Home
Who am I
Technology
EST Assembly
Contact

These datas are free for academic use only, please contact me for any other use.

Oryza sativa
cluster # 17778 cluster # 17778       Sequences # 700       consensus # 35


see consensus multiple alignment with clustalw

Direct access to contigs :
consensus_17778#0 length = 1631 sequences # 368  
consensus_17778#1 length = 1331 sequences # 6  
consensus_17778#2 length = 1069 sequences # 37  
consensus_17778#3 length = 811 sequences # 102  
consensus_17778#4 length = 795 sequences # 3  
consensus_17778#5 length = 788 sequences # 9  
consensus_17778#6 length = 777 sequences # 7  
consensus_17778#7 length = 755 sequences # 1  
consensus_17778#8 length = 750 sequences # 8  
consensus_17778#9 length = 750 sequences # 124  
consensus_17778#10 length = 643 sequences # 5  
consensus_17778#11 length = 610 sequences # 2  
consensus_17778#12 length = 610 sequences # 1  
consensus_17778#13 length = 605 sequences # 1  
consensus_17778#14 length = 564 sequences # 1  
consensus_17778#15 length = 553 sequences # 2  
consensus_17778#16 length = 535 sequences # 2  
consensus_17778#17 length = 503 sequences # 1  
consensus_17778#18 length = 473 sequences # 4  
consensus_17778#19 length = 399 sequences # 1  
consensus_17778#20 length = 380 sequences # 1  
consensus_17778#21 length = 332 sequences # 1  
consensus_17778#22 length = 309 sequences # 1  
consensus_17778#23 length = 304 sequences # 1  
consensus_17778#24 length = 258 sequences # 1  
consensus_17778#25 length = 254 sequences # 1  
consensus_17778#26 length = 225 sequences # 1  
consensus_17778#27 length = 225 sequences # 1  
consensus_17778#28 length = 220 sequences # 1  
consensus_17778#29 length = 198 sequences # 1  
consensus_17778#30 length = 196 sequences # 1  
consensus_17778#31 length = 175 sequences # 1  
consensus_17778#32 length = 160 sequences # 1  
consensus_17778#33 length = 153 sequences # 1  
consensus_17778#34 length = 145 sequences # 1  

consensusID : consensus_17778#0
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 368
consensus length = 1631
fasta sequence
                              [CCGCCCACGCGTCCGCCCACGCGTCAGGAGA-GAGTCAGAGAGGA-G-GCG-T---G-TTGGTTAGCTCAT-TGGC-AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG-TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC-GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG-TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC-GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA-GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG-CCGTCCG-CCGC-GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG-CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG-CTGCTCGCCAACATCTA-CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC-GGCACC-GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC-GGCTCCGGCGTCTCCCTCG-TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC-GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT-CGAGACC-TACGT-C-TTCTCCATGTTC-AACGA-GAA-CCA-GAAGGACGCCGGC-GT-CG-AGCAG-AATTGGGGCCTC-TTC-TA-CCCCAACATGCAGCAC-GT-C-T-ACCCCA-TCAG-CTTCTGAT-GCA-T-TCCGT-AC-AC-ATA-TACGCAT-ACGTATGC-GTATACGTGACCG-CA-GGTAGTGTAG-TA-T-ACA-CG-T-AC-A-CGTACCT-GT-ACA--TT-A-C-A-GT-A-TTGT-A-CA-GA-GGG-C-TTGGC-TT-G-CG-A-CCG--C-TG-A-GA-GG---A-CA-C-GTA-CA-C-CA-AG-TGTA-C-G--TC-TG-TC-AGATG-C-GTACG-C-G-A-TAG-T-AT-A-TA-TA-TT-GGG-TATA-T-T-ATATATA-T-A-CCGTA-TTA-TTA-CGG-TA-TG-TATAG-AAGGGAAGC-TA-CA-GGTA-C-A-AAA-T-A--CGGT-ACG-CTGT-GGTAGGCGAA-TTAGCCCCCA-T---T-TTCC-C-T-T-CC-T-A-GA-TT-ACTA-T-T-A-CTATA-T-AGAGAGGG-TT-G-C-A-A-TATA-T-A-TA-CA-TG-TATATGTACGTA-CTTAGGAGGTGTATTTTGT-ACGT-A-CA-C--AG-ATTGTAATA-CTGTACA-TTTGTACG-CCGTACGTCGAGGTATTTT-G-CCTCA-CGTAGGCGTTTGAG-A-A-AA-A--AAAAG-AAAA-A-A-T---TTAAAA-GA-TTTTAAA------AA----AAAAAAAAACTCGAGG]

