260             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGTACATTCCTGACCCTGAGGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCTTGACCCTGATGCTAAGAAGCCTGAGGACT GGGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATT CCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAAGG CAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCC ATACATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAACTTATTGAACAAGAGAAAT                            ]
[-] EMBL CB659445             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGTACATTCCTGACCCTGAGGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACT GGGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATT CCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAAGG CAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCC ATACATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAACTTATTGAACAAGA                                 ]
[-] EMBL CB658930             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGTACATTCCTGACCCTGAGGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACT GGGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATT CCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAAGG CAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCC ATACATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAACTTATTGAACAAGAGAAATCTTTTGCACAAAAAAAAAga        ]
[-] EMBL CB634350             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACT GCGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATT CCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAAGG CAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCC ATACATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTTGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAG   CTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAAATGG TAGCTTATTGAACAAGAGAAATCTTTTGCACAAAAtataga         ]
[-] EMBL CB654929             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGATATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACT GGGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATT CCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAAGG CAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCC ATACATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAACTTATTGAA                                      ]
[-] EMBL CB656495             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTCCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACT GGGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATT CCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAAGG CAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCC ATACATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGAGTAACTTATTGAACAAGAGAAATCTTTTGCACAAAAAAAAAga        ]
[-] EMBL CB658929             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCAAGGAAATCCCTGACCCTGATGCTAAGAAGCCTGAGGACT GGGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATT CCTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAAGG CAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCC ATACATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTTTCTGTAGTGTCATTTTTCCCCCCA CA AGAAAAAGAACTGA TAAGGTATTGACCACGAGAAA                             ]
[-] EMBL CB669352             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCTGACCTTGATGCTAAGAAGCCTGAGGACT GGGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATT CCTAACCGTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCTTATCTACCAAGG CAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCC ATACATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGCCCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGCCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGT TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTTTAAGATGGTGA GGATGAAGAATGGAGGCCCCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCTCCC CA AGAAAAAGAAAGGA TAACTTATTGACCAAGAGAAATC TTTGCACAAAAAAgggg         ]
[-] EMBL CB671654             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATT CCTAACCCTGAGTACAAGGGGCCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAAGG CAAATGGAAGGCCCCGATGATTGACAACCCAGACTTCAAGGATGATCC ATACATTTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCCCAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATTAGGACAAGG  CCGATGAGAAGGC TG ACTTTGATGCAGAGGATGGCAAGGATTTTGATGA TGAGAAGCATGATGAGCTTTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCC T T GTT ATGAAGTTCCCTTTTT T GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTACGCCCCC CA AGAAAA                                                           ]
[+] EMBL AU093101             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACCATTCCCTAACCNTGAGT CCAGGG CCATGGAAGCAAAAGAAAATCAAG ACCCTAACTACCAAGG CAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCC ATACATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCNTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAACTTATTGAACAAGAGAAATCTTTTGCACAAAAA              ]
[+] EMBL C97614               [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGAAAATCAAG ACCCTAACTACCAAGG CAAATGGAAGGCACCGATGATCGAC ACCCAGACTTCAAGGATGATCC ATACATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAACTTATTGAACAAGAGAAAaa                           ]
[+] EMBL BI800089             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAA G CAAATGGAA GCACCGATGATCGACAACCCAGACTTCAAGGATGATCC ATACATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGAC ACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCCTTTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGGAGTTCCCTTTTT C GTGAT CAGAAAC TTGA C  A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAG   CTCTCTGTAGTGTCATTTTTCCCCCCA CC AGAAAAAGAACTGA TAGCTTATTGAAC AGAGAAATCTTTTGCACAAAA               ]
[+] EMBL AU166106             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGGCCAAATGGAAGNCACCGATGATCGACANCCNAGACTTCAAGGATGATCC ATACATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAACTTATTGAAAAAaaaa                               ]
[+] EMBL BM037940             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGACTTCAAGGATGACCCAATACATCTATGCTTTTGACAGCCCTGAAGTACATT G CA TGA TT T  GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGACCACA GAAAGTA CTCTGTA GATGA GCC TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCACCACAGAAAAAGAACTGA TAACTTATTGAACAAGAGAAATCTTTTGCAAAAAAAAAA           ]
[-] EMBL CF325741             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATCTATGCTTTTGACAG CCTGAAGTACATTGG CATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAACTTATTGAACAAGAGAAA        AAAAAAAAAAAAAAAAAcc  ]
[+] EMBL AU166101             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGACAN CCTGAAGTACATTGGCCATTGAGTTGTG GCAGGTC AAATCAGGTACTCTGTTTGAC ACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAANCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGNCGATGATGATTTGGATGNCGAGGATGCTGAGGNTGAGGACAAGG  CCGNTGAGAAGGC TG ACTNTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAACTTATTGAAAAAaaaa                               ]
[+] EMBL C73907               [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTG GCAGGTC AAATCAGGTACTCTGTTTGACAACTTCCTTATT ACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGCTTG ACTCTGATGCAGAGGATGGCAAGGATTCTNATGA TGAGAAGCATGATGAGCTCTAAGATGGTGAGGGATGAAGAATNGAGGCCGCC TTCGCGACGATGCCAGGATTTTGCTAAGTTTCTNCCA T T GTTAATGAAGTTCCCTTTTTNC GTGATCCAGAAACTTTGA CA AGGAAAGTA CTCTGTAGGATTAGGCATTTNCTTGAGGGACTTTAATTTtgg                                                                                                           ]
[+] EMBL BI807345             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGCGCA GTCAAAATCAGGTACTCTGTTTGACCACTTCCTTATTAACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACAT GGGCAAGCACAAGGATGCTGAGAA GCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGA GCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T TCGTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAACTTATTGAAC AGAGAAATCTTTTGCAAAAAA               ]
[+] EMBL AU058031             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAACTTATTGAAAAA                                   ]
[+] EMBL AU182031             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTNTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTNTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCNCCA CA AGAAAAAGAACTGA TAACTTATTGAACAAGAGAAATCTTTTGCACAAAAAA             ]
[+] EMBL AU184325             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTGAGAAGGCTGCTTTTGNCGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTNTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCNCCN CA AGAAAAAGAACTGA TAACTTATTGAACAAGAGAAATCTTTTGCNCAAAAAAAAAAA        ]
[+] EMBL AU068603             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTTTGACGAGGCAGAGAAAAAGNAGGAAGAGGAGGANGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAACTTATTGAACAAGAGAAATCTTTTGCACAAAAAAAAAA         ]
[-] EMBL CF326624             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAACTTATTGAACAAGAGAAATCTTTTGCACAAAAAAAAAAAAAAAAAAA]
[+] EMBL C74708               [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T Ttgt                                                                                                                                                                                                          ]
[+] EMBL AU078599             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGGTNAGNACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCNCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA N T GTT ATGAAGTTCCCTTTTN C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAACTTATTGAACAAGAGAAAaaaaa                        ]
[+] EMBL D43461               [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGG  CCGATGAGAAGGC TG ACTCTGATGCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTC                                                                                           ]
[+] EMBL BI807727             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        caaatgtgAAGGCACCGATGAGAAGTC TGTACTCTGATCCAGAGGATGGCAAGGATTCTGATGA TGAGAAGCATGATGAGCTCTAAGATGGTGA GGATGAAGAATGGAGGCCGCC TTTGCGACGATGCCAGGA TTTGCT AG TTCTCCCACTGT GTT ATGAAGTTCCCTTTTT CGGTGAT CAGAAAC TTGA CC A GAAAGTAGCTCTGTA GATGA GCC TTGC TGAGGAACTTTAATTTGGTCTTTGTAG   CTCTCTGTAGTGTCATTTTTCCCCCCA CC AG AAAAGAACTGA TAGCTTATTG ACCAGAGAAATCTTTTGCACCAAAAAAAAAA        ]
[-] EMBL AU108113             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCTGATGANTGAGAAGCATGATGAGCTCNAAGATGGTGA GGATGAAGNATGGAGGCCGCC TTCGCGACGATGCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGNTCCCTTTTN C GTGAT CAGAAAC TTGA CA A GAAAGTA CTCTGTA GATGA GCA TTGC TGAGGNNCTTTNATTTGGNCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA ANAAAAAGGACTGA TAACTTATTGAACAAGAGAAATCTTTTGCACAAAAAAAAANAA       ]
[-] EMBL CA757877             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAATGAAGGCGGCC TTCGCGACGATNCCAGGA TTTGCT AG TTCTCCCA T T GTT ATGAAGTTCCCTTTTT C GTGAT CAGAGAC TTGA CA A GNAAGTA CTCTGTA GATGA GCA TTGC TGAGGAACTTTAATTTGGTCTTTGTAGC TCTCTCTGTAGTGTCATTTTTCCCACCA CA AGAAAAAGAACTGA TAGCTTATTGAACAAGAGAAATCTTTTGCACAAAAAAAAANAANANNA  ]


