Home
Who am I
Technology
EST Assembly
Contact

These datas are free for academic use only, please contact me for any other use.

Oryza sativa
cluster # 9434 cluster # 9434       Sequences # 6       consensus # 4


see consensus multiple alignment with clustalw

Direct access to contigs :
consensus_9434#0 length = 2494 sequences # 3  
consensus_9434#1 length = 878 sequences # 1  
consensus_9434#2 length = 604 sequences # 1  
consensus_9434#3 length = 365 sequences # 1  

consensusID : consensus_9434#0
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 3
consensus length = 2494
fasta sequence
                              [TCACAAAGTCAACGCTCGTACTCCCAGCAAAGCCATCCATAATCGGAGCGGGATGATGCAACCATTCACCACATCCCCAGTGGCTCACGCTCCTAGAGCAGGCAGGCTCTCATGGACCGGCGCTTCGTGCCGGCCCAGCAGATGCTGGGTGAGAGTACGGTCCATGAGGAACGGGTCTACCGAGAGCCTGGACCATCTGCAGAGGGCCTCAAAGGCTAGACCGCGGCAGCAGCAGGGGACTCCCAGCGCCAGGAGGAGAGTCATCCAAACCACGCCATTTGGTACGTATAGCAAAAGCTCTTTTGGTGTTTGTCTTCAATTTTGTGTTAACATAATTGAGCTTCGTGT-GGTTTTTGG-TTTGAGAATGCGGTCACTTCTTCTGTTGCTTCTCCTTTACCGGA-CGTAAGAAATGCCCTAGTCTGTGTGCAAGATAGTTCAATCTCAGTGGCTGCCTTAGTTCCAGTTCTTGCATGTGCTGTTAATGATCTAGAGACTGTCTCAACTGAAGTGGTACCTGCGACTGTTTCCTTGGTGTCTGTTATGCCTACAAGAGCTGCTGCGGTTGCTGAAGTTGCTCATGCTACTGTTGAGTCCGTTGTTGTTCCGTCCTCTGTCAGCGAAGATCTCTCGCCAGCGGTCAACCTTAGCAGTATGCCACCTCGTCTCAGATGCAAGAATAAAGGTTTCCTCGCTTGGTACGGCGCCTGTCCATCTTCGAGGCAGCCAAGCTCGGTCCCCCCACAGGAACCTAGGGATATCTTCGTCTGTTCGGAACAGTTGTCTGCCAACCCAATTCTGTCTCCACCTCAGGATCCTGATAGCACGAGATCGCCACCTCCGACATTGAGTGGCCCCTCAGCTGCTGAGCAAATCAGAAGAGCTCTAGCAGGTCTAAGTCCAGAAGGATCTATTCACTCTGCTTCACTCTCTCCAGGTCGGGTGCCAGTCATTACTTCCGATGACACTACTGCCGCGCAGGACTTTGCTTTTGGGGAACCAGATCCAGTTAACATATCAGGAGACAGTGACGATGATATTCTTGATATCTTTATCCCCTTTGTTGACATGAGAGTAACTGCTCATTACGCCACTGCTTATGTTACCCCTCCATGTGAATGCCCTGGCAGAGTAATTCGAAAAGCAATGCAGGATGCTCACCCTCGTTTTCAGTTCACTCTCATCTCAGCTTGTAGAGGTGCAATGACTCTAAGATTTATTCACAGTCAGGACAGAGACATTGCAGTTGATCACCAGGAGAATCTTACAGCTGAAGGCCACTTGGTTAGGCTTGAACGGCCTGAGGACAGTGCGGCTCGCTTCATTCAACACAACACTATGCTGTCCGAACTAGACTGTATTGACTTCCCGCCAGAGATGTTGTTCCCTAACAAGATAAGAAATGCTTTTGAAAATTACGGCGAGCTGATGGAAGTAGATGATCAATGCCTCTATGGGGACGAACAATCCTCTCTGCGTCTTGTTGTTCTGCACTATCCTGGCAAGAGGATGAGCCCTAGATTTCGGCTGCGCTACAATTTGGGGATTGTCTGCACTGTCTATGTCAGGGTTCTAAGAACATGGGAGCTGGCCATGAACGTGGATGAAGATGGAAATTACATTAAGCATTATGAACAGTTTCTATTCCCTCATCAGCTGGATCCTCCCCGTTCAGGACCAACTGTTGGACCAGAGGCAGAGTTGGGCAACTTGAATCAGGCTCCTTCAAATCAAATCTCTAACAACCAAAGACTTCAGAACAGGGGAAGATTGCTTGCGATTCTGCCTGCAGCTAGCACTGTCTTCATTGAGGAAATCTCTGATACACCTGAATTTTTTGTCCCTCCGTCAATCCATTCTGCTCCCTCCAGTATCCATGACTGCCTCCAGGACCTCGTGCCCTCAGATACTGAAAATGAACATGAGCTTTCAGCCCGGAAACGCAGAAGGCAGAAGAAACGGACAATTGATTCAGATGTCAAGAGGCGATATAGCGAAAGACTGGCGGCCAAAGAAGGACATTTGTACATTTCAATGGAATCCAAAGCAGCCAGAGCGAAAAAACTAAAGGAACAACTTGCCAAATGCTCATCCAAACTCAATGACGCGGTACACAAGCACAATCTGCTCGACCTTAACTTCAAGACTACTCCGAAAGCGTTGGAAGATCTGGCTATTGCTTGCAGTTTGAATGATCACGATATTGCCCAGCTTCGAAAGGTGTTCTCGTCAGTGGACTGATGGTGATCAATACCCTCAATGGGATGGACAAGCCCAGCATGCGTCTGCTTCTCTCCCTTTGTTATGTTCTTTCAGCTCTTCTTCAGTTCTCTAGTGTCTTCTCTCCCTTCGGTATGGTCTCTTTCAGGCTATTTACTCCATGTAAGCTGGATTATGTGATGCTGGGGCCTTTTGCTCTTGGGTCTGGCATGNGCTATTTCGGNGAACCTATTNTTTTTTNAAAAAAAAAGAAAAAAAAAAAAGCGGNCGCCANCGG]

[+] EMBL AK108511             [TCACAAAGTCAACGCTCGTACTCCCAGCAAAGCCATCCATAATCGGAGCGGGATGATGCAACCATTCACCACATCCCCAGTGGCTCACGCTCCTAGAGCAGGCAGGCTCTCATGGACCGGCGCTTCGTGCCGGCCCAGCAGATGCTGGGTGAGAGTACGGTCCATGAGGAACGGGTCTACCGAGAGCCTGGACCATCTGCAGAGGGCCTCAAAGGCTAGACCGCGGCAGCAGCAGGGGACTCCCAGCGCCAGGAGGAGAGTCATCCAAACCACGCCATTTGGTACGTATAGCAAAAGCTCTTTTGGTGTTTGTCTTCAATTTTGTGTTAACATAATTGAGCTTCGTGT GGTTTTTGG TTTGAGAATGCGGTCACTTCTTCTGTTGCTTCTCCTTTACCGGA CGTAAGAAATGCCCTAGTCTGTGTGCAAGATAGTTCAATCTCAGTGGCTGCCTTAGTTCCAGTTCTTGCATGTGCTGTTAATGATCTAGAGACTGTCTCAACTGAAGTGGTACCTGCGACTGTTTCCTTGGTGTCTGTTATGCCTACAAGAGCTGCTGCGGTTGCTGAAGTTGCTCATGCTACTGTTGAGTCCGTTGTTGTTCCGTCCTCTGTCAGCGAAGATCTCTCGCCAGCGGTCAACCTTAGCAGTATGCCACCTCGTCTCAGATGCAAGAATAAAGGTTTCCTCGCTTGGTACGGCGCCTGTCCATCTTCGAGGCAGCCAAGCTCGGTCCCCCCACAGGAACCTAGGGATATCTTCGTCTGTTCGGAACAGTTGTCTGCCAACCCAATTCTGTCTCCACCTCAGGATCCTGATAGCACGAGATCGCCACCTCCGACATTGAGTGGCCCCTCAGCTGCTGAGCAAATCAGAAGAGCTCTAGCAGGTCTAAGTCCAGAAGGATCTATTCACTCTGCTTCACTCTCTCCAGGTCGGGTGCCAGTCATTACTTCCGATGACACTACTGCCGCGCAGGACTTTGCTTTTGGGGAACCAGATCCAGTTAACATATCAGGAGACAGTGACGATGATATTCTTGATATCTTTATCCCCTTTGTTGACATGAGAGTAACTGCTCATTACGCCACTGCTTATGTTACCCCTCCATGTGAATGCCCTGGCAGAGTAATTCGAAAAGCAATGCAGGATGCTCACCCTCGTTTTCAGTTCACTCTCATCTCAGCTTGTAGAGGTGCAATGACTCTAAGATTTATTCACAGTCAGGACAGAGACATTGCAGTTGATCACCAGGAGAATCTTACAGCTGAAGGCCACTTGGTTAGGCTTGAACGGCCTGAGGACAGTGCGGCTCGCTTCATTCAACACAACACTATGCTGTCCGAACTAGACTGTATTGACTTCCCGCCAGAGATGTTGTTCCCTAACAAGATAAGAAATGCTTTTGAAAATTACGGCGAGCTGATGGAAGTAGATGATCAATGCCTCTATGGGGACGAACAATCCTCTCTGCGTCTTGTTGTTCTGCACTATCCTGGCAAGAGGATGAGCCCTAGATTTCGGCTGCGCTACAATTTGGGGATTGTCTGCACTGTCTATGTCAGGGTTCTAAGAACATGGGAGCTGGCCATGAACGTGGATGAAGATGGAAATTACATTAAGCATTATGAACAGTTTCTATTCCCTCATCAGCTGGATCCTCCCCGTTCAGGACCAACTGTTGGACCAGAGGCAGAGTTGGGCAACTTGAATCAGGCTCCTTCAAATCAAATCTCTAACAACCAAAGACTTCAGAACAGGGGAAGATTGCTTGCGATTCTGCCTGCAGCTAGCACTGTCTTCATTGAGGAAATCTCTGATACACCTGAATTTTTTGTCCCTCCGTCAATCCATTCTGCTCCCTCCAGTATCCATGACTGCCTCCAGGACCTCGTGCCCTCAGATACTGAAAATGAACATGAGCTTTCAGCCCGGAAACGCAGAAGGCAGAAGAAACGGACAATTGATTCAGATGTCAAGAGGCGATATAGCGAAAGACTGGCGGCCAAAGAAGGACATTTGTACATTTCAATGGAATCCAAAGCAGCCAGAGCGAAAAAACTAAAGGAACAACTTGCCAAATGCTCATCCAAACTCAATGACGCGGTACACAAGCACAATCTGCTCGACCTTAACTTCAAGACTACTCCGAAAGCGTTGGAAGATCTGGCTATTGCTTGCAGTTTGAATGATCACGATATTGCCCAGCTTCGAAAGGTGTTCTCGTCAGTGGACTGATGGTGATCAATACCCTCAATGGGATGGACAAGCCCAGCATGCGTCTGCTTCTCTCCCTTTGTTATGTTCTTTCAGCTCTTCTTCAGTTCTCTAGTGTCTTCTC                                                                                                                                                         ]
[+] EMBL AU063534             [            CGCTCGTACTCCCAGCAAAGCCATCCATAATCGGAGCGGGATGATGCAACCATTCACCACATCCCCAGTGGCTCACGCTCCTAGAGCAGGCAGGCTCTCATGGACCGGCGCTTCGTGCCGGCCCAGCAGATGCTGGNTGAGAGTACGGTCCATGAGGAACGGGTCTACCGAGAGCCTGGACCATCTGCAGAGGGCCTCAAAGGCTAGACCGCGGCA NAGCAGGGGACTCCCAGCGCCAGGAGGAGAGTCATCCAAACCACGTCATTTGGTACGTATAGCAAAAGCTCTTTTGGTGTTTGTCTTCAATTTTGTGTTACCATAATTGAGCTTCGTGTGGGTTTTTGGTTTTGAGAATGCGGTCACTTCTTCTGTTGCTTCTCCTTTACCGGACCGTAAGAAATGCCCT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