[+] EMBL OSS13321A            [CCGCCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGAGTGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTNCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGNCGGCGAGCTCGGTGGTGGGGATGTACCGNTCCAACGGCATCACGTCGATGCGGCTTTACGCGNCGGACCAGGCGGCGCTGCAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL AK121825             [                     aacaAGGAGA GACTCAGAGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCACGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TT                                 ]
[+] EMBL AK060867             [                         AGGAGA GACTCAGAGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTA                                                                                     ]
[+] EMBL BU667270             [                                ggGTCAGAGAGGA G GCG T   G  TGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGC TTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCG CGGCGGCGCCACGTCag                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CB642926             [                                     AGAGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCACGCGCTCCTCGCCGAGGACAGCCCG CCGTCCG CCGC GGAGTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB643002             [                                     AGAGACGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCATGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTACCCCCTACTTCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB675177             [                                     AGAGAGGA G CCT T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CB647593             [                                     AGAGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB673894             [                                     AGAGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB654144             [                                     AGAGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTAACCCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB675241             [                                     AGAGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB650058             [                                     AGAGACGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAAAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB645347             [                                     AGAGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB648201             [                                     AGAGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGGACC GT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB649667             [                                     AGAGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCACGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGACG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB644113             [                                      GAGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB675829             [                                      GAGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CB652020             [                                      GAGAGGA G GCG T   C TTTGTAAGATCAT TGGC ATCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTGTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGCGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGAACGCGCCGGACCACGCGGCGCTGCAGTCGGCGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCATGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGAGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCCCAGGCGCTCCTCACCGTGTACAGCCCG CCGTCCG CCGA GGAGTTCACCGGCGAGTCGCATGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCAG CTGCTCGCCAACATCTA CCCCTACTTCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB658444             [                                     acAGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGAGCGCCG CTGCTCGCCAACATCTA CCGCTACTTCTCCTACACCTACAGCCAGAGCAGCGTCGACGTCTCCTACGCGCTCTTCACC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB652124             [                                       AGAGGA C CCT T   G AGGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACTCGCCGGACCAGGCGGCGCTGCAGTCTGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAAGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCTCCGTGTACAGCACG CCGTCCG CCGC GGAGTTCACCGGCGAGTCACACGCGTTCATGGCG CCCGTCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB647675             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB666777             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGTGCAGCGTCGACGTCTCCTACGCGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB646460             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB674638             [                                       AGAGGA C GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB647655             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB660144             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB644423             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CB678331             [                                       AGAGGA GCGCT T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB675379             [                                       AGAGGA GCGCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CB642858             [                                       AGAGGA C GTG T   G ATGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGGGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB627809             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGGGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB650976             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACCGCGCCTACGGGTA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB648316             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CB646122             [                                       AGAGGC C G G T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCTTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCACGCGCTCCTCCCCGTGTACAGCCCG CCGTCCG CCGC AGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG GTGCTCGCCAACATCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB651322             [                                       AGAGGA G GCT T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB669093             [                                       AGAGGA G CCC T   T TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAAGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB649267             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB652611             [                                       AGAGGA G CCT T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGACTTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACCGGTCGTCCAGGACGcg                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB647488             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB649682             [                                       AGAGGA C GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGGCGCC GGCACC GTCGTCCAGGACGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB645015             [                                       AGAGGA C GCT T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB648794             [                                       AGAGG  C CCT T   G AAGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCGCCCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB650022             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB642154             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB649702             [                                       AGAGGACC GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGCCATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCAGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCACGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGAGTT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB643547             [                                       AGAGCA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CB649620             [                                       AGAGGA C GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB649729             [                                       AGAGGA C GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB647880             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CB647066             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB653548             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACCAACCACATCTCCTATATATAGCTCCTTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTATCCAAGGTGTAGCCTCCATGTTCCCTCTCTCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCCAACAACCTGCCGCCGGCAAGCTCGGGGGTGGGGATGTACCGCTCCAACGGCATCACGTCAATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB650583             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB627031             [                                       AGAGGA C CCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGGGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB651173             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB674447             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB651591             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB670436             [                                       AGAGGA C CCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB651262             [                                       AGAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB674758             [                                       AGAGGA C GTG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB648203             [                                       AGAGGA C GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB676805             [                                        GAGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB649339             [                                         AGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB649564             [                                         AGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCGTGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCAGGGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCATGCGTTCATGGCGACCCGGCCTGAGCTTCCTCGCCCGCACCGGCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CB655142             [                                         AGGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB676592             [                                          GGA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB634811             [                                          GGA G GGG C   G TTGGATAGCTCAT TGGA AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAACCTGAGAGAGGTTTTGAGAGAAATGGNTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTACGGGACGGCGGCCGACGGGAACGAGGTCGCCGGCGGAGCCAGGTCCA ACCTGGTCCCGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB675316             [                                          GGA G GCC T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB652649             [                                           GA G GCG C   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCCGGGCA C GTCGTCCAGGACGGCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CB652675             [                                           GA G GCG C   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAACCTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB658958             [                                           GA G GCC T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB642670             [                                           GA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CB652000             [                                           GA G GCGCC   C TTTG AAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB642607             [                                           GA G GCC C   T TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGACCTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB650116             [                                           GA G GCC T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB644039             [                                           GA G GCG T   G TTGGTTAGCTCAT TGGC AGCAG  CACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCA CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB671433             [                                           GA G GCC C   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB646792             [                                           GA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CB634723             [                                           GA G GCG C   C TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTCGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGGGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCCCAGGCGTTCATGGCG CCCGTCCTGAACT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB644213             [                                           GA G GCG C   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTACTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB625766             [                                           GA G GCG C   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGGGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAAGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CB650118             [                                           GA G GCC T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB673906             [                                           GA G GCG T   C TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTACCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCTATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAGGGTGACTACGTCCGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCATCGCCCGCACCGGCGCGCCA CTGCTCGGGAAAATC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB642943             [                                          aGA G CCG TAAAG ATGGTCAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTCGAAATAGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CB674230             [                                           GA G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB656781             [                                            A G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB678174             [                                            A G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB660839             [                                            A G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB656148             [                                              G GCG T   C TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB653292             [                                              G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB652596             [                                              G GCG T   G CTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CB672072             [                                              G GCG C   C CTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB654457             [                                              G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CB658909             [                                              G GCG C   G TTGGATAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCAG CTGCTCGCCAACATCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB658326             [                                              G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATCCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB677859             [                                              G GCC C   G TTGGTGAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGACAAATGGCTAGCCAAGGTGTAGCCTCCGTGTGCGCTCTCGCGTTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCACCCGGTGGGCGGCACGGGGATCAGCGTCATCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC ACCGGCCGGAACTAGGTCGCCGGCGGCGCCACGTCCAGGCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCACCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CB652305             [                                              G GCG T   G CTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB643350             [                                              G GCG C   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTTACCGCCGCC GGCACC G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB644532             [                                              G GCG C   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB627489             [                                              G GCG T   C TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGGGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB658032             [                                              G GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB685655             [                                                GCG C   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCACGCGTTCATGGCG CC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CB668855             [                                                GCG C   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB669336             [                                            g c GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB673083             [                                                GCG T   G TTGGCTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTACCCTCCATGTTCGCTCTCGCATTGCTCCTCGG GGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB674349             [                                                GCG T   GCCCGTTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAAGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CB662902             [                                                GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB656272             [                                                GCG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CB618246             [                                                 CG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGGGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB675243             [                                                 CG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB674746             [                                                 CG T   G TTCGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB651342             [                                                 CG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGAGCAGCGTCGACGTCTCCTACGCGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB618754             [                                                 CG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGGGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAAGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB618244             [                                                 CG T   G TCCGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGGGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB648052             [                                                 CG T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB675468             [                                                  G T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CB675509             [                                                  G T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCACAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CB668823             [                                                    T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCAGCGCGCCG CTGCTCGCCAACATCTA CGCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB650724             [                                                    T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB653517             [                                                    T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB650280             [                                                    T   G TTGCTTAACTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB654641             [                                                    T   G TTGGCTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB676355             [                                                    T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCCAGGCAGCGTCGACGTCTCCTACGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB668825             [                                                    T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB654698             [                                                cgc T   G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCAACGTCTCCTACACGCTCTTCACCGCCGCC GGGACC GTCGTCCAGGACGGCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CB658024             [                                                        G TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CB674405             [                                                        G TTGGTCATTTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB672923             [                                                        G TTGGTT CCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB657464             [                                                          TTGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB671376             [                                                           TGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB671214             [                                                           TGGTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCGCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCAgc                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB648571             [                                                           TGGTTACCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB657475             [                                                             GTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB642448             [                                                             GTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB656312             [                                                             GTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CB625840             [                                                             GTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGGGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB659361             [                                                             GTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB665916             [                                                             GTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGCTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCCATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCAGTGTCGCATGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTAATCTTCCTCGCCCGCACCGGCGCGCCG CTGCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB625784             [                                                             GTTAGCTCCT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGGGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB657082             [                                                             GTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CB654888             [                                                             GTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGTTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGAGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB651983             [                                                             GTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB657080             [                                                             GTTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB660339             [                                                              TTAGCTCCT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCATGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCGACATCTA CCCCTACTTCTCCTACACCTAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB656683             [                                                              TTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB660300             [                                                              TTAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACATCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCATGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCTACGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL AF323610             [                                                               TAGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCCTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA  GTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAA AAAA A A       AAAA AA     AAA      AA    AA              ]
[+] EMBL CB654524             [                                                                AGCTCATCTGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCTGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCACGCGTTCATGGCG CCCGACCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGGCGACGTCTCCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB654563             [                                                                AGCTCCT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB669139             [                                                              cttGCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTCCGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB665384             [                                                                 GCTCAT TCCT TTCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGACAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAAGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB657150             [                                                                  CTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTCAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCCGCATGGCCAAGCACGGC GG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB644940             [                                                             gtcccCTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB658688             [                                                                  CTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB654260             [                                                                  CTCAT CCCCTAGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACCGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCATCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACATCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACTACGTCTGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCACGCGTTCATGGCG CCCGTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB656360             [                                                                  CTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB668238             [                                                                  CTCAT TGGC AGCAGCACACACGAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCTATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCACAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCACCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB622950             [                                                                  CTCAT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGGGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGAC CCACCGTCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB669588             [                                                                  CTCAT TGCC ATCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGA CCATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB656736             [                                                                    CAT TGCC TGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CB656733             [                                                                    CAT TGCC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB676046             [                                                                     AT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB652388             [                                                                     AT TGGC CGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB658539             [                                                                     AT TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB631194             [                                                                      T TGGC AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGGGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB675858             [                                                                             AGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGCGGGCT CGGCGTCTCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB659125             [                                                                              GCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB654677             [                                                                                AGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCACGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACTTACAGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB678621             [                                                                                 GCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTCCAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCTCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCCCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB656556             [                                                                                       ACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CB652666             [                                                                                             CACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC CGAGTTCACCGGCGAGTCGCAAGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB661031             [                                                                                             CACATCTCCCATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGTGCGCCG CTGCTCGCCAACATCTA CCCCTACTTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB669353             [                                                                                                       ATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG GGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCAGCGGGGCTGGGCCACATCAACGTGACGACGTCGGTGTCCCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGAGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB644125             [                                                                                                             AGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CB643736             [                                                                                                                                                 TGAGAGCCATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB654443             [                                                                                                                                                      GAAATGCCTAGACAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB675795             [                                                                                                                                                      GAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB659612             [                                                                                                                                                               AGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCAGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCAGCGGGGCTGGGCCACATCAAGGTGACGACGTCAGAGTCGCAGGCGCTCCTCGCCGAGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCTCACGCGTTCATGGCG CCCGACCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGACAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGAC GGCACC GTCGTCCAGGACAGCGCCTACGGGTACCAGAACCTGTTCGACACCAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB655461             [                                                                                                                                                                    AGGTGCATTCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCCAGACGGCGCCTACGGGTACC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB670919             [                                                                                                                                                                          AGCCTCCATGTTCGCTCTCGCATTGCTCCTCGG TGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGGCAACG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB677604             [                                                                                                                                                                                                       TCGGCTGTCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCATGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB651668             [                                                                                                                                                                                                                                  AAGGCGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB670461             [                                                                                                                                                                                                                                      CGGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB651782             [                                                                                                                                                                                                                                       GGAGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCTCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAAACTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB652908             [                                                                                                                                                                                                                                         AGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB673940             [                                                                                                                                                                                                                                         AGGCGATC GGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAAACACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CB654032             [                                                                                                                                                                                                                                                       GTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB661855             [                                                                                                                                                                                                                                                             CGGCATCCGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB675983             [                                                                                                                                                                                                                                                                  TGAGCCCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB667642             [                                                                                                                                                                                                                                                                       GCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CB652058             [                                                                                                                                                                                                                                                                         GAACAACCCTCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGT GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCCCCGGGGGCATGTCCGCCTCGCCGGCCAACGCCC GGAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB654595             [                                                                                                                                                                                                                                                                          AACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB670194             [                                                                                                                                                                                                                                                                                                                           GCATCACGCCTATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGAGGAA CCA GAAGGACGCCGGC GT CG AGCAG AAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB653421             [                                                                                                                                                                                                                                                                                                                              TCACGTCCATTCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCCGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB662134             [                                                                                                                                                                                                                                                                                                                                           GCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGGGAGTCGCATGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACATCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCACAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGGCAAGCACGGC GGCTCCGGCGTCTCCCTCGATCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB654735             [                                                                                                                                                                                                                                                                                                                                                                                                GCGTCGCCTTCGGAGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAAGACGCCGGC GTCCG AGCAG AATTGGGGCCTC TTC TA CCCCAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB654106             [                                                                                                                                                                                                                                                                                                                                                                                                       CGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB644222             [                                                                                                                                                                                                                                                                                                                                                                                                         TCGGCGCTCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB659282             [                                                                                                                                                                                                                                                                                                                                                                                                           cGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCGTCCGTCCG CCGCTGGAGTTCACCGGCGAGTCTCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CACCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB657342             [                                                                                                                                                                                                                                                                                                                                                                                                                       GACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC G                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB656551             [                                                                                                                                                                                                                                                                                                                                                                                                                        ACGTCCTTTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGG TGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTC GCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCA GCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB651912             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCA GCCTCTTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCGACTGCTCGCCAACATCTA CCCCTACTTCTCCTACGGCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA Cn ag                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB621301             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACCGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GNG TATA T T                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB657570             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GNG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA G                                                                                                                                                                                                                                                                                                                                             ]
[+] EMBL CB668207             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT                                                                                                                                                                                                                                                                                                                        ]
[-] EMBL CB659126             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCTTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTTGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG A GGCGG C G A TAG T AT A TA TA TT GGG TATA T T ATAT                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL BE041066             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGATGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACCGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGCGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GG A TTGG A CA GA GGG C TTGGC TT G CG A CCG  C T                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB652513             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGCGCCCTTCGCCGTGTACAGCCCG CCGTCCG CCGC GGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCG CCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T TCCC T A GA  T ACTA T T A CTATA T AGAGAAGG TT G C A A TATA T A TA CA TG TA                                                                                                                                                                                               ]
[+] EMBL CB658902             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCTCCCTCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG GT G C A A TATA T A TA CA TG TAT                                                                                                                                                                                              ]
[+] EMBL CB659607             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCGCCCGCACCGGCGCGCCG CTGCTCGCCAACATCTA CCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG GT G C A A TATA T A TA CA TG TATATGTACGTA CTTACGAGGTGTA                                                                                                                                                                       ]
[-] EMBL CB667426             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A                                                                                                                                                                                                                    ]
[-] EMBL CB668824             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCGTGGACGTCTCNTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTTTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC G G GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A                                                                                                                                                                                                                    ]
[-] EMBL CB668826             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCGTCGACGTCTCNTACGCGCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA GG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T AC G A GA TT ACTA T T A CTATA T AGAG                                                                                                                                                                                                                                   ]
[+] EMBL CB657628             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTCTTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG A                                                         ]
[+] EMBL CB668879             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCACCGCCGCC GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCCACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTA                                                                                                      ]
[-] EMBL CB657083             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AAAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTA                                          ]
[-] EMBL CB652389             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTTTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTG                                                                             ]
[-] EMBL CB621302             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACCGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAg            ]
[-] EMBL CB654033             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTTTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTGGAGGTATTTT G CCTCA CGTAG                                                                                    ]
[-] EMBL CB658025             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTT                                                                               ]
[-] EMBL CB658033             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAG                                                                                    ]
[-] EMBL CB653293             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG                                                           ]
[-] EMBL CB656684             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTA                                                                                     ]
[-] EMBL CB667643             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CC GTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA GG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTAAGGGGAGGTATTTT G CCTCA CGTAGGCG TTGAGct t                                                                       ]
[-] EMBL CB653684             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGA                                                                            ]
[-] EMBL CB649621             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTAAAA      AA    AAAga           ]
[-] EMBL CB652650             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGAGGTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TT                                 ]
[-] EMBL CB651592             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTAGGTCGAGGTATTTT G CCTCA CGTAGGCGTTga                                                                             ]
[-] EMBL CB642671             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTAGGGG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAct      ta    aagga           ]
[-] EMBL CB656128             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATGTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTGTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAga            ]
[-] EMBL CB654444             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCG TGGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTAAAA      AA    AAga            ]
[-] EMBL CB649703             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCG TGGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTAAAA      AA    AAgg            ]
[-] EMBL CB671215             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TT                                 ]
[-] EMBL CB659283             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C A A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTGGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTT                                ]
[-] EMBL CB650584             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTA                                          ]
[-] EMBL CB658102             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTA                                          ]
[-] EMBL CB618247             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACCGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A TTTATTAAAA GA                                    ]
[-] EMBL CB668235             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TT                                           ]
[-] EMBL CB658959             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGAAGGAG A A AA A  AAAAG AAAA A A T   T                                            ]
[-] EMBL CB659362             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTT                               ]
[-] EMBL CB625841             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACCGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T C CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AGCATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGAAGGGG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTACAT      TA    AAAga           ]
[-] EMBL CB650023             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGGTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCATCCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACG TATGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT TG AGCAG AATTGGGGCCTT TTC TA CCCCAACATGCAGCAC GT G T ACCCCA TCAG TTTCTGAT GCA T TCCGT AC AC ATA TAGGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACTT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G TG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG T GTCCG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T C CCGTA TTA TTG CGG TA TG TATAG AAGGGAACC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CT T A GA TT AGTA T T A CTATA T AGAGAGGG TC G C A A TATA T A TT CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATC CT                                                                                                                                    ]
[-] EMBL CB670920             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTGGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTT                                ]
[-] EMBL CB656149             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTGGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAga           ]
[-] EMBL CB672924             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA T                                  ]
[-] EMBL CB671377             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTT                                ]
[-] EMBL CB658903             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAA A AGGA A  AAAAG AAAA A A T   TTAAAA GA TTTa                               ]
[-] EMBL CB675380             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAct      gc    tgcg            ]
[-] EMBL CB668856             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTGGGGAA A AA A  AAAAG AAAA A A T   TTAAAA GA TTTAAAA      AA    AAga            ]
[-] EMBL CB674747             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG    T A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTAAAA      AA    AAga            ]
[-] EMBL CB649340             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAG                                                                                    ]
[-] EMBL CB654699             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGAG GGGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TT                                 ]
[-] EMBL CB625785             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACCGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGATGGAG A A AA A  AAAAG AAAA A A T                                                ]
[-] EMBL CB627810             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACCGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTT TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTTTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CAGGGCA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCC CTAAGGGGTTTGAG A A AA A  AAA                                                             ]
[-] EMBL CB644416             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG G A AA A  AAAAG AAAA A A T   TTAAAA GA TTTAAAA      AA    AAAA            ]
[-] EMBL CB660147             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T                                                ]
[-] EMBL CB654642             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTTTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAgga           ]
[-] EMBL CB668957             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGC AAAGGG A A AA A  AAAAG AAAA A A T                                                ]
[-] EMBL CB654678             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGAGGGT AG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTAAAA      AA    AGAAAA          ]
[-] EMBL CB618245             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACCGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT T CCAAG GGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A TTC TTATAA Gg a                                  ]
[-] EMBL CB650117             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT GGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGTCGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT A T ACCCCA TCAG CTTGTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGG TT CA GGTA C A AAA T C  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T G CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT CCGT A CA C  AG ATTGTAATT CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGAGGTTGCG A C AA A  AAAAG Ac                                                        ]
[+] EMBL CB660273             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCAGGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TT                                           ]
[-] EMBL CB657629             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGGGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA T                                  ]
[-] EMBL CB658445             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTGGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTT                                ]
[-] EMBL CB675510             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG    T A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TT                                 ]
[-] EMBL CB657343             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTT                               ]
[-] EMBL CB658910             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT AGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTTTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG G A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      CT    TAAAAgga        ]
[-] EMBL CB656737             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGAGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTAAAA      AA    Aga             ]
[-] EMBL CB645346             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAg           ]
[-] EMBL CB644533             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTTTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGCCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A G AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAAAA         ]
[-] EMBL CB670195             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGAG GTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA T                                  ]
[-] EMBL CB649683             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTTTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTa                               ]
[-] EMBL CB634812             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACCGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAg           ]
[-] EMBL CB658689             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACT TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTGTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCAAGGGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTGAAAA      AA    AAgg            ]
[-] EMBL CB644299             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAAGCACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG G A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAA            ]
[-] EMBL CB627490             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACCGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ACA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTATG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATGTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAGG AAAA T A A   TGGAAA GA TT                                 ]
[-] EMBL CB644424             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGGC GGCTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTAAAA      AA    AAAAA           ]
[-] EMBL CB657081             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCCGGCGTCTCCCTCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AAAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTGGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTAAAA      AA    AAga            ]
[-] EMBL CB648592             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCG TCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATGTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTTTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTGGGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTAAAA      AA    Agga            ]
[-] EMBL CB651343             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTTTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGAG GGGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTAAAA      AA    Agga            ]
[-] EMBL CB644941             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTT TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCG GGGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTAAAA      AA    Aga             ]
[-] EMBL CB675984             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGAG GGGAGAA A AA A  AAAAG AAAA A A T   TTAAAA GA TT                                 ]
[-] EMBL CB648202             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGAG GGGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTCATA      AA    Agga            ]
[-] EMBL CB669382             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTGGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAga           ]
[-] EMBL CB657151             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCC GGATGTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACG TATGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG TTTCTGAT GCA T TCCGT AC AC ATA TACGCAT AGGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TG GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGG TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGAGAA TTAGCCCCCA T   T TTCC C T T CG T A GA TT AGTA T T A GTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTCCGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTGGAG A A AA A  AAAAG AAAA A A T   TTAAAA GACTTTTAAA      AAAAGGAAAAAAAAACTCGAGG]
[-] EMBL CB651783             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTCCGCCTCGCCGGCCAACGCCC GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGAGGTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA T                                  ]
[-] EMBL CB641598             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCGCCTCGCCGGCCAACGCCC GGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTT TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTTTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AGAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAAAAAAaa     ]
[-] EMBL CB642155             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCCTCGCCGGCCAACGCCC GGATGTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT GGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT G T ACCCCA TCAG ATTGTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGTC TT G CG A CCG  C TG A GA GG   A CA C GTA CC C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTC CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT AATA T T A CTATA T AGAGAGGG TT G C A A TATA T A TC CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAGAA A AA A  AAAAG AAAA A A T   TTAAAATGACTTTTAAA      AA    AAAAg           ]
[-] EMBL CB655177             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    C GGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCAT CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCG  AGGG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAga            ]
[+] EMBL BI807685             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 accctcGCCGCGGCAC CCGCGCCACCCCGGC CC T CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CGAACCAGTAATT GGGCCTC TTC TA CCCC ACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT  CA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG      A C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTTAA      AA    AA              ]
[+] EMBL BI806428             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          cgccaACCCGGCGCCACCCCCG GCCNT CGAGACC TACGT CTTTCTCCATGTTC ACCGA GNA CCA GAAGGA   CGGC GT CG A CAG AATTGGGCCCTCTTTC TA CCCC ACAT CAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTA GCGAA TTAGCCCCCA T   T TTCC T T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT   C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTAC  CCGTACGTCGAGGTATTTT   CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTCNAA GA TTTTAAA      AA                    ]
[+] EMBL BQ907156             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCCCGGCGCCATGCGAGACCGTACGTGC TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCC ACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A CTA GT A TTGT A C   A GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TTCACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A CC C  ANAAG AAAA A A T   TTAAAA GA TTTTAAA      AA                    ]
[-] EMBL CB665917             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCGCCAT CGAGACA TACGT C TTTTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC TT CG AGCAG CATTGGGGCCTC TTC TA CCCCAACATGCAGCCC GT C T ACCCCA TAAG CTTCAGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT C C A GT A TTGT A CA GA GGG C TTGGC TT G CG C CCC  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TG TG TC AGATG C GTACG C G A TAG T AT A TA TA TC GGG TATA T T ATATATA T A CCGTC CTA TTA CGG TA TG TATAG AAGGGAAGT TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGGGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T C CTATA T AGAGAGGG TT G C A A TATA T A TA CA GG TATATGTAGGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT A CCTCA CGTAGGCGTTGGGG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTCAA      AA    AAAAg           ]
[+] EMBL BI812269             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAT CGAGA C TACTT C TTCTCCATGTTC AACGA GAA CCA GAAGGACTCCGGCTTT CG AGCAG AATTGGGGCCTCTTTC TA CCCC ACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CC AGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG CTTTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CACC CA AG TGTA C G  TC TG TC AGATG C GTAC  C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTA GCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA TCT A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAGAA A AA A  AAAAG CAAA A A T   TTAAAA GA TTTTAAA      AA                    ]
[+] EMBL BQ907881             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAGACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCC ACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACGCC G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C ANAAA T A  CGGT ACGCCTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    A               ]
[+] EMBL BM418755             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACC TACGT C TTCTCCATGTTC AACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCC ACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAA             ]
[+] EMBL BM038179             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCAAACGA GAA CCAGGAAGGACGCCGGC GT CG AGCAG AATT GGGCCTC TTC TA CCCC ACATGCAGCAC GTGC T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T ACGA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTAC  CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A CC C  ACNAG AAAA A ANT   TTAAAA GA TTTAAAA      AA                    ]
[+] EMBL BM038676             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  C AACGA GAACCCA GAAGGACGCCGGC GT CG AGCAG AATT GGGCCTC TTC TA CCCC ACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TA  T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    A               ]
[-] EMBL CB667296             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACGA GAA CCA GAAGGACGCCGGC GT CG AGCAG AATTGGGGCCTC TTG TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTTTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G AG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTGGGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGC AGGGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AGAAA           ]
[+] EMBL BI813033             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCA GAAGGACGCCGGC GT CG AGCAG AATT  GGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT AC  CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA                    ]
[+] EMBL BQ906820             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CA GAAGGAC CCGGC GT CG AGCAG AATTGGGGCCTC TTC TA CCCC ACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTAC  CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BQ908617             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    aaGACGCCGGC GT CG AGCAG AATT GGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA                    ]
[+] EMBL BI813289             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAG AATTGGGGCCTCTTTC TA CCCC ACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTAC  C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAA             ]
[+] EMBL BM421858             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGCCTC TTC TA CCCCAACATGCAGCAC GT C T ACCCCA TCAGTCTTCTGAT GCA T TCCGT AC ACTATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C C A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACC CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG   A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAACCCCCCAA    AAAAAAAA        ]
[+] EMBL BM038411             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTTACCCCCAACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AN C  CAAAGAAAAA A A T   TTAAAA GA TTTTAAA      AA    A               ]
[+] EMBL BI813037             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TC TA CCCCTACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A CAA GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T   CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT GCC A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BI812136             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TA CCCCGACATGCAGCACTGT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACC  CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CACC  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BI813318             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAACATCCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A CAA GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C   A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTTAA      AA    AAA             ]
[+] EMBL BI807710             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT  CA T TCCGTGAC AC ATATTACGCAT ACGTATGC GTATACGTGACC  CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTTAA      AA    AAA             ]
[+] EMBL BM421571             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ccACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT ACCA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCACT   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTAC  CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  ANNAGCNAAA A A T   TTAAAA GA TTTAAAA      AA    AAAA            ]
[+] EMBL BM419778             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACGCCTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AA              ]
[+] EMBL BI812016             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCACT TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AA              ]
[+] EMBL BI812980             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTA GCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAA            ]
[+] EMBL BI812031             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTAAAA      AA                    ]
[+] EMBL BM420653             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGCAGCAC GT CNT ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATAGTACGCAT ACGTATGC GTATACGTGACCGCCA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACAC TT A C A GT A TTGT ACCACGA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C N AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTAC  CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AACC C A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BM421688             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACC  CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CANC CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT   C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTAC  CCGTACGTCGAGGTATTTT   CCTCA CGTAGGCGTTTGAG A A AA A  AANAG NAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BM038540             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGCAC GT N T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCC  T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CC C  AG ATTGTAATA CTGTACA TTTGTACN CCGTACGTCGAGGTATTTT   CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AA              ]
[+] EMBL BM421900             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCC T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  NCAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AA              ]
[+] EMBL BQ907774             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CACC CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA                    ]
[+] EMBL BI812029             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         tCAGCAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCC CACGGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACAC TT A C C GT A TTGT A CA GA GGG C TTGGC TT G CG A CC   C TG A GA GG   A CA C GTA CACC CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C C AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCACT   TGTTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CC C  AG ATTGTAATA CTGTACA TTTGTACC CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BM419674             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAC GT CTT ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    A               ]
[+] EMBL BM420823             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAC GT C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCGCCA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CACC CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTAC  CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AANC  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AA              ]
[+] EMBL BM418828             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  T C TNACCCCAGTCAG CTTCTGAT GCAGT TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT ANCACGA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C C AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTAAAA      AA    AAAA            ]
[+] EMBL BQ905935             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    C T ACCCCA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA CACA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A ACAA A  NAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAA             ]
[+] EMBL BI812811             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ta cCCCCA TCAG CTTCTGAT GCAGTGTCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TATT ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TTGG CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TACTT GGG TATA TGT ATATATA T C CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTACC T AAA TCA  CGGT ACC CTGT GGTAGGCGAA TTAGCCCCCA TG  T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TTCG C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BQ906492             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCA TCAG CTTCTGAT GCAGT TCCGT AC AC ATA NACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG ATCCG  C TG A GA GG   A CATC GTA CA C CA AG TGTA C GTTTC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T TCACCTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA C  CCCCN AAAA A A T   TTAATA GA TTTTGGA      AA                    ]
[+] EMBL BM038860             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CA TCAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACC  CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GTGA TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTTCG CCTCA CGTAGGCGTTTGAG A A AA ACCCAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA                    ]
[+] EMBL BI812355             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACC  CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA C  C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTA GCGAA TTAGCCCCC  T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CC C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAA             ]
[+] EMBL BM420708             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AG CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTAC  CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA                    ]
[+] EMBL BI812168             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  G CTTCTGAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CGCA CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCC T   T TTCC C T T CC T A GA TT ACTA T C A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATACCTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTTAA      AA    AAAAAA          ]
[+] EMBL BM421673             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  G CTTCTGATGGCA TGTCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTG CCG CA GTTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTAC  CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AACC  NAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA                    ]
[+] EMBL BM420104             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTCTGAT  CACT TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACC  CACGGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACAC TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CC   C TG A GA GG   A CA C GTA CACC CACAG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTACC A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCC T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTAC  CCGTACGTCGAGGTATTTT C CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BI813802             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAT GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA                            ]
[+] EMBL BI813128             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAT GCA T TCCGTGAC AC ATA TACGCAT ACGTATGC GTATACGTGACC  CC GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACC  TT ACC A GT A TTGT A CACGA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CC C CC AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T   CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C    AA T A  CGGT AC  CTGT GGTAGGCGAA TTAGCCCCCC T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C C A TATA T A TA CACTG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CC C  AG ATTGTAATA CTGTACC TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BI812104             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           T GCA T TCCGT AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGGCC TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TT TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTA GCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      A                     ]
[+] EMBL BI812137             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           gcaat T TCCGT ACAACAATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTA GCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    A               ]
[+] EMBL BM420441             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AC AC ATA TACGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA C  C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTACCGG TA TG TATAG AAGGGAAGC TA CA GGTA C N AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AA              ]
[+] EMBL BI812524             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AC AC ATA TACGCAT ACGTATGC GTATACGTGACCC CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BM420430             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          C AC ATA TACGCAT ACGTATGC GTATACGTGACCN CN GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CACC CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C N AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCC T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CC C  AG ATTGTAATA CTGTACA TTTGTACC CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BM420913             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          C AC ATA TACGCAT ACGTATGC GTATACGTGACCGCCA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CN GA GGG C TTGGC TT G CG A CCGC C TG A GA GG   A CA C GTA CACC CACAG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C C AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCN T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TACCA TG TATATGTACGTACCTTAGGAGGTGTATTTTGT ACGT A CACC  AG ATTGTAATA CTGTACA TTTGTACGCCCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BM038052             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TA TACGCATGACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACAC TT A C A GT A TTGT A CACGA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C ACAAA T A  CGGT ACGCCTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTAC  CCGTACGTCGAGGTATTTT   CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA                    ]
[+] EMBL BM039052             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCAT ACGTATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CACGA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CANC  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AANA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BQ907316             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACGTATGC GTATACGTGACCGCCACGGTAGTGTAG TA TGACACCG T AC AGCGTACCT GT ACC  TT ACC A GT ATTTGT ACCACGA GGG C TTGGC TT GTCG ANCCG  C TG AGGA GG   A CACC GTA CACC CACAG TGTA C G  TC TG TC AGATG C GTACG C G ATTAG T AT A TA TA TT GGG TATA T T ATATATA T ACCCGTA TTA TTANCGG TA TG TATAG AAGGGAAGC TACCACGGTACC A TAA T AC CGGT ACGCCTGT GGTAGGCGAA TTAGCCCCCACT   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C ACA TATA T A TA CACTG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CACC  AG ATTGTAATAGCTGTACACTTTGTACGCCCGTACGTCGAGGTATTTT GCCCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAA            ]
[+] EMBL BM421120             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATGC GTATACGTGACCC CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C ACGT A TTGT A CACGA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CACC CANAG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C C AAA T A  CGGT ACGCCTGT GGTAGGCGAA TTAGCCCCCACT   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C N A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CACC  AG ATTGTAATA CTGTACA TTTGTACGCCCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL AU101750             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T N CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AA              ]
[+] EMBL BI812526             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGCGGTATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BI812395             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GC GTATACGTGACCG CA GGTAGTGTAG TA T ACA CGTT ACAA CGTACCTGGTGAC   TT A C A GT A TTGT A CA GAGGGG C TTGGC TT G CG A CCG  C TG A GAGGG   A CA C GTA CA C CACAG TGTA CGG  TC TG TCAAGATG C GTAC  C GAA TAG T AT A TATTA TTGGGG TATATT T ATATATA T A CCGTA TTA TTA CGG TATTG TATAG AAGGGAAGC TA CA GGTA C C AAA T A  CGGT AC  CTGT GGTA GCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA TCAGAGAGGG TT G C C A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG  AAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BI812469             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  C GTATACGTGAACC CA GGTAGTGTAG TA T ACA CG TGAC A CGTACCT GT ACAACTT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT AC  CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTAC  CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AA              ]
[+] EMBL BM421054             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATACGTGACCG CA GGTAGTGTAG TA T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C N AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAANA A T   TTAAAA GA TTTTAAA      AA    AA              ]
[+] EMBL BQ907977             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   A GGTAGTGTAG TA T ACA CG N AC A CGTACCT GT ACA  TT A C A GT A TTGTGA CA GA GGG C TTGGC TT G CGTA CCGC C TG A GA GG   A CATC GTA CA C CA AG TGTA C G  TN TG TC AGATG C GTACG C GTA TAG T AT A TA TA TT GGG TATA T T ATATATA T T CCGTA TTA TTN CGG TA TG TATAG AAGGGAAGC TA CA GGTA C C AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCAGT   G TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA NG TATATGTACGTA CTTAGGAGGTGTATTTTGTGACGTGA CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTTAA      AA    AAAAAA          ]
[+] EMBL BI812642             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGTGTAG TA T ACA CG T AC A CGGACCT GT ACA  TTCA C   GT AGTTGT A CACGA GGG C TTGGC TT G CG A CCG  C TG A GA GG   ACCA C GTA CC C CACAG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T C CCGTA TTA TT  CGG TA TG TATAG AAGGGAAGC TA CA GGTA C C AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCC T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT   C C A TATA T A TA CA TGCTATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CACC  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BM419728             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTNTAGTTA T ACA CG T AC A CGTACCT GT ACA  TTNC C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATAGT T ATATATAGTCA CCGTATTTAGTTA CGGNTA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA TGTGT GTCC C T T CC T A GAGTT ACTA T T A CTATA T AGAGAGGG TT G C A A TATATT A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACN CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA ATA T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BI812703             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 A T ACA CG T AC A CGTACCT GT ACA  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TGTTATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT   C C A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BM421473             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGTACCT GT ACA  TT A C A GT A TTGT A CA GA  GG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTACCACC CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T A  CGGT ACG CTGT GGTA GCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGA GG TT C CAA A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTAC  CCGTACGTCGAGGTATTTT   CCTCA CGTAGGCGTTTGAG A A CC A  ANAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BI811913             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                A  TT A C A GT A TTGT A CA GA GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA                    ]
[+] EMBL BI812375             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               at  TT A C A GT A TTGT A CA GA GGG CTTTGGC TT G CG A CC   C TG A GA GG   A CA C GTA CA C CACAG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C   AAA T A  CGGT ACG CTGT GGTA GCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    A               ]
[+] EMBL BI811842             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          c GT A TTGT A CACGA GGT C TTGGCGTT G CG A CCC  C TG A GA GG   A CA C GTA CACC CC AG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA TGT ATATATA T A CCGTA TTA TT  CGG TA TG TATAG AAGGGAAGC TA CA GGTA C C AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCC T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C C A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAGAA A AA A  AAAAGAAAAA A A T   TTAAAA GA TTTTGAA      AA    AAAAAA          ]
[+] EMBL BQ906718             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GT A CA GA GGG C TTGGC TT G CG A CCGT C TG A GA GG   A CA CTGTA CA C CA AG TGTATC G  TC TG TC AGATGTC GTACG CTG A TAG T AT A TA TA TT GGG TATA T T ATATATA T ATCCGTA TTA TTATCGG TA TG TATAG AAGGGAAGC TANCA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT ATCA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA C  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA                    ]
[+] EMBL BI813205             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            A GGG C TTGGC TT G CG A CCG  C TG A GA GG   A CA C GTA CAGC CA AG TGTA C G  TC TGTTC AGATG C GTACG C G A TAG TGATGA TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA CAA AAA TGA  CGGTGACG CTGTGGGTAGGCGAA TTAGCCCCCA TGG T TGCC C T T CC TGA GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA TGA TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA                    ]
[+] EMBL BI812837             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    tgGGCTTT G CG A CCT  CTTGTA GA GGGACA CA C GTA CA C CA AG TGTA C G  TC TG TC AGATG C GTACC C G ATTAG T AT ATTA TA TT GGG TATA T T ATATATA T   CCGTA TTA TTC CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T    CGGT AC  CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C C A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACC CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTAAAA      AA    AAAA            ]
[+] EMBL BQ907359             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GC TT G CG A CCGCAC TG A GA GG   A CA C GTACCA C CANAG TGTA C G  TC TG TC AGATG C GTACG C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAG AAGGGAAGC TA CA GGTA C C AAA T AC CGGT AC  CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTAC  CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    A               ]
[+] EMBL BI812705             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TT G CG T CCG  C TG A GA GG   A CA C GGA CAGC CA AGTTGTACC G  TCTTG TC AGATG C GTACG C G A TAGTT AT A TA TA TT GGGTTATA T TAATATATA T   CCGTA TTA TTT CGG TA TG TATAG AAGGGAAGC TA CA GGTA C A AAA T    CGGT AC  CT T GGTA GCGAA TTAGCCCCCAGT   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAAAA           ]
[+] EMBL BI812437             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      G  C TG A GA GG   A CA C GTA CAGC CA AG TGTA C G  TC TG TC AGATG C GTAC  C G A TAG T AT A TA TA TT GGG TATA T T ATATATA T A CCGTA TTA TTA CGG TA TG TATAGAAAGGGAAGC TA CA GGTA C ACAAA A T  CGGT AC  CTGT GGTA GCGAA TTAGCCCCCAGT   G TTCCAC T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C ACA TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA CCAAG ATTGTAATA CTGTACA TTTGTACC CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTAAAA      AA    AAAAAA          ]
[+] EMBL BI811914             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        A CA C GTA CT C CT AG TGTA C G  TC TG TC AGATG CGGTACG C G AGTAG T AT A TA TA TT GGG TATATT T ATATATA T A CCGTAGTTAGTTA CGG TA TGTTATAG AAGGGAAGCGTA CA GGTA C ATAAAGT T  CGGT ACG CTGT GGTAGGCGAATTTAGCCCCCA TG  T TTCC CGTGT CCGT A GA TT ACTAGT T A CTATAGT AGAGAGGG TT   C A AGTATA T AGTA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA                    ]
[+] EMBL AU096283             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TA T A CCGTA TTA TTA CGG TA TG TNTAG AAGGGAAGC TN CA GGTA C A AAA T A  CGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T N GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AA              ]
[+] EMBL BQ906101             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              G AAGGGAAGC TA CA GGTA CNA TAA T ATTCGGT ACG CTGT GGTAGGCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT G C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG ACC CN A  CAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA                    ]
[+] EMBL BI811714             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGC TA CA GGTA C   AAA T A  CGGT AC  CTGT GGTA GCGAA TTAGCCCCCA T   T TTCC C T T CC T A GA TT ACTA T T A CTATA T AGAGAGGG TT   C   A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCACCGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA                    ]
[+] EMBL BM418926             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GT GGTAGGCGAA TTAGCCCCCA TG  T TTCC C T T CC T A GA TT ACTA T T AGCTATA T AGAGAGGGNTT G C A A TATA T A TA CAGTG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA                    ]
[+] EMBL BI812678             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     T AGAGA GG TT   C A A TATA T A TA CA TG TATATGTACGTA CTTAGGAGGTGTATTTTGT ACGT A CA C  AG ATTGTAATA CTGTACA TTTGTACG CCGTACGTCGAGGTATTTT G CCTCA CGTAGGCGTTTGAG A A AA A  AAAAG AAAA A A T   TTAAAA GA TTTTAAA      AA    AAA             ]


