Home
Who am I
Technology
EST Assembly
Contact

These datas are free for academic use only, please contact me for any other use.

Oryza sativa
cluster # 17800 cluster # 17800       Sequences # 1316       consensus # 2


see consensus multiple alignment with clustalw

Direct access to contigs :
consensus_17800#0 length = 3808 sequences # 1190  
consensus_17800#1 length = 702 sequences # 126  

consensusID : consensus_17800#0
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 1190
consensus length = 3808
fasta sequence
                              [CGTAAAATTGCTCAAATCCAAAAAGACACCATACGTTACTGCCAATACACAATCCAACACCCCAACACCTGGGCTACATCTGCTGTTTCTGTCTACCTGAGAGAGAGTACCTTGAACAATATTGATCTATTCGAACAAGGGAATGTTCATATTTCCCT-GGTTGCAAAAGAAATACAAGC-TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC-AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA-GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG-CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA-CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAATCTGTCTGATCAGCTTCCACTCCTTGATCAGTATTCTCGTCTCCTGCTGTAGGTGCATCACACTCGCCACGTGTGTCAAGATTTTTGTGGTCCCGACCCTTGGGAATAGAATCTGTGTCAAGCTCTACGGGATCCTGGACCTCACAAATAGAAGGATCAGGAACATCTGTACTCTGATTCAACACAGAACATTCCACTCCAGTCTCAGTGCAGCTGACATTGCCACCATATTCTTTGGGCTCAATCTTGGTGGATCCATCTTCACACTCGGTTATGGTATCCCCTGTAGTGTTGTCACTGCTAGCAGGGTACTTTACGACATTTATGGATTTCACAGCTCCAAACCTTGCACACTCCACACGTACATCTTC-CAATATTTCCTCCAGCTCAGATTTTGAGAGTAGCAAATACTCTTCTTGGTCAAACACATTTTTTAGCTGCAGGACTTTTGTTGGTTCTTCAAGTAGTGATTTGGCACTGTCAGGAATTCCATAAAATGGGGAAGCTTCATTAAAAGCCTGCTCGGTAGAGTTAGGGAACACATTAACAGCAGTTAGGATGCCTCCACCAAGCTTCATCCCATTGAGGCCAGCACATGCCTTCGATGTAATGGAGTGATCAATGTACTCAAGAAATGCACATGCCCCACCAAGGTATTCATTAAAAAGAAAGCGGTAAGCAGCCAACGGACCAAATGAACTAACAATTTCCATGAGCATCTCAGATGAAATCACTCCAGAAATCCCAGCGATGAAAATCTTGTGTGGTGAATCTGCAACAACATCGGATATCAATTTAATCTCTTCAGAAGGCTTCTTAGGAGCAACATGTTGAACCATGTTGTGCAAGCTGTCTTCCTAATTTTTCCATGAACTGAGCACCATAAGGACTCTGCCAGCAGTGTAATCAGCAACCAATAATTCTGGAAGAAGCAGCAGTCACATAATATTGACATTACACCTTGAATCCTGCTTAAAAAATCCTTTGCTTCACCATCCTGAACGTGAATTATGACATACCCAATTAAAATACCTGCCATTTCAACATATTCTTTGGGGCGTCTAATTTTCAAAGAAGATCCACCAAAAGACCGTCCGTCAAAAGAAAGAGCTGCTGTAGCATCCTCTGGTGTAAGAAATTCAACAAAGGCCTGACGTTTGTCCTTGTTTATCACACAACTGAGGCATGGTTGTTTGGACCTCTGGATATGGCTCGCACTAGATGACAGCAAGAACTCATTCAAGCAGCCAATCAGCATGTCTTCTGTGGCTAAAC-TTGGTAGATTTTCAATGTGCAATCTCCTGAGTGGTCGGGTTGCTTGTGTCAGCTGGACAGAATCAACAGCCAAATTACTCCCTGTCAATATAGTTCCAATTGTAGTGTTTGGGTCCTGCTTCGATGTGGTAAAATTGACTGGAACAGTGGAATCCTTTAGACCAACCGTTGACTGCAAAGTGGTAACAAAATTAGATAGATCTGTTGCCACAGGAAGCTGATCCCATGTGGCTGATTTCTTTTCTGGAGACCGAATAACCAGAGAAGCAGTCTTGATAGTTGTCTGTTCATCTTTTGGTGCTGTTTTCCTTTTCCTTGGTGAATATCCACCAAGCCGACTTTCATATCTCCGGTAAGATCCACTACTGTATCCATCATTCCAAGATGTTCTATGTCTGTCAGTTTCAAAATGCTTCCTTCTTGATTTGTCCATGGAGTGATATGGAGGATAATAATCATGGCCATGTCCACGATAGCTATGCCTTTGTTCTCTTGAGGATGGTGAGACAGACCTGTCATGTCTTTCTTGATAATGATCCCTGCTTGTCGACCTTCTCCTTTTTGACCTGGGCTCTTCATGGTGCAGTTTTGCATTCTCTTTCCTCCCGCCTTTTCTATCAAAATGTCTGGGATCTTGTAATCGCACAGCATCTTGTTTCTTCAGTGTGGGTCGATCAACCTGAGAACTCTTCTCATCATCAAAGCCACGGCTATTTCTCTTTCCATCAGTTCGCCTCTCACTCCTCTCCTTGATTCTATCATTACCAACTGGTTCATCAATCCATCTTTTCCCAGGTCTTTTTTGGGATTCCTGTATTGTTGCATCACCGTCTCTTGCTGTAATCTCACCATGGTTTCCACCTCTGCTTTTGCCAACTCGACCACTCGTGTATGTGCTAAGCTTATGAGAATTATGATTGCCTTTGTCTTTGTCAACTAAATGACTATCATCTCTTGTGGAGGACCGCTCTTTCTTGGAGCTCTTCTTTGGTGCATCTCTTTGATCATCTTTCGATGGGACCTTCACTTTAACTTTCAAGTTATCTATCTTGGAGATGTCTTTTGGCCTATCTTTCAGGTTGTCTTTCTTGGAGACCTCTCTTTGCATATCTCTCATGTTGTCCTTTCTACGCTCTTCCCTTGGCGTATGTCTCATTTCATCCTTCTTGGAACCCTCCCCTGGTTTATCACTATTATCCTTTTTGGAGCCCTCCAAGGGCATTTCTCTGACATCCTTTCTGCTTTTGGACCCTCTTCCTGATTCCAGATGATTGGATTTACCATTACTGTTCTCTTCGAGCCCTTCCTTGGTTTTCTTAGCTTCTGAAGCGGTTTTCTTTTCACGACGCGACATGATATCCTGAATGCTCAAAGGCCTTGTGCGAGCAGCCGTCCCATCACTAGTGATTCTCCTAGAATCCTTTTCGTTCTGTACTCTTCTACTCATCTTGCCCCGAAACCAGGAATTTGGACAAGATAATGAGGTCCTAAATTATTTGAGTTAGCATAACCAGAGGATCATGACAAGAGCAGTGCCTCTTCTTC--------CTGGGGAGAGCGGAGGCGGAAGCGGGTGGCAGCAGGACGCTGAAATCCCGGCGCGGTGGCGGCGGCGCGGGTGGTGGCCGCGGGGGATTGGCTCCGCCGCGCGATCCCTTCTCCTCTCTCCGCTCCGGGCTCCTCCGCC]

[-] EMBL AK066407             [CGTAAAATTGCTCAAATCCAAAAAGACACCATACGTTACTGCCAATACACAATCCAACACCCCAACACCTGGGCTACATCTGCTGTTTCTGTCTACCTGAGAGAGAGTACCTTGAACAATATTGATCTAATCGAACAAGGGAATGTTCATATTTCCCT GGTTGCAAAAGAAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCTCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAATCTGTCTGATCAGCTTCCACTCCTTGATCAGTATTCTCGTCTCCTGCTGTAGGTGCATCACACTCGCCACGTGTGTCAAGATTTTTGTGGTCCCGACCCTTGGGAATAGAATCTGTGTCAAGCTCTACGGGATCCTGGACCTCACAAATAGAAGGATCAGGAACATCTGTACTCTGATTCAACACAGAACATTCCACTCCAGTCTCAGTGCAGCTGACATTGCCACCATATTCTTTGGGCTCAATCTTGGTGGATCCATCTTCACACTCGGTTATGGTATCCCCTGTAGTGTTGTCACTGCTAGCAGGGTACTTTACGACATTTATGGATTTCACAGCTCCAAACCTTGCACACTCCACACGTACATCTTC CAATATTTCCTCCAGCTCAGATTTTGAGAGTAGCAAATACTCTTCTTGGTCAAACACATTTTTTAGCTGCAGGACTTTTGTTGGTTCTTCAAGTAGTGATTTGGCACTGTCAGGAATTCCATAAAATGGGGAAGCTTCATTAAAAGCCTGCTCGGTAGAGTTAGGGAACACATTAACAGCAGTTAGGATGCCTCCACCAAGCTTCATCCCATTGAGGCCAGCACATGCCTTCGATGTAATGGAGTGATCAATGTACTCAAGAAATGCACATGCCCCACCAAGGTATTCATTAAAAAGAAAGCGGTAAGCAGCCAACGGACCAAATGAACTAACAATTTCCATGAGCATCTCAGATGAAATCACTCCAGAAATCCCAGCGATGAAAATCTTGTGTGGTGAATCTGCAACAACATCGGATATCAATTTAATCTCTTCAGAAGGCTTCTTAGGAGCAACATGTTGAACCATGTTGTGCAAGCTGTCTTCCTAATTTTTCCATGAACTGAGCACCATAAGGACTCTGCCAGCAGTGTAATCAGCAACCAATAATTCTGGAAGAAGCAGCAGTCACATAATATTGACATTACACCTTGAATCCTGCTTAAAAAATCCTTTGCTTCACCATCCTGAACGTGAATTATGACATACCCAATTAAAATACCTGCCATTTCAACATATTCTTTGGGGCGTCTAATTTTCAAAGAAGATCCACCAAAAGACCGTCCGTCAAAAGAAAGAGCTGCTGTAGCATCCTCTGGTGTAAGAAATTCAACAAAGGCCTGACGTTTGTCCTTGTTTATCACACAACTGAGGCATGGTTGTTTGGACCTCTGGATATGGCTCGCACTAGATGACAGCAAGAACTCATTCAAGCAGCCAATCAGCATGTCTTCTGTGGCTAAAC TTGGTAGATTTTCAATGTGCAATCTCCTGAGTGGTCGGGTTGCTTGTGTCAGCTGGACAGAATCAACAGCCAAATTACTCCCTGTCAATATAGTTCCAATTGTAGTGTTTGGGTCCTGCTTCGATGTGGTAAAATTGACTGGAACAGTGGAATCCTTTAGACCAACCGTTGACTGCAAAGTGGTAACAAAATTAGATAGATCTGTTGCCACAGGAAGCTGATCCCATGTGGCTGATTTCTTTTCTGGAGACCGAATAACCAGAGAAGCAGTCTTGATAGTTGTCTGTTCATCTTTTGGTGCTGTTTTCCTTTTCCTTGGTGAATATCCACCAAGCCGACTTTCATATCTCCGGTAAGATCCACTACTGTATCCATCATTCCAAGATGTTCTATGTCTGTCAGTTTCAAAATGCTTCCTTCTTGATTTGTCCATGGAGTGATATGGAGGATAATAATCATGGCCATGTCCACGATAGCTATGCCTTTGTTCTCTTGAGGATGGTGAGACAGACCTGTCATGTCTTTCTTGATAATGATCCCTGCTTGTCGACCTTCTCCTTTTTGACCTGGGCTCTTCATGGTGCAGTTTTGCATTCTCTTTCCTCCCGCCTTTTCTATCAAAATGTCTGGGATCTTGTAATCGCACAGCATCTTGTTTCTTCAGTGTGGGTCGATCAACCTGAGAACTCTTCTCATCATCAAAGCCACGGCTATTTCTCTTTCCATCAGTTCGCCTCTCACTCCTCTCCTTGATTCTATCATTACCAACTGGTTCATCAATCCATCTTTTCCCAGGTCTTTTTTGGGATTCCTGTATTGTTGCATCACCGTCTCTTGCTGTAATCTCACCATGGTTTCCACCTCTGCTTTTGCCAACTCGACCACTCGTGTATGTGCTAAGCTTATGAGAATTATGATTGCCTTTGTCTTTGTCAACTAAATGACTATCATCTCTTGTGGAGGACCGCTCTTTCTTGGAGCTCTTCTTTGGTGCATCTCTTTGATCATCTTTCGATGGGACCTTCACTTTAACTTTCAAGTTATCTATCTTGGAGATGTCTTTTGGCCTATCTTTCAGGTTGTCTTTCTTGGAGACCTCTCTTTGCATATCTCTCATGTTGTCCTTTCTACGCTCTTCCCTTGGCGTATGTCTCATTTCATCCTTCTTGGAACCCTCCCCTGGTTTATCACTATTATCCTTTTTGGAGCCCTCCAAGGGCATTTCTCTGACATCCTTTCTGCTTTTGGACCCTCTTCCTGATTCCAGATGATTGGATTTACCATTACTGTTCTCTTCGAGCCCTTCCTTGGTTTTCTTAGCTTCTGAAGCGGTTTTCTTTTCACGACGCGACATGATATCCTGAATGCTCAAAGGCCTTGTGCGAGCAGCCGTCCCATCACTAGTGATTCTCCTAGAATCCTTTTCGTTCTGTACTCTTCTACTCATCTTGCCCCGAAACCAGGAATTTGGACAAGATAATGAGGTCCTAAATTATTTGAGTTAGCATAACCAGAGGATCATGACAAGAGCAGTGCCTCTTCTTCCTGCAGAACTGGGGAGAGCGGAGGCGGAAGCGGGTGGCAGCAGGACGCTGAAATCCCGGCGCGGTGGCGGCGGCGCGGGTGGTGGCCGCGGGGGATTGGCTCCGCCGCGCGATCCCTTCTCCTCTCTCCGCTCCGGGCTCCTCCGCC]