>consensus_17382#1 GCCGCGCTTCCGCCGCTGCAGCCGATACGGGAGATTGGATCGGAAGCTTCTAGAAGTTTC CGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTCGCGCTGG CGCTCGCGCTGGCGTCCGTCGCCGCTGTCGCCGGCGAGGTCTTCTTCCAGGAGAAGTTCG AAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTG GTGAATGGAACCACACATCTGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAA CCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAATTCAGCAACAAGG ATAAAACCCTGGTGCTGCAGTTCTCTGTAAAGCATGAGCAAAAGCTTGACTGTGGTGGTG GATATGTCAAGTTGCTTGGTGGTGATGTTGACCAGAAGAAATTTGGTGGGGACACACCGT ACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCACCAAGAAGGTCCATACTATCT TTACTAAGAATGACAAGAACCATTTGATCAAGAAGGATGTCCCCTGCGAGACTGATCAGC TGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACA ATGTTGAGAAGCAATCTGGCAGCATCTACGAGCACTGGGATATTCTGCCTCCGAAGCAAA TCAAGGACCCAGAAGCTAAGAAGCCAGAGGACTGGGATGACAAGGAGTACATTCCTGACC CTGAGGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATG CTAAGAAGCCTGAGGACTGGGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATTC CTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAAG GCAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCCATACATCTATG CTTTTGACAGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTCTGT TTGACAACTTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACAT GGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAG AGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGG ATGAGGACAAGGCCGATGAGAAGGCTGACTCTGATGCAGAGGATGGCAAGGATTCTGATG ATGAGAAGCATGATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTCGCGAC GATGCCAGGATTTGCTAGTTCTCCCATTGTTATGAAGTTCCCTTTTTCGTGATCAGAAAC TTGACAAGAAAGTACTCTGTAGATGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAG CTCTCTCTGTAGTGTCATTTTTCCCACCACAAGAAAAAGAACTGATAACTTATTGAACAA GAGAAATCTTTTGCACAAAAAAAAAAAAAAANAAA