>consensus_17778#0 CCGCCCACGCGTCCGCCCACGCGTCAGGAGAGAGTCAGAGAGGAGGCGTGTTGGTTAGCT CATTGGCAGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGA ATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCG CATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCT ACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCA ACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCG GCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCA GCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGT TCCGGTACGTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGG CCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGA CGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCGCCGTCCGCCGCGGAGTTCACCG GCGAGTCGCAGGCGTTCATGGCGCCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCGC TGCTCGCCAACATCTACCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCT CCTACGCGCTCTTCACCGCCGCCGGCACCGTCGTCCAGGACGGCGCCTACGGGTACCAGA ACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGCGGCTCCG GCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGC CGGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGC GCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTTCAACGAGAACCAGAAGGACG CCGGCGTCGAGCAGAATTGGGGCCTCTTCTACCCCAACATGCAGCACGTCTACCCCATCA GCTTCTGATGCATTCCGTACACATATACGCATACGTATGCGTATACGTGACCGCAGGTAG TGTAGTATACACGTACACGTACCTGTACATTACAGTATTGTACAGAGGGCTTGGCTTGCG ACCGCTGAGAGGACACGTACACCAAGTGTACGTCTGTCAGATGCGTACGCGATAGTATAT ATATTGGGTATATTATATATATACCGTATTATTACGGTATGTATAGAAGGGAAGCTACAG GTACAAAATACGGTACGCTGTGGTAGGCGAATTAGCCCCCATTTTCCCTTCCTAGATTAC TATTACTATATAGAGAGGGTTGCAATATATATACATGTATATGTACGTACTTAGGAGGTG TATTTTGTACGTACACAGATTGTAATACTGTACATTTGTACGCCGTACGTCGAGGTATTT TGCCTCACGTAGGCGTTTGAGAAAAAAAAAGAAAAAATTTAAAAGATTTTAAAAAAAAAA AAAACTCGAGG



consensusID : consensus_17778#1
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 6
consensus length = 1331
fasta sequence
                              [GTTAGCTCATTGGCAGCAGCACACACAAACCACA-TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAGTGATTACCTTTCCCTCTCTTTCCTTTTCTTTTTCTCTCTCTATCTCTCTCTTGTG--TTTTTTTTTCGATTTGTTGCATGTTTGGAAAATCATTAGGTATATATAAGTTTTAGTTTAGTTCATGCACTCGCTCACGATGCAGAGTCTGGGGTTTAATTTTATTCTATTACCAAAAAAAGGTTTTGTTTACGCACGTCATGCATGGTGTGTGGATAGATTGCAAAAAGTTAATGATTAATTTCTTGGGAGACAGAGAAAGATGAAGAGATTATAATTGGTAGAAATGGGCTAGCTAAATAGAGATAGCTAGCTAACAAATAATACACACAGTGGTCAAGAGTCACATAGATATACATCAATTTTCATCAACAACGTCATGCGGAAAAGAGAGATAACAACTCTCGTTAGCGAGTCATCTCGTTAAACGCCTCCCCCTGCAGTTTCGGTGCCTGTCGCTCTCACTGCGAGTTTAATTATTCTCTTCTGCTGCTTAATTGCTGCTGCTGCTGCTGCTGCTGAAAGAAGGTTAATTAAGCTCGTCTCGTGCCGTCTCATTCTGCCCATCACTCACACGCATCGTCGTCTTCGTCTATGGGACCAGTAAAAACCTCGCATCAATCACT-TTCGTTAAAAGATCA-GGAAACCTCAATTTTGACTGATCTT-CTCTGATGACTCACCTCTCTGAATTTTTGCTTATCGAGAGTCGTTCTCTCAAAGATATATCTATCCTTTTTGAGTGGTGGCACCTCACCAAAACAAAAGTGCATATATATATGTCTGAAGAATATAGTATAATTGACTGCAGTTTAATTAACACAGAAAAATTACTGCGAGTAGTAATTAATTTCTGCAAGCAAGCATAGTATCTTGGGAGCATGCCGAAAGGGATGTTTCTAGCTAGCTAGCAGCTAGCTTTTAGAGGCACATTTCGTACACAAATTAACTAACAATCTTGCAGATGAAGTCTTTGCATGTTTGGTGCACTGCATGCATGTCATCTCACAGTTGCTTGCATCTTTTGGAACTTTAGAATGTTTCAACACATAACCTAGCTTTATATCTTTCTTTCNGTTCTATCTCTCATCAGTAGTCATGTTAGGCTAAGAATTCAGCTACTAGAGATAGCCTTTTTGTTTTTGACATTCATGAAAGTTAATTCAATTTAAAAA]

[+] EMBL CB628870             [GTTAGCTCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAGTGATTACCTTTCCCTCTCTTTCCTTTTCTTTTTCTCTCTCTATCTCTCTCTTGTG  TTTTTTTTTCGATTTGTTGCATGTTTGGAAAATCATTAGGTATATATAAGTTTTAGTTTAGTTCATGCACTCGCTCACGATGCAGAGTCTGGGGTTTAATTTTATTCTATTACCAAAAAAAGGTTTTGTTTACGCACGTCATGCATGGTGTGTGGATAGATTGCAAAAAGTTAATGATTAATTTCTTGGGAGACAGAGAAAGATGAAGAGATTATAATTGGTAGAAATGGGCTAGCTAAATAGAGATAGCTAGCTAACAAATAATACACACAGTGGTCAAGAGTCACATAGATATAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB660811             [  TAGCTCATTGGCAGCAGCACACACAAACCACACTCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAGTGATTACCTTTCCCTCTCTTTCCTTTTCTTTTTCTCTCTCTATCTCTCTTTTGTGTTTTTTTTTTTCGATTTGTTGCATGTTTGGAAAATCATTAGGTATATATAAGTTTTAGTTTAGTTCATGCACTCGCTCACGATGCAGAGTCTGGGGTTTAATTTTATTCTATTACCAAAAAAAGGTTTTGTTTACGCACGTCATGCATGGTGTGTGGATAGATTGCAAAAAGTTAATGATTAATTTCTTGGGAGACAGAGAAAGATGAAGAGATTATAATTGGTAGAAATGGGCTAGCTAAATAGAGATAGCTAGCTAACAAATAATACACACAGTGGTCAAGAGTCACATAGATATACATCAATTTTCATCAACAACGTCATGCGGAAAAGAGAGATAACAACTCTCGTTAGCGAGTCATCTCGTTAAACGCCTCCCCCTGCAGTTTCGGTGCCTGTCGCTCTCACTGCGAGTTTAATTATTCTCTTCTGCTGCTTAATTGCTGCTGCTGCTGCTGCTGCTGAAAGAAGGTTAATTAAGCTCGTCTCGTGCCGTCTCATTCTGCCCATCACTCACACGCATCGTCGTCTTCGTCTATGGGACCAGTAAAAACCTCGCATCAATCACT TTCGTTAAAAGATCAGGGAACCCTCAATTTTGACTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CB636342             [                                                                                                                                                                                                                                                                                                                                         TATTACCAAAAAAA GTTTTGTTTACGCACGTCATGCATGGTGTGTGGATAGATTGCAAAAAGTTAATGATTAATTTCTTGGGAGACAGAGAAAGATGAAGAGATTATAATTGGTAGAAATGGGCTAGCTAAATAGAGATAGCTAGCTAACAAATAATACACACAGTGGTCAAGAGTCACATAGATATACATCAATTTTCATCAACAACGTCATGCGGAAAAGAGAGATAACAACTCTCGTTAGCGAGTCATCTCGTTAAACGCCTCCCCCTGCAGTTTCGGTGCCTGTCGCTCTCACTGCGAGTTTAATTATTCTCTTCTGCTGCTTAATTGCTGCTGCTGCTGCTGCTGCTGAAAGAAGGTTAATTAAGCTCGTCTCGTGCCGTCTCATTCTGCCCATCACTCACACGCATCGTCGTCTTCGTCTATGGGACCAGTAAAAACCTCGCATCAATCACT TTCGTTAAAAGATCA GGAAACCTCAATTTTGACTGATCTT CTCTGATGACTCACCTCTCTGAATTTTTGCTTATCGAGAGTCGTTCTCTCAAAGATATATCTATCCTTTTTGAGTGGTGGCACCTCACCAAAACAAAAGTGCATATATAT                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB639807             [                                                                                                                                                                                                                                                                                                                                         TATTACCAAAAAAA GTTTTGTTTACGCACGTCATGCATGGTGTGTGGATAGATTGCAAAAAGTTAATGATTAATTTCTTGGGAGACAGAGAAAGATGAAGAGATTATAATTGGTAGAAATGGGCTAGCTAAATAGAGATAGCTAGCTAACAAATAATACACACAGTGGTCAAGAGTCACATAGATATACATCAATTTTCATCAACAACGTCATGCGGAAAAGAGAGATAACAACTCTCGTTAGCGAGTCATCTCGTTAAACGCCTCCCCCTGCAGTTTCGGTGCCTGTCGCTCTCACTGCGAGTTTAATTATTCTCTTCTGCTGCTTAATTGCTGCTGCTGCTGCTGCTGCTGAAAGAAGGTTAATTAAGCTCGTCTCGTGCCGTCTCATTCTGCCCATCACTCACACGCATCGTCGTCTTCGTCTATGGGACCAGTAAAAACCTCGCATCAATCACT TTCGTTAAAAGATCA AGAAACCTCAATTTTGACTGATCTT CTCTGATGACTCACCTCTCTGAATTTTTGCTTATCGAGAGTCGTTCTCTCAAAGATATATCTAT                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB639808             [                                                                                                                                                                                                                                                                                                                                                                  CGCACGTCATGCATGGTGTGTGGATAGATTGCAAAAAGTTAATGATTAATTTCTTGGGAGACAGAGAAAGATGAAGAGATTATAATTGGTACAAATGGGCTAGCTAAATAGAGATAGCTAGCTAACAAATAATACACACAGTGGTCAAGA TTTTTTTTTTATACATCAATTTTCATCAACAACGTCATGCGGAAAAGAGAGATAACAACTCTCGTTAGCGAGTTATCTCGTTAAACGCCTCCCCCTGCATTTTCCGTGCCTGT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL BM419960             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGCACTGTTCGTTAAAAGATCA GGAAACCTCATGTTTGACTGATCTTGCTCTGATGACTCACCTCTCTGAATTTTTGCTTATCGAGAGTCGTTCTCTC AAGATATATCTATCCTTTTTGAGTGGTGGCACCTCACCNAAAC AAAGTGCATATATATATGTCTGAAGAATATAGTATAATTGACTGCAGTTTAATTAACACAGAAAAATTACTGCGAGTAGTAATTAATTTCTGCAAGCAAGCATAGTATCTTGGGAGCATGCCGAAAGGGATGTTTCTAGCTAGCTAGCAGCTAGCTTTTAGAGGCACATTTCGTACACAAATTAACTAACAATCTTGCAGATGAAGTCTTTGCATGTTTGGTGCACTGCATGCATGTCATCTCACAGTTGCTTGCATCTTTTGGAACTTTAGAATGTTTCAACACATAACCTAGCTTTATATCTTTCTTTCNGTTCTATCTCTCATCAGTAGTCATGTTAGGCTAAGAATTCAGCTACTAGAGATAGCCTTTTTGTTTTTGACATTCATGAAAGTTAATTCAATTTAAAAA]