[+] EMBL CB678014             [                                                                                                            ttgTTGAACAATATTGATCTATTCGAACAAGGCAATGTTCATATTTCCCTCGGTTGCAAAAGAAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCGGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCCAAAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCGTGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAACCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCTCCATCTCCAGGAGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
[+] EMBL CB635318             [                                                                                                                          TGATCTATTCGAACAAGGGAATGTTCATATTTCCCT GGTTGCAAAAGAAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGTATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAGTGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCTCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCTGATCTGCATCTGCATACCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAATCTGTCTGATCAGCTTCCACTCCTTGATCAGTATTCTCGTCTCCTGCTGTAag                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
[+] EMBL CB677979             [                                                                                                                          TGATCTATTCGAACAAGGGAATGTTCATATTTCCCT GGTTGCAAAAGAAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCCAAAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCTCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAATCTGTCTGATCAGCTTCCAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB670441             [                                                                                                                           gtttTATTCGAACAAGGGAATGTTCATATTTCCCT GGTTGCAAAAGAAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCTCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAATCTGTCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[-] EMBL CA998278             [                                                                                                                                ATTCGAACAAGGGAATGTTCATATTTCCCT GGTTGCAAAAGAAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTG TTGAAGCCAAAGCGTTGTCTCTAG CATCAAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB622313             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAATC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB621848             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB618243             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB625395             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB622342             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB625404             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB621585             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB622355             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB623517             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB621662             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB621381             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB624655             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB621903             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB625405             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB626574             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB623457             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB623383             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB624281             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB625266             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB626445             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACCAGCATCATCTTGAGCATCCGTAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB623217             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB623619             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGAA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
[+] EMBL CB623859             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB623615             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB623379             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB624515             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAaa                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB621867             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB624318             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB623412             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB623681             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB621690             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB623533             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB624279             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB621896             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB621818             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB625573             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB623334             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAATGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB622020             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB621285             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB624600             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAACATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB622073             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGATCCACGAGCATCATCTTGAGCATCCGTAaa                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB623929             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB623454             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB623415             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB623376             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB626181             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB625581             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAaa                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB626045             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB626371             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB624464             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAAATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB625194             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB625188             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB624556             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAGA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB623731             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB624653             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB623693             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB625112             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB625579             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB624554             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGGAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB624560             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATCCGTA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB625519             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCATCTTGAGCATC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CB621276             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
[+] EMBL CB622340             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB622311             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACCAGCATCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB624702             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB621916             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGGTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGGGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB626111             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
[+] EMBL CB625119             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCATC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
[+] EMBL CB621880             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAGCA                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CB622270             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CB619765             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCCCGTGTACCATATTGGTTTCCCCCCCAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCCTCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCCGCACTGGAAATCCCCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAACTGCAATGCATGCACCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CB621870             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCACGAG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
[+] EMBL CB625079             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAAAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAATTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGTTCCAC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB624406             [                                                                                                                                                                          AAATACAAAC TGCCACTTCAAATAATGATCACGTGTACCCTATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCCATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCCTCCAAAAGACCAAAACTACCAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCCCTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCCGCACTGGAAATCACCTCGGATACTTCTGGAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACCAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCCAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGGGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAAATTTGTCCCCCCCATCTCCAAGTGCTGTGGAACAAGAAGTTTCCCAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB621938             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTCTCTCTATAGT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB624861             [                                                                                                                                                                          AAATACAAGC TGCCACTTCCAATAATGATCACGTGTACCATATTGTTTTCGCCCCCAAAAACAACTATCCAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACCAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAATGAATGAACTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB624875             [                                                                                                                                                                          AAATACCAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCCAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGGGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCCGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCTC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
[+] EMBL CB623590             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB622229             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGGTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGGCCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGGGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB625565             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB624731             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGGAAGTAAAGATCATGGGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB621882             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB623263             [                                                                                                                                                                          AAATACCAGC TGCAACTTCAGAAAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCCAATCTATGACTACTGGCCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGGAAGTAAAGATCATGGGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCACCCTCTTTGCGCAAAAACTCTACAAGTATACA GCCAACTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB624558             [                                                                                                                                                                          AAATACCAGC TGCAACTTCAGAAAATGATCACGTGGACCATATTGTTTTCCCCCCGAAAAACAACTATCGAGTCTATGACTACTGGCCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCACCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACCTCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGGAAGTAAAGATCATGGGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAAAACTCTACAAGTATACA GCCCGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB624444             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGGGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCCCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