consensusID : consensus_17382#2
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 7
consensus length = 829
fasta sequence
                              [AAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCCATACATCTATGCTTTTGACAGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTCTGTTTGACAACTTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATG-ACGAGGATGCTGAGGATGAGGA-CAAGGCCGATGAGAAGGCTGACTCTGATG-CA-GAGGATGG-CAAGGATTCTGATGATGAGAAGCATGATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTTGCGACGATGCCAGGATTTGCTAGTTCTCCCA-TTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGACAAGAAAGTACTCTGTAGATGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAG--CTCTCTGTAGTGTCATTTTTCCCACCACAAGAAAAAGAACTGATAGCTTATTGAACAAGAGAAATCTTTTGCACAATCGCTCTGCATCCTGCTGTGATTGTATATGTGCTTGTGCCATTTCCCATTGTTTTGCCATAGGGAAAGCGTCTTCAGTCGTTACTCGTTAGGCACCTGGTCACCTATGGCATGGAGTCGAATCGATGAGAAGGCCGAGATAGAAATGCTGGGCAAGTTTGCGTTCCAAACTTCCAATGCCAAGTCTTTCTGGTTAATCAAAGAAATCCCTCACATTGCCTG]

[-] EMBL CB628321             [AAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCCATACATCTATGCTTTTGACAGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTCTGTTTGACAACTTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATG ACGAGGATGCTGAGGATGAGGA CAAGGCCGATGAGAAGGCTGACTCTGATG CA GAGGATGG CAAGGATTCTGATGATGAGAAGCATGATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTTGCGACGATGCCAGGATTTGCTAGTTCTCCCA TTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGACAAGAAAGTACTCTGTAGATGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAG  CTCTCTGTAGTGTCATTTTTCCCCCCACAAGAAAAAGAACTGATAGCTTATTGAACAAGAGAAATCTTTTGCACAATCGCTCTGCATCCTGCTGTGATTGTATATGTGCTTGTGCCATTTCCCATTGTTTTGCCATAGGGAAAGCGTCTTCAGTCGTTACTCGTTAGGCACCTGGTCACCTATGGCATGGAGTCGAATCGATGAGAAGGCCGAGATAGAAATGCTGGGCAAGTTTGCGTTCCAAACTTCCAATGCCAAGTC                                    ]
[+] EMBL OS1203A              [                ACAACCCAGACTTCAAGGATGATCCATACATCTATGCTTTTGACAGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTCTGTTTGACAACTTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATG ACGAGGATGCTGAGGATGAGGA CAAGGCCGATGAGAAGGCTGACTCTGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[-] EMBL CB671518             [                                                 ATGCTTTTGACAGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTTTGTTTGACAACTTCCTTATTTCTGGCGGCCCTGAGTTGGCCAAGACATTTGCAGAGGGGACATGGGGCAAGCACAAGGATGGTGAGAAGGGTGCTTTTGTCGGGGCAGAGAAAAAGAAGGAAGAGGGGGAAGCTGCCCAGGCCGGGGAGGGCGATGATGATTTGGATG ACGAGGATGCTGAGGATTAGGG CAAGGCCGATGAGAAGGGTGACTTTGATG CA GAGGATGG CAAGGATTTTGATGATGAGAAGCATGATGAGCTTTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTTGCGACGATGCCAGGATTTGGTAGTTTTCCCA TTGTTAAGAAGTTCCCTTTTTTGGGATCAGAAACT                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL BQ909256             [                                                                       CATTGGCA TGAGTTGT GCAGGTCAAATCAGGTACTCTGTTTGACAACTTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGTACGAGGATGCTGAGGATGAGGACCAAGGCCGATGAGAAGGCTGACTCTGATG CA GAGGATGG CAAGGATTCTGATGATGAGAAGCATGATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTTGCGACGATGCCAGGATTTGCTAGTTCTCCCA TTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGACAAGAAAGTACTCTGTAGATGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAG  CTCTCTGTAGTGTCATTTTTCCCACCACAAGCAAAAGAACTGATAGCTTATTGAACAAGAGAAAaaa                                                                                                                                                                                                                                      ]
[+] EMBL CA764750             [                                                                                                                                                                                        AGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATG ACGAGGATGCTGAGGATGAGGA CAAGGCCGATGAGAAGGCTGACTCTGATG CA GAGGATGG CAAGGATTCTGATGATGAGAAGCATGATGAGCCCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTTGCGACGATGCCAGGATTTGCTAGTTCTCCCA TTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGACAAGAAAGTACTCTGTAGATGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAG  CTCTCTGTAGTGTCATTTTTCCCACCACAAGAAAAAGAACTGATAGCTTATTGAACAAGAGAAATCTTTTGCACAATCGCTCTGCATCCTGCTGTGATTGTATATGTGCTTGTGCCATTTCCCATTGTTTTGCCATAGGGAAAGCGTCTTCAGTCGTTACTCGTTAGGCACCTGGTCACCTATGGCATGGAGTCGAATCGATGAGAAGGCCGAGATAGAAATGCTGGGCAAGTTTGCGTTCCAAACTTCCAATGCCAAGTCTTTCTGGTTAATCAAAGAAATCCCTCACATTGCCTG]
[+] EMBL BQ908309             [                                                                                                                                                                                                                                                                                                                    GATGAGAAGGCTGACTCTGATGCCACGAGGATGGCCAAGGATTCTGATGATGAGAAGCATGATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTTGCGACGATGCCCGGATTTGCTAGTTCTCCCACTTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGACAAGAAAGTACTCTGTAGATGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAG  CTCTCTGTAGTGTCATTTTTCCCACCACAAGAAAAAGAACTGATAGCTTATTGAAAAAAAAAA                                                                                                                                                                                                                                          ]
[+] EMBL OSR04881A            [                                                                                                                                                                                                                                                                                                                                                              TCTGATGATGAGAAGCATGATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTCGCGACGATGCCAGGATTTGCTAGTTCTCCCA TTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGACAAGAAAGTACTCTGTAGATGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTCTCTGTAGTGTCATTTTTCCCACCACAAGAAAAAGAACTGATAACTTATTGAACAAGAGAAATCTTTTGCACAATCGCTCTGCATCCTGCTGTGAT                                                                                                                                                                                                       ]