>consensus_17778#1 GTTAGCTCATTGGCAGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGC TTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTC GCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAGTGATTACCTTTCCCTC TCTTTCCTTTTCTTTTTCTCTCTCTATCTCTCTCTTGTGTTTTTTTTTCGATTTGTTGCA TGTTTGGAAAATCATTAGGTATATATAAGTTTTAGTTTAGTTCATGCACTCGCTCACGAT GCAGAGTCTGGGGTTTAATTTTATTCTATTACCAAAAAAAGGTTTTGTTTACGCACGTCA TGCATGGTGTGTGGATAGATTGCAAAAAGTTAATGATTAATTTCTTGGGAGACAGAGAAA GATGAAGAGATTATAATTGGTAGAAATGGGCTAGCTAAATAGAGATAGCTAGCTAACAAA TAATACACACAGTGGTCAAGAGTCACATAGATATACATCAATTTTCATCAACAACGTCAT GCGGAAAAGAGAGATAACAACTCTCGTTAGCGAGTCATCTCGTTAAACGCCTCCCCCTGC AGTTTCGGTGCCTGTCGCTCTCACTGCGAGTTTAATTATTCTCTTCTGCTGCTTAATTGC TGCTGCTGCTGCTGCTGCTGAAAGAAGGTTAATTAAGCTCGTCTCGTGCCGTCTCATTCT GCCCATCACTCACACGCATCGTCGTCTTCGTCTATGGGACCAGTAAAAACCTCGCATCAA TCACTTTCGTTAAAAGATCAGGAAACCTCAATTTTGACTGATCTTCTCTGATGACTCACC TCTCTGAATTTTTGCTTATCGAGAGTCGTTCTCTCAAAGATATATCTATCCTTTTTGAGT GGTGGCACCTCACCAAAACAAAAGTGCATATATATATGTCTGAAGAATATAGTATAATTG ACTGCAGTTTAATTAACACAGAAAAATTACTGCGAGTAGTAATTAATTTCTGCAAGCAAG CATAGTATCTTGGGAGCATGCCGAAAGGGATGTTTCTAGCTAGCTAGCAGCTAGCTTTTA GAGGCACATTTCGTACACAAATTAACTAACAATCTTGCAGATGAAGTCTTTGCATGTTTG GTGCACTGCATGCATGTCATCTCACAGTTGCTTGCATCTTTTGGAACTTTAGAATGTTTC AACACATAACCTAGCTTTATATCTTTCTTTCNGTTCTATCTCTCATCAGTAGTCATGTTA GGCTAAGAATTCAGCTACTAGAGATAGCCTTTTTGTTTTTGACATTCATGAAAGTTAATT CAATTTAAAAA



consensusID : consensus_17778#2
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 37
consensus length = 1069
fasta sequence
                              [AGAGAGC--AGGCG-TGTTGGTTAGC-TCATTGGCAGCAGCACACACAAACCACA-TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG-AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG-CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC-GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCAT-GGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCC-CGCCGTCCGCCGCGGAGTTCACCGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCCTCC-CCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCTACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTTCAACGAGAACCAGAAGGACGCCGGCGTCGAGCAGAATTGGGGCCTCTTCTACCCCAACATGCAGCACGTCTACCCCATCAGCTTCTGATGCATTCCGTACACATATACGCATCCGCCTGCCTTTCCTTGCCCCCTAGTAGCGTCGTATGCGCGTGCAGCTGCCGGTACGTTGCAGTCTTGTGCAAAGGGGATGGCTTGGGTCCGCAG]

[+] EMBL CB645345             [AGAGAGC  ACGCG TGTTGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCAGCGCCACGTCCAGCCTGGTCCCGGCCAT GGAGAACGTCCGCGGCGCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB653711             [AGAGAGC  CTGTG TGTTGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCAT GGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCCCAGGCGCTCCTCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB648591             [atAGAGC  AGGCG TGTTGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCAT GGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCC CGCCGTCCGCCGCGGAGTTCACCGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCCTCC CCGGCGGC                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CB645611             [  AGAGCCTTGGCG TGTTGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGGTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGGGCTCTCCAACCTCGCCGCCAGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB661990             [          GGCGCTGTTGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACATCCAGCCTGGTCCCGGCCAT GGAGAACGTCCGCGGCGCGCTGGTGTCTGCGGGGCTGGGCCACATCAAAGTGACCACGTCTGGGTCGCAGGCGCTCCTCCCCGTGTACAGAC CGCCGTCCGCCGCGGAATTCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CB661988             [          GGCG TGTTGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACATCCAGCCTGGTCCCGGCCAT GGAGAACGTCCGCGGCGCGCTGGTGTCTGCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB652326             [          GGCG TCCTGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCAT GGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCACGCCGTCCGCCGCGGAGTTCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CB663524             [          GGCG TGTTGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CB662903             [           GCG TGTTGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCATTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCAT GGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAAGCGCTCCTCTCCGTGTACAGGC CGACGTCCGCCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB640628             [           GCG TGTTGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCATGGGAGAACGTCCGCGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB641597             [            CG TGTTGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCAT GGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCC CGCCGTCCGCCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB667425             [            CG TGTTGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGAGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCAT GGAGAACGTCCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB663990             [            CG TGTTGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCAT GGAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CB618711             [            CG TGTTGGTTAGCGTCATTGGCAGCAGCACACACAAAGCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGGTTTGAGAGAAATGGCTAGCCGAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCATAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGGGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAATCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGACCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGGCGGTGTCGTTCCGGTACTCTCGCCGTCCGGAACAAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCAT GGAGAACGTCCGGGGCGCGCTGGTGTCAGCGGGGCTGGGCCACATCAACGCGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CB654129             [            CG TGTTGGTTAGC CCTTTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCAT GGAGAACGTCCGCGGCGCGCTGGTGTCCGCGGGGCTGGGCCACCTCAAGGTGACc                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB636295             [             G TGTTGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCAT GGAGAACGTCCGCGGCGCGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL OSS12638A            [             G TGTTGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTNAGCTTTTGGAATTTNAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAAGCTCGGTGGTGGGGATGTACCGTTCCAACGGCATCACGTCGATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB636946             [               TGTTGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCAT GGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB663355             [                GTTGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[-] EMBL BI807927             [                  TGGTTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGC TTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCG TCCAACGG ATCACGTCGATGCGG TGTACGCGCCGGACCAGGCGG GCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB660223             [                     TTAGC TCATTGGCAGCATCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTGTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACAGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGAGGGGATGTACCGCTCCAACAGCATCACGTCGATGCGGCTGTACGCGCCGGACCATGCGGCGCTGCATTCCGTGGGCGGCACGGGGATCACCGTCGACATCTGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCACGCCTACCCGTCGGTGTCGATCCGGCAC GTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB637339             [                     TTAGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATTTTTGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB667295             [                       AGC TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCAT GGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CA752725             [                       AGC TCATTGGCAGCAGCACACACAAAC  CA GGTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCG CAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTTCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB662858             [                       AGC TCATTGGCAGCAGCACACACAAACCACACTCTCCTATATATAGCTCATTTTTAGCTTATGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAACCAAGGCGTACCCTCCATGTTCGCTCTCGCATTGCTCCTCAGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACAGCATCACGTCGATGCGGCTGTACACGCCGGACCAGGCGGCGCTGCACTCGGTGGGCGGCACGGGGATCATCGTCGTCCTCGGCGCG CCCAACGACGTGCTCTCCAACCTCACCGCCAGCCCCGCCGCGGCGGCGTCTTGGGTGCGGAACAACATC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB637653             [                         C TCATTGGCAGCAGCACACACAAACCACATTCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCATCTTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCATCCCCGCCGCGGCGGCGTCGTGGGTGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB638860             [                         C TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAAGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCAT GGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CB638859             [                         C TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCATGCCTACCCGTCGGTG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB640715             [                         C TCATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCAT GGAGAACGTCCGCGGCGCGCTGGTGTCNGCGGGGCTGGGCCACATCAAGGTGACGACG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB664078             [                            CATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB656762             [                            CATTGGCAGCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGATTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCTTTCCTCAGAAGGCGGAGGCGATCGGGGTGTGCTACAGCATGATCGCGAACAACCTGCCGCCGGCG AGCTCTGTGGTGGGGATGTACCGCTCCTACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAAGCGGCGCTGCAGTCGGTGGGCGGAACGGGGATCAGCGTCGTCTTCTGCGCT CCCAACCACGAGCTCTCCAACCTCGCCGCCATCCCCTCCGCGGCGGTTTCGAGGGTGCGGAACAACATCCATGCCTAGCCGTCGGTGTCATTCCGGCAC GTCTCCGTCAGGAACGAAGTCGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB636948             [                                    GCAGCACACACAAACCACA TCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAAGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
[+] EMBL CB669003             [                                    GCAGCACACACAAACCACA TCTCCTATATATAACTCATTTTTAGCTTTTGGAATTTGAGACAGGTTCTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACCACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCACGTGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCACCGCCAGCCCCGCCGCGGCTGCGTCGTGGGTGCGGAACAACATCTAAGACTA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB669578             [                                                  CCACA TCTCCTGTATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGCTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTGTGCCTCCGTTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGCGGTGGGGATGTACCGCTCCAACGGCATCACGTCTATGCGGCTGTACGCACCGGACCACGCGGCGCTGCAGTCGGCGGGCGGCACGGGGATCAGCGTCCCCCTCGGCGCG CCCGACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCATGCCTACCCGGCAGTGTCGTTCCGGTAC GTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB652564             [                                                            CTATATATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCG CCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTAC GTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCAT GGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCACGCGCTCCTCGCCGTGTAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB623171             [                                                             TATATATAGCTCATTTTTATCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCGAGGTGTAGCCTCCATGTTCGCTCTCGCGTTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGAGTGCTACTGCATGATCGCGAACAACCTGCCGGCGGCG AGCTCGGTGGTGGGGATGTACCGCTCCAACTGCATCACGTCTATGCGGCTGTACGCGCCGGACCACGCGGCGCTGGATTCGGTGGGCGGCACGGGGATCAGGGTCGTCGTCGGCGCG CCCAACGACTTGCTCTCCAACCTCGCCGCCAGCCCAGCCACGGCGGCGTCGTGGGTGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[-] EMBL CB666481             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGG CCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCTACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTTCAACGAGAACCAGAAGGACGCCGGCGTCGAGCAGAATTGGGGCCTCTTCTACCCCAACATGCAGCACGTCTACCCCATCAGCTTCTGATGCATTCCGTACACATATACGCATCCGCCTGCCTTTCCTTGCCCCCTAGTAGCGTCGTATGCGCGTGCAGCTGCCGGTACGTTGCAGTCTTGTGCAAAGGGGATGGCTTGGGTCCGCAG]


>consensus_17778#2 AGAGAGCAGGCGTGTTGGTTAGCTCATTGGCAGCAGCACACACAAACCACATCTCCTATA TATAGCTCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAG GTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAA AGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCT CGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACC AGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACG ACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACA TCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTCGCCGTCGGGAACGAGGTCGCCGGCG GCGCCACGTCCAGCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGG GGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCC CGCCGTCCGCCGCGGAGTTCACCGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCG TCGACGCGTTCTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCT CCGAGACAGGCTGGCCCCTCCCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATCT ACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCTACCCCGGCGCCATCG AGACCTACGTCTTCTCCATGTTCAACGAGAACCAGAAGGACGCCGGCGTCGAGCAGAATT GGGGCCTCTTCTACCCCAACATGCAGCACGTCTACCCCATCAGCTTCTGATGCATTCCGT ACACATATACGCATCCGCCTGCCTTTCCTTGCCCCCTAGTAGCGTCGTATGCGCGTGCAG CTGCCGGTACGTTGCAGTCTTGTGCAAAGGGGATGGCTTGGGTCCGCAG



consensusID : consensus_17778#3
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 102
consensus length = 811
fasta sequence
                              [CCGTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC-GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC-GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT-CAACGAGAACCAGA-AGGACGCCGGCGTCGAGCA-G-AATTGGGGCCTC-TTC-TACCCC--A-ACA-T-GCAGCAC-GTCTA-CCCCA-TC-AGC-TTC-TGAT-GCATTCCGT-AC-ACATA-TACGC-ATACGTATGCGTATACGTGACCGC-AGGTAGTGTAGTAT-A-C-A--CGTACACGTACCT-G-T-ACA--T-TAC-AGTA-TTG-TACA-GA-GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA-CCA-A-GTGTACGTCTGT-CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT-ACCGT-ATTATT-A-CGGTATGT-AT-AGAAGGGAAGCTACA-GGT-ACA-AAATA-CGGTACGCTGTGGTAGGCGAATTAGCCCCCA-TTTTCCCTTCCTA-GA-TTACT-A-TTACTATATAGAGAGGGTT-G-CAATATATATA-CATGTATATGTACGTA-CTTA-GGAGGTGTATTTT-GTACGTACA-CAGATTGTAATACTGTACATTTGTACGCCG-TA--CGTC-GAGGTATTTT-GCCTCA-CGTAG-GCGTTTGAG-AAA--AA-AAAAGAAAAAATT--TAAAAGAAAAAAAAAAAGA]