[+] EMBL CB624527             [                                                                                                                                                                          AAATACAAGC TGCCACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB625117             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB624456             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGGGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB624867             [                                                                                                                                                                          AAATACAAGC TGCCCCTTCAGAAAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGGCCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCCGCACTGGAAATCCCCTCGGATACTTCTGGAAGTAAAGATCATGGGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCACCCTCTTTGCGCAAAAACTCTACAAGTATACA GCCCGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB623818             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB624394             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCCAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB622079             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB622323             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB625338             [                                                                                                                                                                          AAATACCAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCCAATCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCTAGATTGTCACCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACCACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCACCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCACCCTCTTTGCGCAAAAACTCTACAAGTATACA GCCCGCTTCCAGCGCACTGGTGTTTGAACCCAAAACGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB624352             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCCCTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGGGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB623513             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGAAAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCCAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGGGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB624848             [                                                                                                                                                                          AAATACCAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACCACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB624468             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCCAGTCTATGACTACTGGCCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGGAAGTAAAGATCATGGGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB624523             [                                                                                                                                                                          AAATACCAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCCAGTCTATGACTACTGGCCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGGAAGTAAAGATCATGGGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB623425             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB621410             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGGATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGGGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB621874             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB621761             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB621679             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB624879             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCCAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCCGCACTGGAAATCACCTCGGATACTTCTGGAAGTAAAGATCATGGGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCACCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB624647             [                                                                                                                                                                          AAATACCAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGGCCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGGAAGTAAAGATCATGGGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCCGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB624955             [                                                                                                                                                                          AAATACCAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCCAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCACCCTCTTTGCGCAAAAACTCTACAAGTATACA GCCCGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB623685             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB624550             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGGGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB620053             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB624323             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB623697             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB621838             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB621863             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB623351             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB622008             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGGATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB623461             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB623890             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB622261             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB623670             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB622290             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB623663             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB623188             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB624857             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB621886             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB620034             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB625085             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB621861             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB621826             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB621736             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB624479             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGCC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