[+] EMBL CA764303             [                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCAGGCTCCTTCAAATCAAATCTCTAACAACCAAAGACTTCAGAACAGGGGAAGATTGCTTGCGATTCTGCCTGCAGCTAGCACTGTCTTCATTGAGGAAATCTCTGATACACCTGAATTTTTTGTCCCTCCGTCAATCCATTCTGCTCCCTCCGGTATCCATGACTGCCTCCAGGACCTCGTGCCCTCAGATACTGAAAATGAACATGAGCTTTCAGCCCGGAAACGCAGAAGGCAGAAGAAACGGACAATTGATTCAGATGTCAAGAGGCGATATAGCGAAAGACTGGCGGCCAAAGAAGGACATTTGTACATTTCAATGGAATCCAAAGCAGCCAGAGCGAAAAAACTAAAGGAACAACTTGCCAAATGCTCATCCAAACTCAATGACGCGGTACACAAGCACAATCTGCTCGACCTTAACTTCAAGACTACTCCGAAAGCGTTGGAAGATCTGGCTATTGCTTGCAGTTTGAATGATCACGATATTGCCCAGCTTCGAAAGGTGTTCTCGTCAGTGGACTGATGGTGATCAATACCCTCAATGGGATGGACAAGCCCAGCATGCGTCTGCTTCCCTNCCTTTGGTATGGTCTTTCAGCTCTTCTTCAGNTCTCTAGGGNCTTCTCTCCCTTCGGTATGGTCTCTTTCAGGCTATTTACTCCATGTAAGCTGGATTATGTGATGCTGGGGCCTTTTGCTCTTGGGTCTGGCATGNGCTATTTCGGNGAACCTATTNTTTTTTNAAAAAAAAAGAAAAAAAAAAAAGCGGNCGCCANCGG]


>consensus_9434#0 TCACAAAGTCAACGCTCGTACTCCCAGCAAAGCCATCCATAATCGGAGCGGGATGATGCA ACCATTCACCACATCCCCAGTGGCTCACGCTCCTAGAGCAGGCAGGCTCTCATGGACCGG CGCTTCGTGCCGGCCCAGCAGATGCTGGGTGAGAGTACGGTCCATGAGGAACGGGTCTAC CGAGAGCCTGGACCATCTGCAGAGGGCCTCAAAGGCTAGACCGCGGCAGCAGCAGGGGAC TCCCAGCGCCAGGAGGAGAGTCATCCAAACCACGCCATTTGGTACGTATAGCAAAAGCTC TTTTGGTGTTTGTCTTCAATTTTGTGTTAACATAATTGAGCTTCGTGTGGTTTTTGGTTT GAGAATGCGGTCACTTCTTCTGTTGCTTCTCCTTTACCGGACGTAAGAAATGCCCTAGTC TGTGTGCAAGATAGTTCAATCTCAGTGGCTGCCTTAGTTCCAGTTCTTGCATGTGCTGTT AATGATCTAGAGACTGTCTCAACTGAAGTGGTACCTGCGACTGTTTCCTTGGTGTCTGTT ATGCCTACAAGAGCTGCTGCGGTTGCTGAAGTTGCTCATGCTACTGTTGAGTCCGTTGTT GTTCCGTCCTCTGTCAGCGAAGATCTCTCGCCAGCGGTCAACCTTAGCAGTATGCCACCT CGTCTCAGATGCAAGAATAAAGGTTTCCTCGCTTGGTACGGCGCCTGTCCATCTTCGAGG CAGCCAAGCTCGGTCCCCCCACAGGAACCTAGGGATATCTTCGTCTGTTCGGAACAGTTG TCTGCCAACCCAATTCTGTCTCCACCTCAGGATCCTGATAGCACGAGATCGCCACCTCCG ACATTGAGTGGCCCCTCAGCTGCTGAGCAAATCAGAAGAGCTCTAGCAGGTCTAAGTCCA GAAGGATCTATTCACTCTGCTTCACTCTCTCCAGGTCGGGTGCCAGTCATTACTTCCGAT GACACTACTGCCGCGCAGGACTTTGCTTTTGGGGAACCAGATCCAGTTAACATATCAGGA GACAGTGACGATGATATTCTTGATATCTTTATCCCCTTTGTTGACATGAGAGTAACTGCT CATTACGCCACTGCTTATGTTACCCCTCCATGTGAATGCCCTGGCAGAGTAATTCGAAAA GCAATGCAGGATGCTCACCCTCGTTTTCAGTTCACTCTCATCTCAGCTTGTAGAGGTGCA