[-] EMBL CB654736             [CCGTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  T AAAGAAAAAAggga   ]
[-] EMBL CB659026             [CCGTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAGAt           ]
[-] EMBL CB645612             [                   CTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CGGGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACTCCt aa  a                                                                                ]
[-] EMBL CB650977             [                    TACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCAA TG  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTg                                              ]
[-] EMBL CB651174             [                              AGAACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAA AAA  AA AAAAG                             ]
[-] EMBL CB661856             [                               GAACCTGTTCGACACCACCGTGGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATAT  TATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG                                                     ]
[-] EMBL CB654145             [                                AACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTA                                                      ]
[-] EMBL CB668208             [                                AACCTGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GGGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAGACAAAAAAga   ]
[-] EMBL CB652306             [                                AACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAAT                      ]
[-] EMBL CB667019             [                                AACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAGAtt          ]
[-] EMBL CB643003             [                                AACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATTGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GAAAGTGAG AAA  AA AAAAGAAAAA                        ]
[-] EMBL CB643737             [                                AACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT CCCGT ATTATT A CGGTATGT AT AAAAGGGAAGTTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATC CATGTATATGTCCGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAG                             ]
[-] EMBL CB646123             [                                AACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TA                 ]
[-] EMBL CB663356             [                                AACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TA                 ]
[-] EMBL CB651263             [                                AACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG                                                     ]
[-] EMBL CB675859             [                                AACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  T                  ]
[-] EMBL CB643778             [                                 ACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AAAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA AGGAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TACTAAAAAg         ]
[-] EMBL CB658327             [                                 ACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTA                                                      ]
[-] EMBL CB659613             [                                 ACCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TA                 ]
[-] EMBL CB656734             [                                  CCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAGATTAAAAAAAAGA]
[-] EMBL CB654551             [                                  CCTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GAGGTTGAG AAA  AA AAAAGAAAAAATT  TAAAAGAt           ]
[-] EMBL CB668239             [                                   CTGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGCACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAga                             ]
[-] EMBL CB675178             [                                    TGTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCC CGTCC TCG AGGGG AAA  AA AAAAGAAAAAA                       ]
[-] EMBL CB644114             [                                    TGTTCGACACCACCGTCGACCCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGGG GAA  AA AAAAGAAAAAAT                      ]
[-] EMBL CB678605             [                                     GTTCGACACCACCGTTGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACTCCA GG  GGTC GAGGTATTTT GCCTCA CGTAG GCG TTGAG CTA  AA Aggga                             ]
[-] EMBL CB661991             [                                     GTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  T                  ]
[-] EMBL CB674448             [                                     GTTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAG                             ]
[-] EMBL CB648204             [                                      TTCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATC CATGTATATGTCCGTA CTTA GGAGGTGTA                                                                                                                                   ]
[-] EMBL CB654989             [                                       TCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA GGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATTTATAAAAGAga          ]
[-] EMBL CB670437             [                                       TCGACACCACCGTCGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAGAtt          ]
[-] EMBL CB654596             [                                                    CGACGCGTTTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA AGGAG GCGTTTGAG AAA  AA AAAA                              ]
[-] EMBL CB653053             [                                                            TTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  AGTC GAGGTATTTT TCCACG GGTAG GCGTTTGNA AAA  AA AA                                ]
[-] EMBL CB622951             [                                                              TACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACCGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GAG GTGAG AAA  AA AAAAGAAAAA                        ]
[-] EMBL CB650059             [                                                                         GGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAg              ]
[-] EMBL CB660840             [                                                                         GGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTATGGG AAA  AA AAAAGAAAAA                        ]
[-] EMBL CB650988             [                                                                         GGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAA              ]
[-] EMBL CB669577             [                                                                         GGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TA                 ]
[-] EMBL CB674350             [                                                                         GGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCG TTGAG AAA  AA AAAga                             ]
[-] EMBL CB634860             [                                                                         GGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACCGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTTTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TA                 ]
[-] EMBL CB652327             [                                                                          GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GAG GTGAG AAA  AA AAAAGAAAAAA                       ]
[-] EMBL CB662923             [                                                                          GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTT TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAA                         ]
[-] EMBL CB641884             [                                                                          GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCGCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAGAAAA  AA AAAAGAAAAAATT  TA                 ]
[-] EMBL CB662135             [                                                                          GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TA                 ]
[-] EMBL CB623133             [                                                                          GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACCGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TA                 ]
[-] EMBL CB647676             [                                                                          GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTT                                              ]
[-] EMBL CB656557             [                                                                          GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  T                  ]
[-] EMBL CB676593             [                                                                          GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAAT                      ]
[-] EMBL CB643351             [                                                                          GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGGAGATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTAC                                                                                                  ]
[-] EMBL CB676047             [                                                                          GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GAGGGTGAG AAA  AA AAAAGAAAAAA                       ]
[-] EMBL CB673850             [                                                                           CCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAGAAAA  AA AAAAGAAAAAATT  TAAAAGAAAAAAAAgga  ]
[-] EMBL CB675244             [                                                                           CCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GGGTTTGAG AAA  AA AAAAGAAAAAATT  T  AAGAAAAAAAga    ]
[-] EMBL CB655462             [                                                                           CCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTG GAGGTATTTT GCCTCA CGTAG                                                     ]
[-] EMBL CB644223             [                                                                           CCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCCTTAAAG GAA  AA AAAAGAAAAAATT                     ]
[-] EMBL CB662904             [                                                                             AAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTA TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGCCCGCTGAGAGGACACGTACT CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGGGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTACGGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCGCTA  CGTCAGAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TA                 ]
[-] EMBL CB649565             [                                                                              AGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG                                                     ]
[-] EMBL CB677605             [                                                                              AGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTT TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG AA  GGTC GAGGTATTTT GCCTCA CG                                                        ]
[-] EMBL CB656361             [                                                                              AGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATNCTGTACATT                                                                                               ]
[-] EMBL CB656552             [                                                                               GCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCG TTGAG AAA  AA AAAga                             ]
[-] EMBL CB644126             [                                                                                 ACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TA                 ]
[-] EMBL CB650119             [                                                                                  CGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GC AAGGAG AAA  AA AAAAGAAAAAATT                     ]
[-] EMBL CB642927             [                                                                                   GGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTG GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGT T GTAAAGGAG AAA  AA AAAAGAAA                          ]
[-] EMBL CB646011             [                                                                                       GCTCCGGCGTCTCCCTCGTAGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTT CCCCA TC AGC TTG TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  T AAAGAAAA         ]
[-] EMBL CB673217             [                                                                                               GTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA AGTAG GCGTTTGAGAAAA  AA AAAAGAAAAAATT  TAAAAAAAgg         ]
[-] EMBL CB674231             [                                                                                                      TCGTCGTCTCCGAGACAGGTTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGTGCCACCCCGGCGCCATGGAGACCTACGTCTTTTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTT TTT TACCCC  A ACA T GCAGCAC GTTTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTTTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TA                 ]
[-] EMBL CB652125             [                                                                                                             CTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCATGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATAGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTG TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGGTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT CCCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG GGA  AA AAAAGAAA                          ]
[-] EMBL CB674759             [                                                                                                                CGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT                     ]
[-] EMBL CB645348             [                                                                                                                         CTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT C CAAT                                                                                                                                                                          ]
[-] EMBL CB673895             [                                                                                                                           GGCCCTCCGCCGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG AACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAA              ]
[-] EMBL CB673290             [                                                                                                                                     CGGCGGCATGTCCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCAAGTC GTCCGCGGCACGCCGCGCCACCCCGGGGCCATCGAGACCTAGGTGTTTTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  T ACA T GCAGCAC GTCTA CCCCA TC AGG TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACCCGTCCCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT T CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTG                                             ]
[-] EMBL CB648795             [                                                                                                                                            ATGTCCGCCTCGCCGGGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATGGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACCCCG TA  CGTC GAGGTATTTT GCCAAG CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAAT                      ]
[-] EMBL CB634724             [                                                                                                                                                CCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAAAAga         ]
[-] EMBL CB618755             [                                                                                                                                                CCGCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTAAGGGTAGNGCGTTTGAG AAA  AA AAA                               ]
[+] EMBL CB627258             [                                                                                                                                                  GCCTCCCT TGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAA                        ]
[-] EMBL CB653137             [                                                                                                                                                  GCCTCGCC GGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATGGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTT TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTAGGTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC                                                                             ]
[-] EMBL CB648053             [                                                                                                                                                    CTCGCC GGCCAACGCCCGGATGTACAACCAGAACCTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATGGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTT TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  T AAAGAAAAAAAAGAAa ]
[-] EMBL CB650516             [                                                                                                                                                                  GCCCGGATCTACAACCAGAACGTCATCAACCACGTC GGCCGCGGCACGCCGCGCCACCCCGGCGCCATAGAGACCTAGGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTG TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATAGGGTGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTCCTCTT AAAGGGTC GAGGTATTTT GCCTCA                                                           ]
[-] EMBL CB650725             [                                                                                                                                                                        ATCTACAACCAGAACTTCATCAACC CCTCGGGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTT TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCC CGTAG GAG GGGAG AAA  AA AAAAGAAAAA                        ]
[-] EMBL CB654564             [                                                                                                                                                                        ATCTACAACCAGAACCTCATCAACCACGTC GGCCGGGGCACGCCGCGCCACCCCGGGGCCATGGAGACCTACGTCTTCTCCATGTT CAACGAGAACCAGA AGGACGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTG TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGGGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTAGAG AAA  AA AAAAGAAAAAAT                      ]
[+] EMBL BM419207             [                                                                                                                                                                                                                                           ACCTACGTCTTCTCCATGTTCCTACGAGAACCAGATAGGACGCCGGCGTCGAGCA G AATT GGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG CCN  CN AAAAGAAAAAATT  TAAAAAAAAA         ]
[+] EMBL BI813716             [                                                                                                                                                                                                                                                                 AACGAGAACCAGA AGGACGCCGGCGTCGA CA G AATT GGGCCTC TTC TACCCC    ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAGAAAAAAAAAA   ]
[+] EMBL BM419813             [                                                                                                                                                                                                                                                                        ACCAGA AGGACGCCGGCGTCGA CA G AATTGGGGCCTC TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACN AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAGAAAAAAAAAA   ]
[+] EMBL BM419806             [                                                                                                                                                                                                                                                                                   CGCCGGCGTCGAGCA G AATTGGGGCCTC TTC TACCCC    ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAGAAAAA        ]
[+] EMBL BM420623             [                                                                                                                                                                                                                                                                                            CGAGCATGTAATTGGGGCCTC TTG TACCCC  N ACA TNGCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACN AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG ACC  AN NAAAGAAAAAATT  TAAAAAAAAAA        ]
[+] EMBL BI812195             [                                                                                                                                                                                                                                                                                                            cCCTCTTTCGTACCCC  G ACA T GCAGCAC GTCTA CCCCA TC AGCGTTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A CAA  CGTACACGTACCT G T ACA  TGTAC AGTA TTG TACACGAGGGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCT T CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACC AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCC TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT GCCAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACC CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAGAAAAAAAAAA   ]
[+] EMBL BM419055             [                                                                                                                                                                                                                                                                                                              CTC TTC TACCCC  A ACA T  CAGCAC GTCTA CCCCA TC AGC TTC TGAT  CATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTG CCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACAN T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACANCCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACN AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTTCC CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACACCAGATTGTAATACTGTACATTTGTACNCCG TA  CGTC GAGGTATTTT  CCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAAAAAAA        ]
[+] EMBL BM421536             [                                                                                                                                                                                                                                                                                                                C TTC TACCCC  A ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACACCCANA GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT ACCGGTATGT AT AGAAGGGAAGCTACACGGT ACACAAATACCGGTACGCTGTGGTAGGCGAATTAGCCCCCACTTTTCCCTTCCTA GACTTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG ANN  AA AAAAGAAAAAATT  TAAAAGAAAAA        ]
[+] EMBL BI813199             [                                                                                                                                                                                                                                                                                                               ct TTT TACCCCCGA ACATT GCAGCACGGTCTACCCCCACTCAAGCGTTCTTGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACACCCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A CTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGACCAAATT  TAAAAAAAAAA        ]
[+] EMBL BM419034             [                                                                                                                                                                                                                                                                                                                  TTC TACCCC    ACA T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACC C AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT AC  AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTACGA TTACTCA TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTAC CCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG CCC  AC CAAAGAAAAAATT  TAAAAAAAAAA        ]
[+] EMBL BM038321             [                                                                                                                                                                                                                                                                                                                   tt TACCCC  ANACA T  CAGCAC GTCTA CCCCA TC AGC TTCTTGATNNCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCCC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACN AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCC TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACN CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AACCAAAGAAAAAATT  TAAAAGAAAAAAAAAAA  ]
[+] EMBL BI812140             [                                                                                                                                                                                                                                                                                                                                  A T GCAGCAC GTCTA CCCCA TC AGC TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAGAAAAAA       ]
[+] EMBL BM421240             [                                                                                                                                                                                                                                                                                                                                                               C TTC TGAT CCATTCCGT AC ACATATTACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACC CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT AC  AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTAC CCG TA  CGTC GAGGTATTTTGGCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAAAAAAA        ]
[+] EMBL BI812544             [                                                                                                                                                                                                                                                                                                                                                             caC TTC TGAT CCATTCCGT AC ACATA TAC C ATAC TATGCGTATAC TGACC C A GTAATTTA TAT A C AACCGTACACGTACCTGG T ACA  T TAC AGTATTTGTTACA GA  GGCTTTGCTT CGACCCCTGAGAGGACACGTACA CCACAGGTGTACGTCTGTCCAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT AC  AAATA CGGTAC CTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAAAAA          ]
[+] EMBL BI813728             [                                                                                                                                                                                                                                                                                                                                                                 TTC TGAT GCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT AC  AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAGAAAAAAAAAA   ]
[+] EMBL BM418944             [                                                                                                                                                                                                                                                                                                                                                                 tct TGA  GCATNCCGTGACAACATA TACGCAATACGTATGCGTATACGTGACCGCAAGGTAGTGTAGTAT AGC A  CGTACACGTACCT G TGACANNTNNACAAGTAGTTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACANCCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATATGACCGT ATTATTCA CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTAC CTGTGTTAGGCGAATTAGCCCCCAGGGTTCCCTTCCTA GAGTTACT A TTACTATATAGAGAGGGTT C CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTTGGTACGTACA CAGATTGTAATACTGTACATTTGTACCCCG TA  CGTC GAGGTATTTT GCCTCACCGTAG GCGTTTGAG   A  AA AAAAG AAAAATT  TAAAAAAAA          ]
[+] EMBL BI813796             [                                                                                                                                                                                                                                                                                                                                                                        gacCATTCCGT AC ACATA TACGC ATACGTATGCGTATACGTGACC C AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T AC   T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACACCCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT AC  AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAGAAAAAA       ]
[+] EMBL BM038326             [                                                                                                                                                                                                                                                                                                                                                                                 GT AC ACATA TACGC ATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACNCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA CCAAGAAAAAATT  TAAAAAAAAAAAAA     ]
[+] EMBL BI813275             [                                                                                                                                                                                                                                                                                                                                                                                    AC ACATA TACGC ATACGTATGCGTATACGTGACCCC AGGTAGTGTAGTAT A C A  CGTACACGTACCTGG T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACC CTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTAC CGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACC AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGCAAAAATT  TAAAAGAAAAAAAAAA   ]
[+] EMBL BI811739             [                                                                                                                                                                                                                                                                                                                                                                                                           GCGTATACGTGACCGC AGGTAGTGTAGTATGA C A  CGTACACGTACCT GTT ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCTCTGAGAGGACACGTACC CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATGGGGTATATTATATATAT  CCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT AC  AAATA CGGTAC CTGTGGTA GCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTATCTTA GGAGGTGTATTTT GTACGTACC CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAAAAAAA        ]
[+] EMBL BM420292             [                                                                                                                                                                                                                                                                                                                                                                                                             GTATACGTGACCGC AGGTA TGTAGTAT A C A  CGTACACGTACCT G T ACA  T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGTGATTATTGA CGGTATGTGATGAGAAGGGAAGCTACA GGT ACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCACTTTTCCCTTCCTA GA TTACT ACTTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACGGTACATTTGTAC CCG TA  CGTC GAGGTATTTT  CCTCA CGTAG GCGTTTGAG AAANCCC NANAGAAAAAATT  TAAAAAAAAAA        ]
[+] EMBL BI812302             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                G T ACAC T TAC AGTA TTG TACA GA GGGCTTGGCTTGCGACCGCTGAGAGGACACGTACA CCC A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACC AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCC TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CCATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACACCAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAA AAA  AA AAAAGAAAAAATT  TAAAAGAAAAAAAAAA   ]
[+] EMBL BM418899             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACA CCA A GTGTACGTCTGT CAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATAT ACCGT ATTATT A CGGTATGT AT AGAAGGGAAGCTACA GGT ACC AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT G CAATATATATA CATGTATATGTACGTA CTTA GGAGGTGTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTACGCCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG AAA  AA AAAAGAAAAAATT  TAAAAAAAAAA        ]
[+] EMBL BQ908155             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TT A CGGTATGT AT AGAAGGGAAGCTACA GGTGACA AAATA CGGTACGCTGTGGTAGGCGAATTAGCCCCCA TTTTCCCTTCCTA GA TTACT A TTACTATATAGAGAGGGTT C CAATATATATA CATGTATATGTACGTA CTTA GGAGGTTTATTTT GTACGTACA CAGATTGTAATACTGTACATTTGTAC CCG TA  CGTC GAGGTATTTT GCCTCA CGTAG GCGTTTGAG  AA  AA AAAAGAAAAAATT  T AAAGAA           ]


>consensus_17778#3 CCGTCGTCCAGGACGGCGCCTACGGGTACCAGAACCTGTTCGACACCACCGTCGACGCGT TTTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAG GCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATCTACAACCAGA ACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACG TCTTCTCCATGTTCAACGAGAACCAGAAGGACGCCGGCGTCGAGCAGAATTGGGGCCTCT TCTACCCCAACATGCAGCACGTCTACCCCATCAGCTTCTGATGCATTCCGTACACATATA CGCATACGTATGCGTATACGTGACCGCAGGTAGTGTAGTATACACGTACACGTACCTGTA CATTACAGTATTGTACAGAGGGCTTGGCTTGCGACCGCTGAGAGGACACGTACACCAAGT GTACGTCTGTCAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATATACCGT ATTATTACGGTATGTATAGAAGGGAAGCTACAGGTACAAAATACGGTACGCTGTGGTAGG CGAATTAGCCCCCATTTTCCCTTCCTAGATTACTATTACTATATAGAGAGGGTTGCAATA TATATACATGTATATGTACGTACTTAGGAGGTGTATTTTGTACGTACACAGATTGTAATA CTGTACATTTGTACGCCGTACGTCGAGGTATTTTGCCTCACGTAGGCGTTTGAGAAAAAA AAAGAAAAAATTTAAAAGAAAAAAAAAAAGA



consensusID : consensus_17778#4
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 3
consensus length = 795
fasta sequence
                              [GTACCCNGTTGATCCCTCATAGGGANAAAGNGTTCCCCNGGGGCGTTNGATNTGTCCCGGNGCGGATTGANGGGAACTTTNAACCCCTTGAAGTTTAACCCCAGGCCAGCNGGGGTTCGGTTTTCCTTTTTTTTTCGGGANGGTGCCNTTCNCGGGGGAATTTCCCCTTGCCGCCAAACNCNGAATTAANAACNAGACCTTTTTNAACAATTTGGCCGGGGAAAGCGGNCCACCCCGGGGCCNTTGGAGACCNAATTTTTTTNCATTTTTCAACGNGAACCAGAAGAACNCCGGNTTTNGAGCAGAATTGGNCCTTTTTTTACCCCAAACAT-GCGGCAAG-TTTACCCCATTCA-GTTTTTGATGCA-TTCCGTAACAACAT-ATACGCATACGTATGCGTATAACGTGACCGGCAGTTAGTGTAGTAT-AAACGT-ACACGTACC-TGTACATTACAG-TATTGTACAGAGGGCTTGGCTT-GCGACCGCTGA-GAGGACACGT-ACA-CCAAGTGT-ACGTCTGTCAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATATACCGTATTATTACGGTATGTATAGAAGGGAAGCTACAGGTACAAAATACGGTACGCTGTGGTAGGCGAATTAGCCCCCATTTTCCCTTCCTAGATTACTATTACTATATAGAGAGGGTTGCAATATATATACATGTATATGTACGTACTTAGGAGGTGTATTTTGTACGTACACAGATTGTAATACTGTACATTTGTACGCCGTACGTCGAGGTATTTTGCCTCACGTAGAAAAAA]