[+] EMBL CB625525             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB622022             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB623666             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB626020             [                                                                                                                                                                          AAATACCAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCCAGTCTATGACTACTGGCCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACCACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGGAAGTAAAGATCATGGGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCACCCTCTTTGCGCAAAAACTCTACAAGTATACA GCCCGCTTCCAGCGCACTGGTGTTTGAACCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB623186             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB624474             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB621919             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB622318             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB626296             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB626262             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCCCTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB625184             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB623529             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAATGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB622331             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB623537             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAATGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB623525             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGGGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAAAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB623848             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAAAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB621962             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB624887             [                                                                                                                                                                          AAATACCAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAAAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB625036             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB625554             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
[+] EMBL CB624432             [                                                                                                                                                                          AAATACAAGCATGCCACTTCAAATAATGATCACGTGTACCCTATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGGATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCCTCCAAAAGACCAAAACTACCAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCCCTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCCGCACTGGAAATCACCTCGGATACTTCTGGAAGTAAAGATCATGTGGAGCATATCCTGCATAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAACTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACCAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGGGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAAGTGCTGTGGAACAAGAAGTTTCCCAGGACGCCGGATCTGCATCTGCAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
[+] EMBL CB623448             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB621857             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB624842             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB624440             [                                                                                                                                                                          AAATACCAGC TGCCACTTCAAATAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCCAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCCATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCCGCACTGGAAATCCCCTCGGATACTTCTGTAAATAAAGATCATGGGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGGAATGAATGAGCTGCAATGCATGCACCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCCGCTTCGAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTAACAGATTTGTCCCCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB624454             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623856             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB621796             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAAATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCCCTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAAAATACATCTGAATCTCAGCACTGGAAATCACCTCCGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAATGAATGAACTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAACGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAA CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623607             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB624643             [                                                                                                                                                                          AAATACCAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCCAGTCTATGACTACTGGCCCCTGGATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGGAAGTAAAGATCATGGGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAAAACTCTACAAGTATACA GCCCGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGGTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623918             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCCGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAATGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAATTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623863             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCCGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAATGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB619546             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCCAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAAAATACATCTGAATCTCAGCACTGGAAATCACCTCCGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAATGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAACGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAA CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623573             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAATACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAATGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAACGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623181             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGAAAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGGCCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGGAAGTAAAGATCATGGGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCACCCTCTTTGCGCAAAAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623875             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAAAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCCTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAA CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB622127             [                                                                                                                                                                          AAATACCAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCCCCCCCAAAAACAACTATCCAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCCGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAAATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB621790             [                                                                                                                                                                          AAATACAAGC CCCAAATTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGGATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGGAGGGGCCTTCTCTGGGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623643             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCCTCCATGTAATGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAA CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAAAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623418             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAAAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAAATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAATTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623881             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAAAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAA CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623493             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAAAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAATTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623410             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCCTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB624947             [                                                                                                                                                                          AAATACCAGC TGCAACTTCAGAAAATGATCACGTGGACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGGAAGTAAAGATCATGGGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623327             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCCCTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAAAATACATCTGAATCTCCGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCCCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB622133             [                                                                                                                                                                          AAATACAAGC CCCAACTTCAGATAATGATCACGTGGACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGGAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623339             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAA CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAATTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB619841             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAACGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAA CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB624537             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCCAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAA CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623492             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623725             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAACGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623317             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB621929             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCCCCCCCAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAAATTTGTCCCCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB622369             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGGTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCCGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB626373             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCCTCCATGTAATGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAA CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAAATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623652             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAAATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAA CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB622350             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCCGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB619716             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB624533             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAAAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAATGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAA CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623878             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623626             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623332             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAAAAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB624696             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAATGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAACACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB624604             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAACACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623481             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCCTCCATGTAGTGAATGAACTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB624812             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCCCTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623598             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAAAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623505             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB622338             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB619516             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623314             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623635             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCCCTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAACACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623674             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAAAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB621683             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCCGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCCGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGGGTTGCTTTCACTCA CACCAACACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB625005             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB625083             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623484             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCCCTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB625488             