>consensus_17382#2 AAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCCATACATCTATGCTTTTGAC AGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTCTGTTTGACAAC TTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAG CACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAA GCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGAC AAGGCCGATGAGAAGGCTGACTCTGATGCAGAGGATGGCAAGGATTCTGATGATGAGAAG CATGATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTTGCGACGATGCCAG GATTTGCTAGTTCTCCCATTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGACAAG AAAGTACTCTGTAGATGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTCTGT AGTGTCATTTTTCCCACCACAAGAAAAAGAACTGATAGCTTATTGAACAAGAGAAATCTT TTGCACAATCGCTCTGCATCCTGCTGTGATTGTATATGTGCTTGTGCCATTTCCCATTGT TTTGCCATAGGGAAAGCGTCTTCAGTCGTTACTCGTTAGGCACCTGGTCACCTATGGCAT GGAGTCGAATCGATGAGAAGGCCGAGATAGAAATGCTGGGCAAGTTTGCGTTCCAAACTT CCAATGCCAAGTCTTTCTGGTTAATCAAAGAAATCCCTCACATTGCCTG



consensusID : consensus_17382#3
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 1
consensus length = 779
fasta sequence
                              [CGAGACAAGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGTAAATTCCTTCACCTTACAATGTTCTAATATGAGGATGATGGATGTACAACTGTCCTTGTCATTGCATTTCAGTCTGTGCTCCATTTCACTGTCTTTGCTATACGTTTTGATTTTTGTTGGCATGAACACCAGTTCCTTGATGATCAGTGGGCCATTGCTTCCACTTAATTATACTATGGTGTGCTCAAAACCTTTTAACTCACTGGCATGGTTATGTTATTTGTAGTTTTACGTATTATCTTCTGATTGTTACACCAGCATAGCTTTAAGCAACTGAAATATTCTCCTTTGCTGAACTGCCATCACTCGTGGTTATTGTGGATGTAATTTGCTTACCATTGATTATCAATGTCCTTGTTAACAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGGCCGATGAGAAGGCTGACTCTGATGCAGAGGATGGCAAGGATTCTGATGATGAGAAGCATGATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTTGCGACGATGCCAGGATTTGCTAGTTCTCCCATTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGACAAGAAAGTACTCTGTAGGTGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTCTGTAGTGTCATTTTTNCCACCACAAGAAAAAGAACTGATA]

[+] EMBL CA766773             [CGAGACAAGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGTAAATTCCTTCACCTTACAATGTTCTAATATGAGGATGATGGATGTACAACTGTCCTTGTCATTGCATTTCAGTCTGTGCTCCATTTCACTGTCTTTGCTATACGTTTTGATTTTTGTTGGCATGAACACCAGTTCCTTGATGATCAGTGGGCCATTGCTTCCACTTAATTATACTATGGTGTGCTCAAAACCTTTTAACTCACTGGCATGGTTATGTTATTTGTAGTTTTACGTATTATCTTCTGATTGTTACACCAGCATAGCTTTAAGCAACTGAAATATTCTCCTTTGCTGAACTGCCATCACTCGTGGTTATTGTGGATGTAATTTGCTTACCATTGATTATCAATGTCCTTGTTAACAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATGCTGAGGATGAGGACAAGGCCGATGAGAAGGCTGACTCTGATGCAGAGGATGGCAAGGATTCTGATGATGAGAAGCATGATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTTGCGACGATGCCAGGATTTGCTAGTTCTCCCATTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGACAAGAAAGTACTCTGTAGGTGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTCTGTAGTGTCATTTTTNCCACCACAAGAAAAAGAACTGATA]


>consensus_17382#3 CGAGACAAGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAA GAAGGAAGAGGAGGTAAATTCCTTCACCTTACAATGTTCTAATATGAGGATGATGGATGT ACAACTGTCCTTGTCATTGCATTTCAGTCTGTGCTCCATTTCACTGTCTTTGCTATACGT TTTGATTTTTGTTGGCATGAACACCAGTTCCTTGATGATCAGTGGGCCATTGCTTCCACT TAATTATACTATGGTGTGCTCAAAACCTTTTAACTCACTGGCATGGTTATGTTATTTGTA GTTTTACGTATTATCTTCTGATTGTTACACCAGCATAGCTTTAAGCAACTGAAATATTCT CCTTTGCTGAACTGCCATCACTCGTGGTTATTGTGGATGTAATTTGCTTACCATTGATTA TCAATGTCCTTGTTAACAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGA CGAGGATGCTGAGGATGAGGACAAGGCCGATGAGAAGGCTGACTCTGATGCAGAGGATGG CAAGGATTCTGATGATGAGAAGCATGATGAGCTCTAAGATGGTGAGGATGAAGAATGGAG GCCGCCTTTGCGACGATGCCAGGATTTGCTAGTTCTCCCATTGTTATGAAGTTCCCTTTT TCGTGATCAGAAACTTGACAAGAAAGTACTCTGTAGGTGAGCATTGCTGAGGAACTTTAA TTTGGTCTTTGTAGCTCTCTGTAGTGTCATTTTTNCCACCACAAGAAAAAGAACTGATA



consensusID : consensus_17382#4
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 1
consensus length = 524
fasta sequence
                              [TCAAGGATGATCCATACATCTATGCTTTTGACAGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTCTGTTTGACAACTTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATTCTGATGATGAGAAGCATGATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTTGCGACGATGCCAGGATTTGCTAGTTCTCCCATTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGACAAGAAAGTACTCTGTAGATGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTCTGTAGTGTCATTTTTCCCACCACCAAGAAAAGAACTGATAGCTTATTGAACAAGAGAAATCTTTTGCACAAAAAA]