[-] EMBL BE229284             [GTACCCNGTTGATCCCTCATAGGGANAAAGNGTTCCCCNGGGGCGTTNGATNTGTCCCGGNGCGGATTGANGGGAACTTTNAACCCCTTGAAGTTTAACCCCAGGCCAGCNGGGGTTCGGTTTTCCTTTTTTTTTCGGGANGGTGCCNTTCNCGGGGGAATTTCCCCTTGCCGCCAAACNCNGAATTAANAACNAGACCTTTTTNAACAATTTGGCCGGGGAAAGCGGNCCACCCCGGGGCCNTTGGAGACCNAATTTTTTTNCATTTTTCAACGNGAACCAGAAGAACNCCGGNTTTNGAGCAGAATTGGNCCTTTTTTTACCCCAAACATGGCGGCAAG TTTACCCCATTCA GTTTTGGATGCA TTCCGTAACAACATAAAAGGCATACGTATGCGTATAACGTGACCCGCAGTTAGTGTAGTAT AAACGT ACACGTACC TGTACATTACAG TATTGTACAGAGGGCTTGGCTT GCGACCGCTGA GAGGACACGT ACA CCAAGTGT ACGTCTGTCAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATATACCGTATTATTACGGTATGTATAGAAGGGAAGCTACAGGTACAAAATACGGTACGCTGTGGTAGGCGAATTAGCCCCCATTTTCCCTTCCTAGATTACTATTACTATATAGAGAGGGTTGCAATATATATACATGTATATGTACGTACTTAGGAGGTGTATTTTGTACGTACACAGATTGTAATACTGTACATTTGTACGCCGTACGTCGAGGTATTTTGCCTCACGTAG      ]
[+] EMBL BM419567             [                                                                                                                                                                                                                                                                                                                                 ACCCC AACAT GCAGCACG TCTACCCCA TCA GCTTCTGATGCA TTCCGT AC ACAT ATACGCATACGTATGCGTAT ACGTGACCGCCAGGTAGTGTAGTAT ACACGT ACACGTACC TGTACATTACAG TATTGTACAGAGGGCTTGGCTT GCGACCGCTGA GAGGACACGT ACA CCAAGTGT ACGTCTGTCAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATATACCGTATTATTACGGTATGTATAGAAGGGAAGCTACAGGTACAAAATACGGTACGCTGTGGTAGGCGAATTAGCCCCCATTTTCCCTTCCTAGATTACTATTACTATATAGAGAGGGTTGCAATATATATACATGTATATGTACGTACTTAGGAGGTGTATTTTGTACGTACACAGATTGTAATACTGTACATTTGTACGCCGTACGTCGAGGTATTTTGCCTCACAAAAAAAAAA]
[-] EMBL BE229335             [                                                                                                                                                                                                                                                                                                                                       AACAT GCGG AAGTTTTACCCCATTCAGGTTTTTGA GCATTTCCG AACAACAN ATACGCATANGTATGCGTATAACGGGA CNGCAGTT GNGTAGTATAAAACGTAACANGTACCTTGAACATTACNGTTNTTGTACAGAGGGCTTGGCTTGGCGACCGCTGANGA GACACGTAACACCCAAGTGTAACNTCTGTCAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATATACCGTATTATTACGGTATGTATAGAAGGGAAGCTACAGGTACAAAATACGGTACGCTGTGGTAGGCGAATTAGCCCCCATTTTCCCTTCCTAGATTACTATTACTATATAGAGAGGGTTGCAATATATATACATGTATATGTACGTACTTAGGAGGTGTATTTTGTACGTACACAGATTGTAATACTGTACATTTGTACGCCGTACGTCGAGGTATTTTGCCTCACGTAG      ]


>consensus_17778#4 GTACCCNGTTGATCCCTCATAGGGANAAAGNGTTCCCCNGGGGCGTTNGATNTGTCCCGG NGCGGATTGANGGGAACTTTNAACCCCTTGAAGTTTAACCCCAGGCCAGCNGGGGTTCGG TTTTCCTTTTTTTTTCGGGANGGTGCCNTTCNCGGGGGAATTTCCCCTTGCCGCCAAACN CNGAATTAANAACNAGACCTTTTTNAACAATTTGGCCGGGGAAAGCGGNCCACCCCGGGG CCNTTGGAGACCNAATTTTTTTNCATTTTTCAACGNGAACCAGAAGAACNCCGGNTTTNG AGCAGAATTGGNCCTTTTTTTACCCCAAACATGCGGCAAGTTTACCCCATTCAGTTTTTG ATGCATTCCGTAACAACATATACGCATACGTATGCGTATAACGTGACCGGCAGTTAGTGT AGTATAAACGTACACGTACCTGTACATTACAGTATTGTACAGAGGGCTTGGCTTGCGACC GCTGAGAGGACACGTACACCAAGTGTACGTCTGTCAGATGCGTACGCGATAGTATATATA TTGGGTATATTATATATATACCGTATTATTACGGTATGTATAGAAGGGAAGCTACAGGTA CAAAATACGGTACGCTGTGGTAGGCGAATTAGCCCCCATTTTCCCTTCCTAGATTACTAT TACTATATAGAGAGGGTTGCAATATATATACATGTATATGTACGTACTTAGGAGGTGTAT TTTGTACGTACACAGATTGTAATACTGTACATTTGTACGCCGTACGTCGAGGTATTTTGC CTCACGTAGAAAAAA



consensusID : consensus_17778#5
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 9
consensus length = 788
fasta sequence
                              [CGGCACGAGGGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTTCAACGAGAACCAGAAGGACGCCGGCGTCGAGCAGAATTGGGGCCTCTTCTACCCCAACATGCAGCACGTTTACCCCATCAGCTTTTGATGCATTCCGTACACATATACGCATACGTAT-GCGTATACGTGACCGCAGGTAGTGTAGTATACACGTACACGTACCTGTACATTACAGTATTGTACAGAGGGCTTGGCTTGCGACCGCTGAGAGGACACGTACACCAAGTGTACGTCTGTCAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATATACCGTATTATTACGGTATGTATAGAAGGGAAGCTACAGGTACAAAAT-ACGGTACGCTGTGGTAGG-GGAATTAGCC-CCCATTTTCCCTTCCTAGATTACTATTACTATATAGAGAGGGTTGCAATATATATACATGTATATGTACGT-ACTTAGGAGGTGTATTTTGTACGTACACAGATTGTAATACTGTACATTTGTACGCCGTAC-GTCGAGGTATTTTGCCTCACGTAGGCG-TAGGGGAAAAAAAAAGAAAAAATTTAAAAGATTTTACAAAAAAGGAA]

[-] EMBL CB660274             [CGGCACGAGGGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCATGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTTCAACGAGAACCAGAAGGACGCCGGCGTCGAGCAGAATTGGGGCCTCTTCTACCCCAACATGCAGCACGTTTACCCCATCAGCTTCTGATGCATTCCGTACACATATACGCATACGTAT GCGTATACGTGACCGCAGGTAGTGTAGTATACACGTACACGTACCTGTACATTACAGTATTGTACAGAGGGCTTGGCTTGCGACCGCTGAGAGGACACGTACACCAAGTGTACGTCTGTCAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATATACCGTATTATTACGGTATGTATAGAAGGGAAGCTACAGGTACAAAAT ACGGTACGCTGTGGTAGG GGAATTAGCC CCCATTTTCCCTTCCTAGATTACTATTACTATATAGAGAGGGTTGCAATATATATACATGTATATGTACGT ACTTAGGAGGTGTATTTGGTACGTACACAGATTGTAATACTGTACATTTGTACGCCGTAC GTCGAGGTATTTTGCCTCACGTAGGCG TAGGGGAAAAAAAAAGAAAAAATTTAAAAGATTTTACAAAAAAGGAA]
[-] EMBL CB656497             [                         CGACGCGTTCTACGCCGCCATGGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTTCAACGAGAACCAGAAGGACGCCGGCGTCGAGCAGAATTGGGGCCTCTTCTACCCCAACATGCAGCACGTCTACCCCATCAGCTTTTGATGCATTCCGTACACATATACGCATACGTAT GCGTATACGTGACCGCAGGTAGTGTAGTATACACGTACACGTACCTGTACATTACAGTATTGTACAGAGGGCTTGGCTTGCGACCGCTGAGAGGACACGTACACCAAGTGTACGTCTGTCAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATATACCGTATTATTACGGTATGTATAGAAGGGAAGCTACAGGTACAAAAT ACGGTACGCTGTGGTAGG CGAATTAGCC CCCATTTTCCCTTCCTAGATTACTATTACTATATAGAGAGGGTTGCAATATATATACATGTATATGTACGT ACTTAGGAGGTGTATTTTGTACGTACACAGATTGTAATACTGTACATTTGTACGCCGTAC GTCGAGGTATTTTGCCTCACGTAGGCGTTAGGGAAAAAAAAAAGAAAAAATTTAAAAGATTTTACCTTAAAGGA ]
[-] EMBL CB649268             [                                                CCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTTCAACGAGAACCAGAAGGACGCCGGCGTCGAGCAGAATTGGGGCCTCTTCTACCCCAACATGCAGCACGTTTACCCCATCAGCTTTTGATGCATTCCGTACACATATACGCATACGTAT GCGTATACGTGACCGCAGGTAGTGTAGTATACACGTACACGTACCTGTACATTACAGTATTGTACAGAGGGCTTGGCTTGCGACCGCTGAGAGGACACGTACACCAAGTGTACGTCTGTCAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATATACCGTATTATTACGGTATGTATAGAAGGGAAGCTACAGGTACAAAAT ACGGTACGCTGTGGTAGG CGAATTAGCC CCCATTTTCCCTTCCTAGATTACTATTACTATATAGAGAGGGTTGCAATATATATACATGTATATGTACGT ACTTAGGAGGTGTATTTTGTACGTACACAGATTGTAATACTGTACATTTGTACGCCGTAC GTCGAGGTATTTTGCCTCACGTAGGCG TTGGGGAAAAAAAAAGAAAAA                          ]
[-] EMBL CB665385             [                                                CCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTTCAACGAGAACCAGAAGGACGCCGGCGTCGAGCAGAATTGGGGCCTCTTCTACCCCAACATGCAGCACGTCTACCCCATCAGCTTTTGATGCATTCCGTACACATATACGCATACGTAT GCGTATACGTGCCCGCAGGTAGTGTAGTATACACGTACACGTACCTGTACATTCCAGTATTGTACAGAGGGCTTGGCTTGCGACCGCTGAGAGGACACGTACACCAAGTGTACGTCTGTCAGATGCGTACGCGATAGTATATATATTGGGTATAT  TATATATCCGGTATTATTACGGTATGTATAGAAGGGAAGTTACAGGTACAAAAT CCGGTCCCCTGTGGTAGG GGAATTAGCC CCCATTTTCCCTTCCTAGATTACTATTACTATATAGAGAGGGTTGCAATATATATGCAAGTATATGT GGTGACTTAGGAGGTGTATTTTCTTGGTGCACAGACTGTAATTAGGCACATTTGTCCGCCCTTCTTTCAAGGTATTTTACCTCAC                                                       ]
[-] EMBL CB651323             [                                                                                    CCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTTGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTTGGCCGCGGCACGCCGCGCCACCCCGGGGCCATTGAGACCTACGTTTTTTCCATGTTCAACGAGAACCAGAAGGACGCCGGCGTTGAGCAGAATTGGGGCCTTTTTTACCCCAACATGCAGCACGTTTACCCCATCAGCTTTTGATGCATTCCGTACACATATACGCATACGTAT GCGTATACGTGACCGCAGGTAGTGTAGTATACACGTACACGTACCTGTACATTACAGTATTGTACAGAGGGCTTGGCTTGCGACCGCTGAGAGGACACGTACCCCAAGTGTACGTTTGTCAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATATACCGTATTATTTCGGTATGTATAGAAGGGAAGCTACAGGTACAAAAT TCGGTACGCTGTGGTAGG GGAATTAGCC CCCATTTTCCCTTCCTAGATTACTATTACTATATAGAGAGGGTTGCAATATATATACATGTATATGTACGT ACTTAGGAGGTGTATTTTGTACGTACCCAGATTGTAATTCTGTACATTTGTACGCCGTAC GTCGAGGTATTTTGCCTCCCGTAG                                                   ]
[-] EMBL CB654107             [                                                                                              CTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACCTACGTTTTCTCCATGTTCAACGAGAACCAGAAGGACGCCGGCGTCGAGCAGAATTGGGGCCTTTTTTACCCCAACATGCAGCACGTTTACCCCATCAGCTTTTGATGCATTCCGTACACATATACGCATACGTAT GCGTATACGTGACCGCAGGTAGTGTAGTATACACGTACACGTACCTGTACATTACAGTATTGTACAGAGGGCTTGGCTTGCGACCGCTGAGAGGACACGTACACCAAGTGTACGTTTGTCAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATATACCGTATTATTACGGTATGTATAGAAGGGAAGCTACAGGTACAAAAT ACGGTACGCTGTGGTAGG GGAATTAGCC CCCATTTTCCCTTCCTAGATTACTATTACTATATAGAGAGGGTTGCAATATATATACATGTATATGTACGT ACTTAGGAGGTGTATTTTGTACGTACACAGATTGTAATACTGTACATTTGTACGCCGTAC GTCGAGGTATTTTTACGCACGTAGGCG TTTGGGAAAAAAAAAAAAAAAAAATAAAAag                ]
[-] EMBL CB650281             [                                                                                                               GCATGTCCGCCTCGCCGGCCAACGCCCGGATGTACAACCAGAACCTCATCAACCAGGTCGGCCGCGGCACGCCGCGCCACCCCGGCGCCATCGAGACATACGTCTTCTCCATGTTCAACGAGAACCAGAAGGACGCCGGCGTCGAGCAGAATTGGGGCCTCTTCTACCCCAACATGCAGCACGTTTACCCCATCAGCTTTTGATGCATTCCGTACACATATAGGCATACGTAT GGGTATACGTGCCCGCAGGTAGTGTAGTATACACGTACACGTACCTGTACATTACAGTATTGTACAGAGGGCTTGGCTTGCGACCGCTGAGAGGACACGTACACCAAGTGTCCGTCTGTCAGAGGCGTACGCGATAGTATATATATTGGGTATATTATATATATACCGTCTTCTTCCGGTATGTATAGAAGGGAAGGTTCAGGTTCAAAAT GCGGTACGCTGTGGTAGGCCGAATTCGCCTCCCATTTTCCCTTCATAGACTCCTATTACTATATAGAGAGGGTTGCAATATATATA                                                                                                                                                        ]
[-] EMBL CB655074             [                                                                                                                                                                                                       CATCGAGACCTATGTCTTCTCCATGTTCAACGAGAACCAGAAGGACGCCGGCGTCGAACATAATTGGGGCCTCTTTTACCCCAACATGCAGCACGTTTACCCCATCAGGTTTTGATGCATTCCGTACACATATACGCATACGTATGGCGTATACGTGACCGCAGGTAGGGTAGTATACACGTACACGTACCTGTACATTACAGTATTGTACAGAGGGCTTGGCTTGCGACCGCTGAGAGGACACGTACACCAAGTGTACGTCTATCAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATATACCGTATTATTTCGGTATGTATAGAAGGGAAGCTACAGGTACAAAAT ACGGTACGCTGTGGTAGG CGAATTAGCC CCCATTTTCCCTTCCTAGATTACTATTACTATATAGAGAGGGTTGCAATATATATACATGTATATGTACGT ACTTAGGAGGTGTATTTTGTACGTACACAGATTGTAATACTGTACATTTGTACGCCGTAC GTCGAGGTATTTTGCCTCAC                                                       ]
[-] EMBL CB676806             [                                                                                                                                                                                                                                                                                                                                                                      CGCAGGTAGTGTAGTATACACGTACACGTACGTGTACATTACAGTATTGTACAGAGGGCTTGGCTTGGGACCGTTGAGAGGACACGTACACCAAGTGTACGTCTGTCAGATGCGTACGCGATAGTATATATATTGGGTATATTATATATATGCCGTATTATTACGGTATGTATAGAAGGGAAGCTACTGGTACAAAATGACGGTACGCTGTGGTAGG GGAATTAGCC CCCATTTTCCCTTCGTAGATTACTATTACTATATAGAGAGGGTTGCAATATATATACATGTATATGTACGT ACTTAGGAGGTGTATTTTGTACGTACACAGATTGTAATACTGTACATTTGTACGCCGTAC GT                                                                         ]


>consensus_17778#5 CGGCACGAGGGTTCGACACCACCGTCGACGCGTTCTACGCCGCCATGGCCAAGCACGGCG GCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCG CCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCA CGCCGCGCCACCCCGGCGCCATCGAGACCTACGTCTTCTCCATGTTCAACGAGAACCAGA AGGACGCCGGCGTCGAGCAGAATTGGGGCCTCTTCTACCCCAACATGCAGCACGTTTACC CCATCAGCTTTTGATGCATTCCGTACACATATACGCATACGTATGCGTATACGTGACCGC AGGTAGTGTAGTATACACGTACACGTACCTGTACATTACAGTATTGTACAGAGGGCTTGG CTTGCGACCGCTGAGAGGACACGTACACCAAGTGTACGTCTGTCAGATGCGTACGCGATA GTATATATATTGGGTATATTATATATATACCGTATTATTACGGTATGTATAGAAGGGAAG CTACAGGTACAAAATACGGTACGCTGTGGTAGGGGAATTAGCCCCCATTTTCCCTTCCTA GATTACTATTACTATATAGAGAGGGTTGCAATATATATACATGTATATGTACGTACTTAG GAGGTGTATTTTGTACGTACACAGATTGTAATACTGTACATTTGTACGCCGTACGTCGAG GTATTTTGCCTCACGTAGGCGTAGGGGAAAAAAAAAGAAAAAATTTAAAAGATTTTACAA AAAAGGAA



consensusID : consensus_17778#6
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 7
consensus length = 777
fasta sequence
                              [TTGTTTTCTNCTCGGCCGTGTNGTGTGGNTTGGNGCTGACNGTGGCCNCCTGTGTCGTNTGCCCNCTGGCTCACGGTCGGTGTCCCTCTTGTGTTCGTGGCGTGTGCCCTCGCNGNGGNGTTCCCCTGCCCGGTCCACGTCCCGGGTTGNTCTGTCCAGNCTNCGTCNCCACTTCNGGGCCTCGGCACGCCGCGCCACCCCGGCGGCTCATTGTAGGACCTACGTGTTCTNCCATGGTTCATCGAGGTACCCGAGTACGCCGGCGTCGAGCAGNATGTGGGGCCTCTTCTACCCCTGACATGCAGCACGTCGACCCCATCTAGCTTTTGATGCATTCCGTACACATATACGCTATACGTATGCGTATACGTGACCGCAGGTAGTGTAGTATACACGTACACGTACCTGTACATTACTAGTATTGTACAGAGGGCTTGGCTTGCGACCGCTGAGAGGACACGTACACCAAGTGTACGTCTGTCAGATGCGTACGCGATAGTATATATATTGGGTATATTATAGTATATACCGTATTATTACGGTATGTATAGAAGGGAAGCTA-CA-GGTAC--AAAATACGGTACGCTGTGGTAGGCGAA--TTAGCCCCCATT-TTCCC-TTC-CTAGA-TTACTA-TTA-CTATATAGAGA-GGGTTGC-AATATATATACA-TGTATATGTACGTACTTAGGAGGTGTATTTTGTACGTACA-CAGAT-TGTAATACTGTACATTTGTACGCCGTACGTCGAGGTATT-TTGCCTCACGTAGGCGTTTGAGAAAAAAAAAAA]