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623842             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCCCTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB626101             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623594             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCCAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGGGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB626485             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB625458             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB624968             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB622346             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB621925             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623904             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAATGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB625042             [                                                                                                                                                                          AAATACAAGC TGCCACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623162             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAAAAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTATCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB626197             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAACTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB621954             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB621668             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623640             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAATGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623441             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGGATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB624541             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCCCTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB624466             [                                                                                                                                                                          AAATACAAGC TGCCACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623780             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB619929             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623745             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGGACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGGTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB625559             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623372             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB625028             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB625182             [                                                                                                                                                                          AAATACAAGC TGCCACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB625087             [                                                                                                                                                                          AAATACAAGC TGCCACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623355             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB625332             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB620049             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB619744             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB625190             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB622202             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB626412             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCCGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB625572             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB626577             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB619777             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAAAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB619464             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB625032             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAAAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB626278             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGGAGGGGCCTTCTCTGGGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB624806             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAAATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB624641             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB624777             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623770             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAAACCAAAACTACGAGGCTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAAAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB624963             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCCCTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGTGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB623546             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCCCTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAATACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAA CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB621996             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGGTAGTTCATCAGAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCGAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB621878             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGGTTTCGCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCATCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACGAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAGACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAGCCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
[+] EMBL CB625512             [                                                                                                                                                                          AAATACAAGC TGCAACTTCAGATAATGATCACGTGTACCATATTGTTTTCCCCCCAAAAAACAACTATCGAGTCTATGACTACTGACCCCTGTATTACCCTTCTATAAAGAAATACATCAATTCTGATGAAAACTCCTCGAGATTGTCAGCCTATGCATCCAAAAGACCAAAACTACGAGGCTAGTTCATCAAAATCTTTTCCCCATGATGAAAACTCACTGGGACAACCAAAGCTTTAGCTTCCATCAGTACACTCCAATCTTTCCCCCC AAAAAGAGTACATCTGAATCTCAGCACTGGAAATCACCTCGGATACTTCTGTAAGTAAAGATCATGTGGAGCATATCCTGCAGAAACAATCCTGCTGCCAAAACGCCGTCCATGTAGTGAATGAGCTGCAATGCATGCAGCCTCTTTGCGCAAGAACTCTACAAGTATACA GCCAGCTTCCAGCGCACTGGTGTTTGAAACCAAAGCGTTGTCTCTAG CATCAACTGCAGGGGCCTTCTCTGTGTTGCTTTCACTCA CACCAGCACCACCTTGTTGCTCGTTCTCCCTACCAGATTTGTCCGCCCCATCTCCAGGTGCTGTGGAACAAGAAGTTTCCAAGGACGCCGGATCTGCATCTGCATG