[+] EMBL BM419852             [TCAAGGATGATCCATACATCTATGCTTTTGACAGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTCTGTTTGACAACTTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATGATTTGGATGACGAGGATTCTGATGATGAGAAGCATGATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTTGCGACGATGCCAGGATTTGCTAGTTCTCCCATTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGACAAGAAAGTACTCTGTAGATGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTCTGTAGTGTCATTTTTCCCACCACCAAGAAAAGAACTGATAGCTTATTGAACAAGAGAAATCTTTTGCACAAAAAA]


>consensus_17382#4 TCAAGGATGATCCATACATCTATGCTTTTGACAGCCTGAAGTACATTGGCATTGAGTTGT GGCAGGTCAAATCAGGTACTCTGTTTGACAACTTCCTTATTACTGACGACCCTGAGTTGG CCAAGACATTCGCAGAGGAGACATGGGGCAAGCACAAGGATGCTGAGAAGGCTGCTTTTG ACGAGGCAGAGAAAAAGAAGGAAGAGGAGGAAGCTGCCAAGGCCGGTGAGGACGATGATG ATTTGGATGACGAGGATTCTGATGATGAGAAGCATGATGAGCTCTAAGATGGTGAGGATG AAGAATGGAGGCCGCCTTTGCGACGATGCCAGGATTTGCTAGTTCTCCCATTGTTATGAA GTTCCCTTTTTCGTGATCAGAAACTTGACAAGAAAGTACTCTGTAGATGAGCATTGCTGA GGAACTTTAATTTGGTCTTTGTAGCTCTCTGTAGTGTCATTTTTCCCACCACCAAGAAAA GAACTGATAGCTTATTGAACAAGAGAAATCTTTTGCACAAAAAA



consensusID : consensus_17382#5
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 1
consensus length = 482
fasta sequence
                              [CATAAGCAATGTCCAAGAGAAACATATGGGGCCAAACCACAAGGAATGCCTGGAAGAAAGCTGCCTTTTGACGAAGCCAGGAGAAAAAAAGAAGGAAAGAGGGAGGAACCTTCCAAAGCCGGTGAGGACGGATGGATGATTTGGATGACGAGGATCTGAGGATGAGGACAAAGCCGATGAGAAGCTGACTCTGATCAGAGGATGCAAGGATTCTGATGATGGAGAAGCATGATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGCCCCTTTGCGACGATGCCAGGATTTGCTAGTTCTCCCACTTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTGACAAGAAAGTACTCTGTAGATGACCATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTCTGTAGTGTCATTTTTCCCACCACAAGAAAAAGAACTGATAGCTTATTGAACCAAGAGAAATCTGTTGCACAAAAAAAAAA]

[+] EMBL BI796386             [CATAAGCAATGTCCAAGAGAAACATATGGGGCCAAACCACAAGGAATGCCTGGAAGAAAGCTGCCTTTTGACGAAGCCAGGAGAAAAAAAGAAGGAAAGAGGGAGGAACCTTCCAAAGCCGGTGAGGACGGATGGATGATTTGGATGACGAGGATCTGAGGATGAGGACAAAGCCGATGAGAAGCTGACTCTGATCAGAGGATGCAAGGATTCTGATGATGGAGAAGCATGATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGCCCCTTTGCGACGATGCCAGGATTTGCTAGTTCTCCCACTTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTGACAAGAAAGTACTCTGTAGATGACCATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTCTGTAGTGTCATTTTTCCCACCACAAGAAAAAGAACTGATAGCTTATTGAACCAAGAGAAATCTGTTGCACAAAAAAAAAA]


>consensus_17382#5 CATAAGCAATGTCCAAGAGAAACATATGGGGCCAAACCACAAGGAATGCCTGGAAGAAAG CTGCCTTTTGACGAAGCCAGGAGAAAAAAAGAAGGAAAGAGGGAGGAACCTTCCAAAGCC GGTGAGGACGGATGGATGATTTGGATGACGAGGATCTGAGGATGAGGACAAAGCCGATGA GAAGCTGACTCTGATCAGAGGATGCAAGGATTCTGATGATGGAGAAGCATGATGAGCTCT AAGATGGTGAGGATGAAGAATGGAGCCCCTTTGCGACGATGCCAGGATTTGCTAGTTCTC CCACTTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTGACAAGAAAGTACTCTGTAGA TGACCATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTCTGTAGTGTCATTTTTCCC ACCACAAGAAAAAGAACTGATAGCTTATTGAACCAAGAGAAATCTGTTGCACAAAAAAAA AA



consensusID : consensus_17382#6
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 1
consensus length = 169
fasta sequence
                              [TCGGCCGAGCCTGAATACTTGGCATTGAGTTGTGGCAGGTCAAATCAGGTNCTCTGTTTGACAACTTCCTTATTACTGACGACCCTCAGTTGGCCNAGACATTCNCNNANGANACATGGGGCNAGCACCAGGGATGCTGAGAANGCTGCTTTTGACNANGCCGAAAAAA]

[+] EMBL BE229634             [TCGGCCGAGCCTGAATACTTGGCATTGAGTTGTGGCAGGTCAAATCAGGTNCTCTGTTTGACAACTTCCTTATTACTGACGACCCTCAGTTGGCCNAGACATTCNCNNANGANACATGGGGCNAGCACCAGGGATGCTGAGAANGCTGCTTTTGACNANGCCGAAAAAA]