[-] EMBL BM418732             [TTGTTTTCTNCTCGGCCGTGTNGTGTGGNTTGGNGCTGACNGTGGCCNCCTGTGTCGTNTGCCCNCTGGCTCACGGTCGGTGTCCCTCTTGTGTTCGTGGCGTGTGCCCTCGCNGNGGNGTTCCCCTGCCCGGTCCACGTCCCGGGTTGNTCTGTCCAGNCTNCGTCNCCACTTCNGGGCCTCGGCACGCCGCGCCACCCCGGCGGCTCATTGTAGGACCTACGTGTTCTNCCATGGTTCATCGAGGTACCCGAGTACGCCGGCGTCGAGCAGNATGTGGGGCCTCTTCTACCCCTGACATGCAGCACGTCGACCCCATCTAGCTTTTGATGCATTCCGTACACATATACGCTATACGTATGCGTATACGTGACCGCAGGTAGTGTAGTATACACGTACACGTACCTGTACATTACTAGTATTGTACAGAGGGCTTGGCTTGCGACCGCTGAGAGGACACGTACACCAAGTGTACGTCTGTCAGATGCGTACGCGATAGTATATATATTGGGTATATTATAGTATATACCGTATTATTACGGTATGTATAGAAGGGAAGCTA CA GGTAC  AAAATACGGTACGCTGTGGTAGGCGAA  TTAGCCCCCATT TTCCC TTC CTAGA TTACTA TTA CTATATAGAGA GGGTTGC AATATATATACA TGTATATGTACGTACTTAGGAGGTGTATTTTGTACGTACA CAGAT TGTAATACTGTACATTTGTACGCCGTACGTCGAGGTATT TTGCCTCACGTAGGCGTTTGAGAAAAAAAAAAA]
[+] EMBL BI806969             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGTATGTATAGAAGGGAAGCTACCA GGTAC  AAAATACGGTACCCTGTGGTA GCGAA  TTAGCCCCCATT TTCCT TTC CTAGA TTACTA TTACCTATATAGAGA GGGTTGC AATATATATACA TGTATATGTACGTACTTAGGAGGTGTATTTTGTACGTACA CAGAT TGTAATACTGTACATTTGTAC CCGTACGTCGAGGTATT TTGCCTCACGTAGGCGTTTGAGA          ]
[-] EMBL BU667213             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATGTATAGAAGGGAAGCTA CA GGTACAAAAAATACGGTACGCTGTGGTAGGCGAA  TTAGCCCCCATTGTTCCC TTC CTAGA TTACTA TTA CTATATAGAGA GGGTTGC AATATATATACA TGTATATGTACGTACTTAGGA                                                                                                   ]
[+] EMBL BI813077             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGAAGGGAAGCTA CAGGGTAC   AGATACGGTACGCTGTGGTAGGCGAACCCTAGCCCCCATT TTCCCGTTCGCTAGAGTTACTAGTTAGCTATATAGAGA GGGTTGC AATATATATACAGTGTATATGTACGTACTTAGGAGGTGTATTTTGTACGTACA CAGAT TGTAATACTGTACATTTGTACGCCGTACGTCGAGGTATTCTTGCCTCACGTAGGCGTTTGAGAAAAA      ]
[+] EMBL BQ906772             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTAGGCGAA  TTAGCCCCCATT TTCCC TTC CTAGA TTACTA TTA CTATATAGAGA GGGTTGC AATATATATACA TGTATATGTACGTACTTAGGAGGTGTATTTTGTACGTACA CAGAT TGTAATACTGTACATTTGTACGCCGTACGTCGAGGTATT TTGCCTCACGTAGGCGTTTGAGAAAAA      ]
[+] EMBL BM418756             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTA TTA CTATATAGAGA GGGTTGC  ATATATATACA TGTATATGTACGTACTTAGGAGGTGTATTTTGTACGTACA CAGAT TGTAATACTGTACATTTGTACGCCGTACGTCGAGGTATT TTGCCTCACGTAGGCGTTTGAGAAAAAAAAA  ]
[+] EMBL BM420873             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAGAGACGGTTTGCAAATATATATACA TGNATATGTACGTACTTAGGAGGTGTATTTTGTACGTACACCAGATGTGTAATACTGGACATTTGTACGCCGTACGTCGAGGTATT TTGCCTCACGTAGGCGTTTGAGAAAAAA     ]


>consensus_17778#6 TTGTTTTCTNCTCGGCCGTGTNGTGTGGNTTGGNGCTGACNGTGGCCNCCTGTGTCGTNT GCCCNCTGGCTCACGGTCGGTGTCCCTCTTGTGTTCGTGGCGTGTGCCCTCGCNGNGGNG TTCCCCTGCCCGGTCCACGTCCCGGGTTGNTCTGTCCAGNCTNCGTCNCCACTTCNGGGC CTCGGCACGCCGCGCCACCCCGGCGGCTCATTGTAGGACCTACGTGTTCTNCCATGGTTC ATCGAGGTACCCGAGTACGCCGGCGTCGAGCAGNATGTGGGGCCTCTTCTACCCCTGACA TGCAGCACGTCGACCCCATCTAGCTTTTGATGCATTCCGTACACATATACGCTATACGTA TGCGTATACGTGACCGCAGGTAGTGTAGTATACACGTACACGTACCTGTACATTACTAGT ATTGTACAGAGGGCTTGGCTTGCGACCGCTGAGAGGACACGTACACCAAGTGTACGTCTG TCAGATGCGTACGCGATAGTATATATATTGGGTATATTATAGTATATACCGTATTATTAC GGTATGTATAGAAGGGAAGCTACAGGTACAAAATACGGTACGCTGTGGTAGGCGAATTAG CCCCCATTTTCCCTTCCTAGATTACTATTACTATATAGAGAGGGTTGCAATATATATACA TGTATATGTACGTACTTAGGAGGTGTATTTTGTACGTACACAGATTGTAATACTGTACAT TTGTACGCCGTACGTCGAGGTATTTTGCCTCACGTAGGCGTTTGAGAAAAAAAAAAA



consensusID : consensus_17778#7
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 1
consensus length = 755
fasta sequence
                              [GGCGTNGCCCTTTAACTCATTGGCAGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGACAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCATGGAGAACGTCCGGGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCGCCGTCCGCCGCGGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCGCCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCGCTGCTCGCCAACATCTACCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCG]

[+] EMBL CB623132             [GGCGTNGCCCTTTAACTCATTGGCAGCAGCACACACAAACCACATCTCCTATATATAGCTCATTTTTAGCTTTTGGAATTTGACAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCATGGAGAACGTCCGGGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCGCCGTCCGCCGCGGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCGCCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCGCTGCTCGCCAACATCTACCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCG]


>consensus_17778#7 GGCGTNGCCCTTTAACTCATTGGCAGCAGCACACACAAACCACATCTCCTATATATAGCT CATTTTTAGCTTTTGGAATTTGACAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGC CTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGA GGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGT GGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGC GCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCT CTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGC CTACCCGTCGGTGTCGTTCCGGTACGTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCAC GTCCAGCCTGGTCCCGGCCATGGAGAACGTCCGGGGCGCGCTGGTGTCGGCGGGGCTGGG CCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCGCCGTC CGCCGCGGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCGCCCGTCCTGAGCTTCCTCGC CCGCACCGGCGCGCCGCTGCTCGCCAACATCTACCCCTACTTCTCCTACACCTACAGCCA GGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCG



consensusID : consensus_17778#8
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 8
consensus length = 750
fasta sequence
                              [ACACCCTTAAAATCTCCTATATATAGATCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCGCCGTCCGCCGCGGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCGCCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCGCTGCTCG-CCAACATCTACCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCCGGCACCGTCGTCCAGGACGGCG]

[+] EMBL CB668234             [ACACCCTTAAAATCTCCTATATATAGATCATTTTTAGCTTTTGGAATTTGAGAGAGGTTTTGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCGCCGTCCGCCGCGGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCGCCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCGCTGCTCG CCAACATCTACCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCCGGCACCGTCGTCCAGGACGGCG]
[+] EMBL CB643777             [                                                            TGAGCCATATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACAGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGAGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCACGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTCGCCGACGGGAACAAGGTCGCCGGCGGCGCCACGTACAGCCT                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB667018             [                                                                 GAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCAGCGGGGCTG                                                                                                                                                                                                                                                     ]
[+] EMBL CB663946             [                                                                   AATGGCTAGCCAAGGTGTATCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACCACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCCTGGGTGCGGAAC                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB654550             [                                                                                     AGCCTCCCTGTTCGCTCTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCGCCGTCCGCCGCGGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCGCCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCGCTGCTCG CCAACATCTACCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCCGGCACCG               ]
[+] EMBL CB654759             [                                                                                                     CTCGCATTGCTCCTCGGTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCGCCGTCCGCCGCGGAGTTCACCGGCGAGTCGCAGGCGTTCATGGCGCCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCGCTGCTCG CCAACATCTACCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCACCGCCGCCGGCAC                 ]
[+] EMBL CB655176             [                                                                                                          ATTGCTCCTCCCTGCCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGAACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCTGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCATGGAGAACGTCCGCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGGCGCTCCTCGCCGTGTACAGCCCGCCGTCCGCTGCGGAGTTCACCGGCGAGTCACATGCGTTCATGGCGCCCGTCCTGAGCTTCCTCGCCCGCACCAGCGCGCCGCTGCTCGCCCAACATCTACCCCT                                                                                    ]
[+] EMBL CB653175             [                                                                                                                                                                                           GCCGCCCGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGATGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCGTCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGGCGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTCGCCGTCGGGAACGAGGTCGCCGGCGGCGCCACATCCAGCCTGGTC                                                                                                                                                                                                                                                                                                  ]


>consensus_17778#8 ACACCCTTAAAATCTCCTATATATAGATCATTTTTAGCTTTTGGAATTTGAGAGAGGTTT TGAGAGAAATGGCTAGCCAAGGTGTAGCCTCCATGTTCGCTCTCGCATTGCTCCTCGGTG CCTTTGCCTCCATTCCTCAAAAGGCGGAGGCGATCGGGGTGTGCTACGGCATGAGCGCGA ACAACCTGCCGCCGGCGAGCTCGGTGGTGGGGATGTACCGCTCCAACGGCATCACGTCGA TGCGGCTGTACGCGCCGGACCAGGCGGCGCTGCAGTCGGTGGGCGGCACGGGGATCAGCG TCGTCGTCGGCGCGCCCAACGACGTGCTCTCCAACCTCGCCGCCAGCCCCGCCGCGGCGG CGTCGTGGGTGCGGAACAACATCCAGGCCTACCCGTCGGTGTCGTTCCGGTACGTCGCCG TCGGGAACGAGGTCGCCGGCGGCGCCACGTCCAGCCTGGTCCCGGCCATGGAGAACGTCC GCGGCGCGCTGGTGTCGGCGGGGCTGGGCCACATCAAGGTGACGACGTCGGTGTCGCAGG CGCTCCTCGCCGTGTACAGCCCGCCGTCCGCCGCGGAGTTCACCGGCGAGTCGCAGGCGT TCATGGCGCCCGTCCTGAGCTTCCTCGCCCGCACCGGCGCGCCGCTGCTCGCCAACATCT ACCCCTACTTCTCCTACACCTACAGCCAGGGCAGCGTCGACGTCTCCTACGCGCTCTTCA CCGCCGCCGGCACCGTCGTCCAGGACGGCG



consensusID : consensus_17778#9
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 124
consensus length = 750
fasta sequence
                              [GGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG-CCACCCCGGCGCC-A-TCGAGA-CCTACGTC-TTCT-CCATGTTC-A-ACGAGAACCA-GAA-GGACGCCGGCG-TCGAG-CAGAA-TTGGGGCCTC-TTC-T-ACCCC-AACA-TGC-A-GCACGTC-TA-CCCCATCAGC-TTC-TGA-T-GCA-TTCCG-TAC-AC-ATA-TA-CGCA-TAC-GT-A-TGCGTAT-ACGTGA-CC-G-CA-GGTAGTGTA-GTA-TAC-A-C-G-TACA-C-GT-A-CCT-GT-A-CA--TT-A-CA---G-TATTGTA-CA-GA-GGGCTT-GGCT-T-GCG-A-CC-G-CT-GAGAGG-A-CA-CGT-ACA-CCA-A-GTGTA-C-G-T-CT-GTCAG-AT-GCGT-A-C-G-CG-A-TA-G-TATAT-ATA-TTGGGTATA-TT-ATATA-TA-T-A-CCGTATTATT-ACGGTATGTA-TAGAA-GGGAAG-CTA-CA-GGT-A-CAAAATA-CGG-TAC-G-C-T-GTGGTA-GGCG-AA-TTAG-CCCCCA--T-T-TTCCC-TTCCTAGA-TT-AC-TA-TTACTATATAGA-GAG-GG-TT-G-C-A-A-TAT-ATATA-C-A-TGTATATGTACGTACTTAGGAGGTGTA-TTTTGTACGT-ACA-CAG-A-TTGT-AATA-CTG-TACA-TTTGT-A-CG-C-CGT-ACG-TCG-A-GG-TA-TT-TTGCCT-CA-CGTA-GGCGT--TTGAG-AAAAAAAAAGAAAAAATTTAAAAGATTTTACTGCAGCG--AAAAGAAAAAG]