>consensus_17382#6 TCGGCCGAGCCTGAATACTTGGCATTGAGTTGTGGCAGGTCAAATCAGGTNCTCTGTTTG ACAACTTCCTTATTACTGACGACCCTCAGTTGGCCNAGACATTCNCNNANGANACATGGG GCNAGCACCAGGGATGCTGAGAANGCTGCTTTTGACNANGCCGAAAAAA



consensus multiple alignement with clustalw

CLUSTAL W (1.82) multiple sequence alignment


consensus_17382#0      ------AAAAAAAAAAAAAAAAAAAAACGGGAGATTGGATCGGAAGCTTCTAGAAGTTTC 54
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      GCCGCGCTTCCGCCGCTGCAGCCGATACGGGAGATTGGATCGGAAGCTTCTAGAAGTTTC 60
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      ------------------------------------------------------------
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ------------------------------------------------------------
                                                                                   

consensus_17382#0      CGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTCGCGCTGG 114
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      CGTGGGCGATGGCGATCCGCGCGAGGTCCTCCTCCTACGCCGCCGCGGCGGTCGCGCTGG 120
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      ------------------------------------------------------------
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ------------------------------------------------------------
                                                                                   

consensus_17382#0      CGCTCGCGCTGGCGTCCGTCGCCGCTGTCGCCGGCGAGGTCTTCTTCCAGGAGAAGTTCG 174
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      CGCTCGCGCTGGCGTCCGTCGCCGCTGTCGCCGGCGAGGTCTTCTTCCAGGAGAAGTTCG 180
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      ------------------------------------------------------------
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ------------------------------------------------------------
                                                                                   

consensus_17382#0      AAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTG 234
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      AAGATGGATGGGAAAGTCGGTGGGTCAAGTCAGAATGGAAGAAGGATGAGAACATGGCTG 240
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      ------------------------------------------------------------
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ------------------------------------------------------------
                                                                                   

consensus_17382#0      GTGAATGGAACCACACATCTGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAA 294
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      GTGAATGGAACCACACATCTGGGAAGTGGAATGGAGATCCTGAGGACAAAGGTATCCAAA 300
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      ------------------------------------------------------------
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ------------------------------------------------------------
                                                                                   

consensus_17382#0      CCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAATTCAGCAACAAGG 354
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      CCTCTGAGGACTACAGGTTCTACGCTATTTCAGCGGAGTACCCAGAATTCAGCAACAAGG 360
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      ------------------------------------------------------------
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ------------------------------------------------------------
                                                                                   

consensus_17382#0      ATAAAACCCTGGTGCTGCAGTTCTCTGTAAAGCATGAGCAAAAGCTTGACTGTGGTGGTG 414
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      ATAAAACCCTGGTGCTGCAGTTCTCTGTAAAGCATGAGCAAAAGCTTGACTGTGGTGGTG 420
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      ------------------------------------------------------------
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ------------------------------------------------------------
                                                                                   

consensus_17382#0      GATATGTCAAGTTGCTTGGTGGTGATGTTGACCAGAAGAAATTTGGTGGGGACACACCGT 474
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      GATATGTCAAGTTGCTTGGTGGTGATGTTGACCAGAAGAAATTTGGTGGGGACACACCGT 480
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      ------------------------------------------------------------
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ------------------------------------------------------------
                                                                                   

consensus_17382#0      ACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCACCAAGAAGGTCCATACTATCT 534
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      ACAGCATTATGTTTGGACCAGACATCTGTGGGTACAGCACCAAGAAGGTCCATACTATCT 540
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      ------------------------------------------------------------
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ------------------------------------------------------------
                                                                                   

consensus_17382#0      TTACTAAGAATGACAAGAACCATTTGATCAAGAAGGATGTCCCCTGCGAGACTGATCAGC 594
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      TTACTAAGAATGACAAGAACCATTTGATCAAGAAGGATGTCCCCTGCGAGACTGATCAGC 600
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      ------------------------------------------------------------
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ------------------------------------------------------------
                                                                                   

consensus_17382#0      TGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACA 654
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      TGTCCCATGTGTACACTTTGATCATCCATCCTGATGCTACATACACCATACTTATTGACA 660
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      ------------------------------------------------------------
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ------------------------------------------------------------
                                                                                   

consensus_17382#0      ATGTTGAGAAGCAATCTGGCAGCATCTACGAGCACTGGGATATTCTGCCTCCGAAGCAAA 714
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      ATGTTGAGAAGCAATCTGGCAGCATCTACGAGCACTGGGATATTCTGCCTCCGAAGCAAA 720
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      ------------------------------------------------------------
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ------------------------------------------------------------
                                                                                   

consensus_17382#0      TCAAGGACCCAGAAGCTAAGAAGCCAGAGGACTGGGATGACAAGGAGTACATTCCTGACC 774
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      TCAAGGACCCAGAAGCTAAGAAGCCAGAGGACTGGGATGACAAGGAGTACATTCCTGACC 780
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      ------------------------------------------------------------
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ----------------------------------------CGAGACAAGGGGCAAGCACA 20
                                                                                   

consensus_17382#0      CTGAGGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATG 834
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      CTGAGGACAAGAAGCCTGAGGGATACGATGATATTCCCAAGGAAATCCCTGACCCTGATG 840
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      ------------------------------------------------------------
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      AGGATGCTGAGAAGGCTGCTTTTGACGAGGCAGAGAAAAAGAAGGAAGAGGAGGTAAATT 80
                                                                                   

consensus_17382#0      CTAAGAAGCCTGAGGACTGGGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATTC 894
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      CTAAGAAGCCTGAGGACTGGGATGATGAGGAAGATGGTGAGTGGACTGCACCAACCATTC 900
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      ------------------------------------------------------------
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      CCTTCACCTTACAATGTTCTAATATGAGGATGATGGATGTACAACTGTCCTTGTCATTGC 140
                                                                                   

consensus_17382#0      CTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAAG 954
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      CTAACCCTGAGTACAAGGGACCATGGAAGCAAAAGAAAATCAAGAACCCTAACTACCAAG 960
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      ------------------------------------------------------------
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ATTTCAGTCTGTGCTCCATTTCACTGTCTTTGCTATACGTTTTGATTTTTGTTGGCATGA 200
                                                                                   

consensus_17382#0      GCAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCCATACATCTATG 1014
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      GCAAATGGAAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCCATACATCTATG 1020
consensus_17382#4      ------------------------------------TCAAGGATGATCCATACATCTATG 24
consensus_17382#2      --------AAGGCACCGATGATCGACAACCCAGACTTCAAGGATGATCCATACATCTATG 52
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ACAC---CAGTTCCTTGATGATCAGTGGGCCATTGCTTCCACTTAATT-ATACTATGGTG 256
                                                                                   

consensus_17382#0      CTTTTGACAGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTCTGT 1074
consensus_17382#6      --TCGGCCGAGCCTGAATAC-TTGGCATTGAGTTGTGGCAGGTCAAATCAGGTNCTCTGT 57
consensus_17382#1      CTTTTGACAGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTCTGT 1080
consensus_17382#4      CTTTTGACAGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTCTGT 84
consensus_17382#2      CTTTTGACAGCCTGAAGTACATTGGCATTGAGTTGTGGCAGGTCAAATCAGGTACTCTGT 112
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      TGCTCAAAACCTTTTAACTCACTGGCAT--GGTTATGTTATTTGTAGTTTTACGTATTAT 314
                                                                                   

consensus_17382#0      TTGACAACTTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACAT 1134
consensus_17382#6      TTGACAACTTCCTTATTACTGACGACCCTCAGTTGGCCNAGACATTCNCNNANGANACAT 117
consensus_17382#1      TTGACAACTTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACAT 1140
consensus_17382#4      TTGACAACTTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACAT 144
consensus_17382#2      TTGACAACTTCCTTATTACTGACGACCCTGAGTTGGCCAAGACATTCGCAGAGGAGACAT 172
consensus_17382#5      ---------------------------------CATAAGCAATGTCCAAGAGAAACATAT 27
consensus_17382#3      CTTCTGATTGTTACACCAGC-ATAGCTTTAAG-CAACTGAAATATTCTCCTTTGCTGAAC 372
                                                                *  * *           * 

consensus_17382#0      GGGGC--AAGCAC-AAGGATGCT---GAGAAGGCTGC-TTTTGACGAGGC----AGAGAA 1183
consensus_17382#6      GGGGC--NAGCACCAGGGATGCT---GAGAANGCTGC-TTTTGACNANGC----CGAAAA 167
consensus_17382#1      GGGGC--AAGCAC-AAGGATGCT---GAGAAGGCTGC-TTTTGACGAGGC----AGAGAA 1189
consensus_17382#4      GGGGC--AAGCAC-AAGGATGCT---GAGAAGGCTGC-TTTTGACGAGGC----AGAGAA 193
consensus_17382#2      GGGGC--AAGCAC-AAGGATGCT---GAGAAGGCTGC-TTTTGACGAGGC----AGAGAA 221
consensus_17382#5      GGGGCCAAACCACAAGGAATGCCTGGAAGAAAGCTGCCTTTTGACGAAGCCAGGAGAAAA 87
consensus_17382#3      T--GC--CATCACTCGTGGTTATT--GTGGATGTAATTTGCTTACCATTG-----ATTAT 421
                          **   * ***      *        * * *     *  * ** *           * 

consensus_17382#0      AAAGAAGGAAGA--GGAGGAAGCTGCCAAGGCCGGTGAGGACGAT--GATGATTTGGATG 1239
consensus_17382#6      AA---------------------------------------------------------- 169
consensus_17382#1      AAAGAAGGAAGA--GGAGGAAGCTGCCAAGGCCGGTGAGGACGAT--GATGATTTGGATG 1245
consensus_17382#4      AAAGAAGGAAGA--GGAGGAAGCTGCCAAGGCCGGTGAGGACGAT--GATGATTTGGATG 249
consensus_17382#2      AAAGAAGGAAGA--GGAGGAAGCTGCCAAGGCCGGTGAGGACGAT--GATGATTTGGATG 277
consensus_17382#5      AAAGAAGGAAAGAGGGAGGAACCTTCCAAAGCCGGTGAGGACGGATGGATGATTTGGATG 147
consensus_17382#3      CAATGTCCTTGTTAACAGGAAGCTGCCAAGGCCGGTGAGGACGAT--GATGATTTGGATG 479
                        *                                                          

consensus_17382#0      ACGAGGATGCTGAGGATGAGGACAAGGCCGATGAGAAGGCTGACTCTGATGCAGAGGATG 1299
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      ACGAGGATGCTGAGGATGAGGACAAGGCCGATGAGAAGGCTGACTCTGATGCAGAGGATG 1305
consensus_17382#4      ACGAGGAT---------------------------------------------------- 257
consensus_17382#2      ACGAGGATGCTGAGGATGAGGACAAGGCCGATGAGAAGGCTGACTCTGATGCAGAGGATG 337
consensus_17382#5      ACGAGGAT-CTGAGGATGAGGACAAAGCCGATGAGAAG-CTGACTCTGAT-CAGAGGATG 204
consensus_17382#3      ACGAGGATGCTGAGGATGAGGACAAGGCCGATGAGAAGGCTGACTCTGATGCAGAGGATG 539
                                                                                   