[-] EMBL CB663570             [GGCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAG                                         ]
[-] EMBL CB675242             [ GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAGAAAAAAGAAAAAATTTAAAAGATTTTACTGCACTT  AAAAGA     ]
[-] EMBL CB656313             [ GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT AAG GCG A GG TA TT TTGCCT CA CGTA GGCG   TTGAG AAAAAAAAga                                         ]
[-] EMBL CB654458             [ GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCG   GGGAG AAAAAAAAAGAAAAAATTTAAAAGATT                        ]
[-] EMBL CB654889             [ GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CAA AGG TCG A GG TA TT TTGCCT CA CGTA GGCG   TTGAG CTTAAAAgga                                         ]
[-] EMBL CB654525             [ GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGGG AAAAAAAAAGAAAAAATTTAAAA                            ]
[-] EMBL CB652009             [ GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTCCCT CA CGT    CTTAAAGGAG AAAAAAAA                                           ]
[-] EMBL CB644214             [ GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAGAAAAAAAAAAGAAAAAATTTA                               ]
[-] EMBL CB672945             [ GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTT T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGAAAAAATTTA                               ]
[-] EMBL CB657465             [ GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTG TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTG TA CCCCATCAGC TTG TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T C CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGAAAAAATTT                                ]
[-] EMBL CB653518             [ GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT AGG TCG A GG TA TT TTGCCT CA CGTA GGCGT  Tga                                                      ]
[-] EMBL CB658540             [ GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA                                                                 ]
[-] EMBL CB647656             [ GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA                                                                 ]
[-] EMBL CB671434             [ GCCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAga                                         ]
[-] EMBL CB673907             [  CCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTAAA AGAAAAAAAGAAAAAATTTAAAAGATTTTCCTG                  ]
[-] EMBL CB647067             [  CCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C AGG GCG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTG                                                      ]
[-] EMBL CB669140             [  CCAAGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGAG   GGGAG AAAAAAAAAGAAAAA                                    ]
[-] EMBL CB652514             [     AGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATGTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGAG   GGGAG AAAAAAAAAGAAAAAATTTAAAAGATTT                       ]
[-] EMBL CB649730             [     AGCACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGAAAAAATTTA                               ]
[-] EMBL CB631195             [        ACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACCGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGAAAAAATTTA                               ]
[-] EMBL CB663991             [        ACGGCGGCTCCGGCGTCTCCCTCGTCGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGAAAAAATTTAAAAGATTTTAC                    ]
[-] EMBL CB652446             [             GGCTCCGGGGTCTCCCTCGTCGTGTCCGAGACAGGATGGCCCTCCGCCGGCGGCATGTCCGCCTTGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGGG CCACCCCGGCGCC A TAGAGA CTTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAAAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCAGGTA TA CCCCATCAGC TTG TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT T CCT GT A CA  TT T CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACC CCA A GCGTC C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT CCGGTATGTA TAGAA GGGAAG CTT CA GGT A CAAAATA CAG TAC G C T GTGGTA GGTG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TCGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CT TTAA GGGGG  TTG                                                      ]
[-] EMBL CB654130             [                                 CGTCTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT AAG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTG G AAATAAAAgag                                        ]
[-] EMBL CB646793             [                                    CTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGAAAAAAT                                  ]
[-] EMBL CB623131             [                                    CTCCGAGACCGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATGTACAACCAGAACTTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TAGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTA TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACC C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TC G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTCCGT TCA CTG A TTGT AATT CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CC CTTA AAGGG  TTGAG AAAAAAA                                            ]
[-] EMBL CB649668             [                                    CTCCGAGACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TGGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTT TTT T ACCCC AACA TGC A GCACGTT TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T TT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGGG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAG                                         ]
[-] EMBL CB655143             [                                          GACAGGCTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAGTA TTGT AATACCTG TACACTTTGT A CG CACGTAACG TCG A GGATA TT TTGCCT CA CGTA GAGGT  TTGAG AAAAAAAAAGAAAAAATTTAAAAGATTTTAaagg                 ]
[-] EMBL CB669094             [                                                CTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GAAGG  TTGAG AAAAAAAAAGA                                        ]
[-] EMBL CB672073             [                                                CTGGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TNGAGA CCTACGTT TTTT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTT T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGAAAAAATTTA                               ]
[-] EMBL CB652445             [                                                  GGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAAAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC C CT GAGAGG A CA CGT ACC CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T C CCGTATTATT CCGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATT CGG TAC C C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGACGAG GG TT G C ACA TAT ATATA C ACTGTAc                                                                                                                                                                                  ]
[-] EMBL CB627032             [                                                  GGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGAAAAAATTTAAAAGATTTTACTGCTGCGt            ]
[-] EMBL CB661989             [                                                  GGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGAAAAAATTTA                               ]
[-] EMBL CB618483             [                                                  GGCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTT TAAG   GTGAG AAAAAAAAA                                          ]
[-] EMBL CB675830             [                                                   GCCCTCCGCCGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TAGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTT T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGAAAAAATTTA                               ]
[-] EMBL CB662859             [                                                            CGGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATCTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGGAAAAATTTAAAAGATTTTACTGCTGCGTCAAAAAAAAAAG]
[-] EMBL CB645016             [                                                             GGCGGCATGTCCGCCTCGCCGGCCAACGCCCGGATGTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A GGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A C  C CTTAAAG GCG A GG TA TT TTGCCT CC CGT                                                                  ]
[-] EMBL CB652014             [                                                                    TGTCCTCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACTTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TT                                                                                                                                                         ]
[-] EMBL CB668880             [                                                                    TGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TTGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTT T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TT AG AAAGAGAAAGAAAAAATTTA                               ]
[-] EMBL CB654760             [                                                                    TGTCCGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CCTG CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TTC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT TA TA TTAGTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATACCTACGTACTTAGGAGGGGTA TTTTGTTCGT ACA CAG A TCGT AATA CTG TACA TTTGT C CT C CGC ACG TGG A GG TA TT TTGCCT CA CCTA GGCGT  TTAAG GGAAAAAAA                                          ]
[-] EMBL CB663947             [                                                                        CGCCTCGCCGGCCAACGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGNGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGAAAAAATTTAAAAGATTTTAC                    ]
[-] EMBL CB648317             [                                                                           CTCGCCGGCCAACGCCCGGATTTACAACCAGAACTTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGAG   GGGAG AAAAAAAAAGAAAAAATTTAAAAGATTTTtataaaggg             ]
[-] EMBL CB642859             [                                                                                   CCAACGCCCGGATGTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGGGCC A TGGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTG T ACCCC AACA TGC A GCAGGTT TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGG CC G CA GGTAGTGTA GTA TAC A C G TACA G GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGATT GGCT T GCC A CC C CC GAGAGG A CA CGT ACC CCA A TCGTA C G T GT GTCAG AT GATT A C G GG A TA G TATAT ATA TT                                                                                                                                                                                                                                                                                                                                                                                          ]
[-] EMBL CB653420             [                                                                                       CGCCCGGATTTACAACCAGAACCTCATCAACCACGTCGGCCGCGGCACGCCGCG CCACCCCGGGGCC A TAGAGA CATACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTT TTT T ACCCC AACA TGC A GCAGGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GTG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGAG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AG TA TTCCTATATAGA GAG GG TT G C A A TAT ATATA C A CGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GG                                                              ]
[-] EMBL CB647489             [                                                                                       CGCCCGGATGTACAACCAGAACCTCATCAACCACGTCGGCCGGGGCACGCCGCG CCACCCCGGCGCCAA TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA T                                                                                                                                                          ]
[-] EMBL CB652001             [                                                                                                                 TCAACCACGTCGGCCGAGGCACGCCGTG CCACCCCGGCGCC A TGGAGA CTTATGTC TTTT CCATGTTC A ACGAGACCCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTA TA CCCCATCAGG TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GTG A CC G CT GAGAGG C CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T G CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTC CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCTTAGA TT AC TA TTTCTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTCGT A CG C CGT TCG TCG A G                                                                                       ]
[-] EMBL CB647881             [                                                                                                                             GCCGCGGCACGCGGCG CCACCCCGGCGCC A TTGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTG TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT aa gggt                                                                 ]
[-] EMBL BI807879             [                                                                                                                                 ccGCAC CCGCGCCCACCCCGGC CC A TCGAGA CCTACGTC TTCT CCATGTTC ACACGAGAACCA GAA GGAC CCGGCG TCGA  CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCC A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CCAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACACTTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA G                                                               ]
[+] EMBL BM419447             [                                                                                                                                  gtCACGCCGCG CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT ACCAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT Aaaaaaaaaa                                                                                                                                      ]
[-] EMBL CB646047             [                                                                                                                                       GCCGCG CCACCCCGGCGCC A TCGAGA CTTTCGTA TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC CACA TGC A GCAAGTC TT CCCCATCAGT TTG TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T TCG A CC G CT GAGAGG A CA CTT ACA CCA A GTGTA C G T CT GTCAG AC GCGT C C GCCG A TA G TATAT ATA TTGGGCATA TT ATATA TA T T CC                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL BI813039             [                                                                                                                                           CG CCACCCCGGC CC A TCGAGA CCTACGTC TTCT CCATGTTC A CCGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGCCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAA                                             ]
[-] EMBL CB636296             [                                                                                                                                              CCACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAG                                         ]
[-] EMBL CB638861             [                                                                                                                                               CACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGAAAAAATTTA                               ]
[+] EMBL BQ907950             [                                                                                                                                               CACCCCGGCGCC A TCGAGA CCTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGCCCTC TTC T ACCCC GACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A C AAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A C  C CGT ACG TCG A GG TA TT TTCCCT CA CGTA GGCG   TTGAG AAAAAA                                             ]
[+] EMBL BM421778             [                                                                                                                                                cCCCCGGCGCC A TCGAGACCCTACGTG TTCTCCCATGTTCNA CCGAGAACCACGAAGGGAC CCGGCGTTCGAC CAGAA ATTGGGCCTC GTC TGACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T  CA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G NACA C GT A CCT GT A C   TT A C    G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACC CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA TCA CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CCAAATA CGG TAC G C T GTGGTA GGCG AA TNAG CCCCCACGT G TTCCC TGCCTAGA TTGAC TA NTACTATATAGA GAG GG TT   C   A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGTGA C  C CGT ACG TCG A GG TA TT TT CCT CA CGTA GGCGT  TTGA                                                     ]
[-] EMBL CB647594             [                                                                                                                                                  CCCGGGGCC A TTGAGA CCTACGTT TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCTAG CAGAA TTGGGGCCTC TTT T ACCCC AACA TGC A GCACGTC TA CCCCATCAGA TTG TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCC GT G CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG T CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGAG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATC CCG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGACAAAATTTTAAAG                           ]
[+] EMBL BM038421             [                                                                                                                                                   CCGGC CC   TCGAG   CTACGTC TTCG CCATGTTT C ACGAGAACCA GAA GGACGCCGGCG TCGA  CAGAA TT GGGCCTC TTC T ACCCC AACA TGC A GCACGTN TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CAC TT A CA   G TATTGTA CACGA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A C AAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCC   T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C   A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A C  C CGT ACG TCG A GN TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAA                                             ]
[+] EMBL BI813532             [                                                                                                                                                        GCC ATTCGAGA CCTACGTCTTTCT CCATG TC C ACGAGAACCC GAA GGACCCCGGC  TCGAG CAGAA TTGGGCCCTC TTC T ACCCC AACA T C A GCACGTC TA CCCCATCAGC TTC TGA T  CA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC   CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACACCCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A C AAATA CGG TAC G C T GTGGTA  GCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT   C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACC CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT CTCCCT CA CGTA GGCGT  TTGAG AAAAA                                              ]
[+] EMBL BI812005             [                                                                                                                                                                 AGA  CTACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGAC CCGGCG TCGA  CAGAA TTGGGCCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAA                                              ]
[-] EMBL CB669589             [                                                                                                                                                                       TACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGAAAAAATTTAAAAGAT                         ]
[+] EMBL BQ908960             [                                                                                                                                                                       TACGTC TTCT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAA                                              ]
[+] EMBL BQ906694             [                                                                                                                                                                                CT CCATGTTC A ACGAGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC TACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGNGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCACA GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAA                                             ]
[+] EMBL BI808961             [                                                                                                                                                                                    CATG TC A ACGGGAACCA GAA  GACGCCGGCG TCGAC CAGAA TT GGCCCTC TTC T ACCCC GACA TGC A CCACGT  TA CCCCATCAGC TT  TGA   GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAA                                          ]
[+] EMBL BM419212             [                                                                                                                                                                                              ACGAG ACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGCCCTC TTCGT ACCCC TACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA TNC CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT N C A A TAT ATATACC A TGTATATGTACGTACTTAGGAGGTGTA TTTGGTACGT ACACCAG A TNGT AATA CGGATACA TTTGT A C  C CGT ACG TCG A GC TA TT TTCCCT CA CGTAGGGCGT  TGGAG AAA                                                ]
[+] EMBL BI812478             [                                                                                                                                                                                               CGAGAACCA GAA GGACGCC GCG TCGA  CAGAA TT TGGCCTC TTC T ACCCC  ACA TGC AGGCACGT  TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A C AAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCAC T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C   A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  CTGAG AAAAAAAAAGAAAAAATTTAAAAa                           ]
[-] EMBL CB636947             [                                                                                                                                                                                                 AGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTAAATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGAAAAAATTTA                               ]
[-] EMBL CB676356             [                                                                                                                                                                                                 AGAACCA GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCAGGTG TA CCCCATCAGC TTG TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGG CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T G CCGTATTATT GCGGTATGTA TAGAA GGGAAG TTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGAG AA TTAG CCCCCA  T T TTCCC TTCTTAGA TT AA TA TTGGTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTGCGTACTCAGGAGGTGTA TTTTGTTCGT ACA                                                                                                                                             ]
[-] EMBL CB637654             [                                                                                                                                                                                                       A GAA GGACGCCGGCG TCGAG CAGAA TTGGGGCCTC TTT T ACCCC AACA TGC A GCACGTN TA CCCCATCAGC TTT TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T TT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCTCCA CGTA GGCGT  TTGAG AAAAAAAAAGAAAAAATTTA                               ]
[+] EMBL BQ906431             [                                                                                                                                                                                                         GAA GGACNCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATACTTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAACGGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA  GCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACGTTCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAA                                              ]
[+] EMBL BQ908834             [                                                                                                                                                                                                         GAA GGACGCCGGCG TCGAGNCAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTCNTA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGACCC GCCACGGTAGTGTA GTA TAC ACC G TACACC GT ACCCT GT A CAC TT A CA   G TATTGTACCACGA GGGCTT GGCT T GCG ACCC GCCTCGAGAGGAA CACCGTAACACCCANA GTGTANC GTT CTGGTCAG ATGGCGTAA C GCCG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT ACCAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C ACTGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGTAACACCAG A TTGT AATA CTG TACACTTTGT A CGCC CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAa                                         ]
[+] EMBL BI812531             [                                                                                                                                                                                                           A GGAC CC GCG TCGA  CAGAA TT GGGCCTC TT  T ACCCC AACA TGCAA GCACGT  TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A C AAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GA  GG TT   C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAA                                             ]
[+] EMBL BM038788             [                                                                                                                                                                                                             GGAC CC GCG TCGA  CAGAA TT GGGCCTC TTC T ACCCC  ACA T C A GCACGTC TA CCCCATCAGC TTC TGA T  CA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC   CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CCAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCC   T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAA                                             ]
[+] EMBL BQ908674             [                                                                                                                                                                                                                CGCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC GACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTNGTACGT ACA CAG A TNGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAA                                                ]
[+] EMBL CB661861             [                                                                                                                                                                                                                 GCCGGCG TCGAG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGAAAAAATTT                                ]
[+] EMBL BI803432             [                                                                                                                                                                                                             cgtgcCCGGCT TCGAC CAGAATTTGGGCCCTC TTC TGACCCC AACAGTGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC   CA GGTAGTGTA GTATTAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACACCCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A C AAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT   C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A C  C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAA                                             ]
[+] EMBL BQ906184             [                                                                                                                                                                                                                   CGGCG TCGA  CAGAA  TGGGGCCTCGTTCGT ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC GCCT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAGTCTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TTCTTGCCT CA CGTA GGCGT  TTGAG AAAAAA                                             ]
[-] EMBL CB618712             [                                                                                                                                                                                                                    GGCG TTGAG CAGAA TTGGGGCCTA TTT T ACCCC AACA AGC A GCACGTA TA CCCCATCAGC TTA TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT CCGCGT CC G CA GGTAGTGTA GTA TAC T C G TACA C GT G CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT C GCG A CC G AT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG ATA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGAG AA TTAGACCCCCA  T T TTCCC TTCTTAGA TT AG TA TTCCTATTTAGA GAG GG TT G C A A TAT ATATC C A TGTATATGTACGTTCTTAGGAGGTGTA TTTTGTACGT ACC CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TAG A GG TA TT TTGCCT CA CGTA GGCGT  CCGAG AACAAAAAAG                                         ]
[+] EMBL BM420388             [                                                                                                                                                                                                                     GCG TCGA  CAGAA TTGGGGCCTC TTC T ACCCC GACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTACCACGA GGGCTT GGCT T GCG A CC GCCT GAGAGG A CA CGT ACC CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CCAAATA CGG TAC G C T GTGGTA GCCG AA TTAG CCCCCC  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT   C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A C  C CGT ACG TCG ACGG TN TT TT CCT CACCGTA GGCGT  TTGAG AAAAA                                              ]
[+] EMBL BI812173             [                                                                                                                                                                                                                       G TCGA  CAGAA TT GGGCCTC TT  T ACCCC AACA TGC A GCACGTCGTA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A C AAATA CGG TAC G C T GTGGTA GCCG CA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT   C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TCGCCT CACCGTA GGCGT  TTGAG AAAAA                                              ]
[+] EMBL BI811748             [                                                                                                                                                                                                                            AG CAGAA TTGGGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C   CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CCAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACC CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CACCGTA GGCGT  TTGAG AAAAAA                                             ]
[+] EMBL BM418942             [                                                                                                                                                                                                                            ac CAGAA TTGGGGCCTC TTC T ACCCC  ACA T C A GCACGTC TA CCCCATCAGC TTC TGA T GCACTTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC   CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CC  TT A CA   G TATTGTA CACGA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CACGGT A CNAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCC  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT   C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACN TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAA                                             ]
[+] EMBL BQ906785             [                                                                                                                                                                                                                               CAGCA TTGGGGCCTCGTTN T ACCCCGTACA TGC A GCACGTT TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTATAACGTGAGCC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CAC TTCA CA   GATATTGTA CA GACGGGCTT GGCTAT GCGCA CC GTCT GAGAGG ACCA CGT ACACCCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TACG TATAT ATACTTGGGTATA TT ATATA TA T ATCCGTATTATTCACGGTATGTA TAGAA GGGAAG CTA CACGGT A CAAAATA CGG TAC GAC T GTGGTACGGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAGCGGCTT G C A ACTAN ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG ACTTGT AATA CTG TACA TTTGT ATCA C CGT ACT TCG A GGCTA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAA                                             ]
[+] EMBL BI810680             [                                                                                                                                                                                                                                        GGGCCTC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CACGGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C   CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACC TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAA                                             ]
[+] EMBL BM421647             [                                                                                                                                                                                                                                           CCTC TTC T ACCCC GACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAA                                             ]
[-] EMBL CA752593             [                                                                                                                                                                                                                                             TC TTC T ACCCC AACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTG  CC G CA GGTAGTGTA GTA TAC A CGG TACA CGGT A CCT GT A CA  TT   CA   G TATTGTA CA GA GGGCTT GGCT T GCG   CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCC A GG TA TT TTGCCT CA CGTA GG                                                              ]
[+] EMBL BI813032             [                                                                                                                                                                                                                                              C TTC T ACCCC TACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATATTA CGCA TAC GT A TGCGTAT ACGTGA CCTG CATGGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC T CT GAGA G A CA CGT ACA CCA A GTGTA CGG TGGTGGGCAG AT TCGT A C   CG A TA G TATAT ATATTTGGGTATA TT ATATA TA T A CCGTATTAGT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TT                                                       ]
[-] EMBL BU667318             [                                                                                                                                                                                                                                                  C T ACCCC  ACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC   CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A C   TT A CA   G TATTGTA CC GA GGGCTT GGCT T  CG A CC   CT GAGAGG A CA CGT AC  CCC A GTGTA C G T CT GTCAG AT GCGT A C   CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T   CCGTATTATT  CGGTATGTA TAGAA GGGAA  CTA CA GGT A C  AATA CGG TAC   C T GTGGTA  GCG AA TTA  CCCCC     T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GA  GG TT   C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT AC  C G A TTGT AATA CTG TAC  TTTGT A C  C C T AC  TCG A GG TA TT TT CCT CA C                                                                    ]
[+] EMBL BM419686             [                                                                                                                                                                                                                                                    T ACCCC  ACA TGC A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCGCAA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAA                                              ]
[-] EMBL CB637575             [                                                                                                                                                                                                                                                                     A GCACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG CAC AC ATA AA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA C A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A CG C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAAAAAGAAAAAATTTA                               ]
[+] EMBL BI807706             [                                                                                                                                                                                                                                                                    cg GCACGTT TACCCCCCTCAGC TTC TGAGT GCA TTCCG GAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC C CC GGTAGTGTA GTA TAC A C G TACA C GT A CCT GG A CC  TT A CC   G TATTGTA CC GA GGGCTT GGCT T GCG A CC C CT GAGAGG A CA CGT ACC CCC A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA TCA CCGTATTATT  CGGTATGTA TAGAA GGGA   CTA CA GGT A CCAAATA CGG TAC   C T GTGGTA GGCG AA TTAG CCCCCC  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C C A TAT ATATA C A  GTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACC CAG A TTGT AATA CTG TACA TTTGT A CC C CCT ACC TCGCA GG TA                                                                                   ]
[+] EMBL BI803145             [                                                                                                                                                                                                                                                                       aCACGTC TA CCCCATCAGC TTC TGA TCGCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC C CA GTTATTTTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A CAAAATA CGG TACAG CAT GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTACTTAGGAGGTGTA TTTTGTACGT ACA CAG A TTGT AATA CTG TACA TTTGT A C  C CGT ACG TCG A GG TA TT TTGCCT CA CGTA GGCGT  TTGAG AAAAAA                                             ]
[+] EMBL BM419673             [                                                                                                                                                                                                                                                                        CACGTC TA CCCCATCAGC TTC TGA T GCA TTCCG TAC AC ATA TA CGCA TAC GT A TGCGTAT ACGTGA CC G CA GGTAGTGTA GTA TAC A C G TACA C GT A CCT GT A CA  TT A CA   G TATTGTA CA GA GGGCTT GGCT T GCG A CC G CT GAGAGG A CA CGT ACA CCA A GTGTA C G T CT GTCAG AT GCGT A C G CG A TA G TATAT ATA TTGGGTATA TT ATATA TA T A CCGTATTATT ACGGTATGTA TAGAA GGGAAG CTA CA GGT A C AAATA CGG TAC G C T GTGGTA GGCG AA TTAG CCCCCA  T T TTCCC TTCCTAGA TT AC TA TTACTATATAGA GAG GG TT G C A A TAT ATATA C A TGTATATGTACGTAC