consensus_17382#0      GCAAGGATTCTGATGATG-AGAAGCATGTATGTAACACTCCTGCGTTTTCTTGATACCTT 1358
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      GCAAGGATTCTGATGATG-AGAAGCATG-------------------------------- 1332
consensus_17382#4      --------TCTGATGATG-AGAAGCATG-------------------------------- 276
consensus_17382#2      GCAAGGATTCTGATGATG-AGAAGCATG-------------------------------- 364
consensus_17382#5      -CAAGGATTCTGATGATGGAGAAGCATG-------------------------------- 231
consensus_17382#3      GCAAGGATTCTGATGATG-AGAAGCATG-------------------------------- 566
                                                                                   

consensus_17382#0      CTGGATTCTGGTGATGCATTTCCTGTTAACCTCCATGTGTCCTGATCACCGTCCTTCCTT 1418
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      ------------------------------------------------------------
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      ------------------------------------------------------------
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ------------------------------------------------------------
                                                                                   

consensus_17382#0      TCCAGGATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTCGCGACGATGCC 1478
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      ------ATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTCGCGACGATGCC 1386
consensus_17382#4      ------ATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTTGCGACGATGCC 330
consensus_17382#2      ------ATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTTGCGACGATGCC 418
consensus_17382#5      ------ATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGCCC--CTTTGCGACGATGCC 283
consensus_17382#3      ------ATGAGCTCTAAGATGGTGAGGATGAAGAATGGAGGCCGCCTTTGCGACGATGCC 620
                                                                                   

consensus_17382#0      AGGATTTGCTAGTTCTCCCA-TTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGAC 1537
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      AGGATTTGCTAGTTCTCCCA-TTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGAC 1445
consensus_17382#4      AGGATTTGCTAGTTCTCCCA-TTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGAC 389
consensus_17382#2      AGGATTTGCTAGTTCTCCCA-TTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGAC 477
consensus_17382#5      AGGATTTGCTAGTTCTCCCACTTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACT-GAC 342
consensus_17382#3      AGGATTTGCTAGTTCTCCCA-TTGTTATGAAGTTCCCTTTTTCGTGATCAGAAACTTGAC 679
                                                                                   

consensus_17382#0      AAGAAAGTACTCTGTAGATGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTC 1597
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      AAGAAAGTACTCTGTAGATGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTC 1505
consensus_17382#4      AAGAAAGTACTCTGTAGATGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTC 449
consensus_17382#2      AAGAAAGTACTCTGTAGATGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTC 537
consensus_17382#5      AAGAAAGTACTCTGTAGATGACCATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTC 402
consensus_17382#3      AAGAAAGTACTCTGTAGGTGAGCATTGCTGAGGAACTTTAATTTGGTCTTTGTAGCTCTC 739
                                                                                   

consensus_17382#0      TCTGTAGTGTCATTTTTCCCACCACAAGAAAAAGAACTGATAACTTATTGAAC-AAGAGA 1656
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      TCTGTAGTGTCATTTTTCCCACCACAAGAAAAAGAACTGATAACTTATTGAAC-AAGAGA 1564
consensus_17382#4      T--GTAGTGTCATTTTTCCCACCACCAAGAAAAGAACTGATAGCTTATTGAAC-AAGAGA 506
consensus_17382#2      T--GTAGTGTCATTTTTCCCACCACAAGAAAAAGAACTGATAGCTTATTGAAC-AAGAGA 594
consensus_17382#5      T--GTAGTGTCATTTTTCCCACCACAAGAAAAAGAACTGATAGCTTATTGAACCAAGAGA 460
consensus_17382#3      T--GTAGTGTCATTTTTNCCACCACAAGAAAAAGAACTGATA------------------ 779
                                                                                   

consensus_17382#0      ------------------------------------------------------------
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      AATCTTTTGCACAAAAAAAAAAAAAAANAAA----------------------------- 1595
consensus_17382#4      AATCTTTTGCACAAAAAA------------------------------------------ 524
consensus_17382#2      AATCTTTTGCACAATCGCTCTGCATCCTGCTGTGATTGTATATGTGCTTGTGCCATTTCC 654
consensus_17382#5      AATCTGTTGCACAAAAAAAAAA-------------------------------------- 482
consensus_17382#3      ------------------------------------------------------------
                                                                                   

consensus_17382#0      ------------------------------------------------------------
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      ------------------------------------------------------------
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      CATTGTTTTGCCATAGGGAAAGCGTCTTCAGTCGTTACTCGTTAGGCACCTGGTCACCTA 714
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ------------------------------------------------------------
                                                                                   

consensus_17382#0      ------------------------------------------------------------
consensus_17382#6      ------------------------------------------------------------
consensus_17382#1      ------------------------------------------------------------
consensus_17382#4      ------------------------------------------------------------
consensus_17382#2      TGGCATGGAGTCGAATCGATGAGAAGGCCGAGATAGAAATGCTGGGCAAGTTTGCGTTCC 774
consensus_17382#5      ------------------------------------------------------------
consensus_17382#3      ------------------------------------------------------------
                                                                                   

consensus_17382#0      -------------------------------------------------------
consensus_17382#6      -------------------------------------------------------
consensus_17382#1      -------------------------------------------------------
consensus_17382#4      -------------------------------------------------------
consensus_17382#2      AAACTTCCAATGCCAAGTCTTTCTGGTTAATCAAAGAAATCCCTCACATTGCCTG 829
consensus_17382#5      -------------------------------------------------------
consensus_17382#3      -------------------------------------------------------
                                                                              




Copyright Mon Feb 16 12:49:02 CET 2004 Hubert Wassner    (hubert.wassner@noos.fr)