ATGACTCTAAGATTTATTCACAGTCAGGACAGAGACATTGCAGTTGATCACCAGGAGAAT CTTACAGCTGAAGGCCACTTGGTTAGGCTTGAACGGCCTGAGGACAGTGCGGCTCGCTTC ATTCAACACAACACTATGCTGTCCGAACTAGACTGTATTGACTTCCCGCCAGAGATGTTG TTCCCTAACAAGATAAGAAATGCTTTTGAAAATTACGGCGAGCTGATGGAAGTAGATGAT CAATGCCTCTATGGGGACGAACAATCCTCTCTGCGTCTTGTTGTTCTGCACTATCCTGGC AAGAGGATGAGCCCTAGATTTCGGCTGCGCTACAATTTGGGGATTGTCTGCACTGTCTAT GTCAGGGTTCTAAGAACATGGGAGCTGGCCATGAACGTGGATGAAGATGGAAATTACATT AAGCATTATGAACAGTTTCTATTCCCTCATCAGCTGGATCCTCCCCGTTCAGGACCAACT GTTGGACCAGAGGCAGAGTTGGGCAACTTGAATCAGGCTCCTTCAAATCAAATCTCTAAC AACCAAAGACTTCAGAACAGGGGAAGATTGCTTGCGATTCTGCCTGCAGCTAGCACTGTC TTCATTGAGGAAATCTCTGATACACCTGAATTTTTTGTCCCTCCGTCAATCCATTCTGCT CCCTCCAGTATCCATGACTGCCTCCAGGACCTCGTGCCCTCAGATACTGAAAATGAACAT GAGCTTTCAGCCCGGAAACGCAGAAGGCAGAAGAAACGGACAATTGATTCAGATGTCAAG AGGCGATATAGCGAAAGACTGGCGGCCAAAGAAGGACATTTGTACATTTCAATGGAATCC AAAGCAGCCAGAGCGAAAAAACTAAAGGAACAACTTGCCAAATGCTCATCCAAACTCAAT GACGCGGTACACAAGCACAATCTGCTCGACCTTAACTTCAAGACTACTCCGAAAGCGTTG GAAGATCTGGCTATTGCTTGCAGTTTGAATGATCACGATATTGCCCAGCTTCGAAAGGTG TTCTCGTCAGTGGACTGATGGTGATCAATACCCTCAATGGGATGGACAAGCCCAGCATGC GTCTGCTTCTCTCCCTTTGTTATGTTCTTTCAGCTCTTCTTCAGTTCTCTAGTGTCTTCT CTCCCTTCGGTATGGTCTCTTTCAGGCTATTTACTCCATGTAAGCTGGATTATGTGATGC TGGGGCCTTTTGCTCTTGGGTCTGGCATGNGCTATTTCGGNGAACCTATTNTTTTTTNAA AAAAAAAGAAAAAAAAAAAAGCGGNCGCCANCGG



consensusID : consensus_9434#1
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 1
consensus length = 878
fasta sequence
                              [TCTCACAAAGTCAACGCTCGTACTCCCAGCAAAGCCATCCATAATCGGAGCGGGATGATGCAACCATTCACCACATCCCCAGTGGCTCACGCTCCTAGAGCAGGCAGGCTCTCATGGACCGGCGCTTCGTGCCGGCCCAGCAGATGCTGGGTGAGAGTACGGTCCATGAGGAACGGGTCTACCGAGAGCCTGGACCATCTGCAGAGGGCCTCAAAGGCTAGACCGCGGCAGCAGCAGGGGACTCCCAGCGCCAGGAGGAGAGTCATCCAAACCACGCCATTTGAGCTGCTGCGGTTGCTGAAGTTGCTCATGCTACTGTTGAGTCCGTTGTTGTTCCGTCCTCTGTCAGCGAAGATCTCTCGCCAGCGGTCAACCTTAGCAGTATGCCACCTCGTCTCAGATGCAAGAATAAAGGTTTCCTCGCTTGGTACGGCGCCTGTCTATCTTCGAGGCAGCCAAGCTCGGTCCCCCCACAGGAACCTAGGGATATCTTCGTCTGTTCGGAACAGTTGTCTGCCAACCCAGTTCTGTCTCCACCTCAGGATCCTGATAGCACGAGATCGCCACCTCCGACATTGAGTGGCCCCTCAGCTGCTGAGCAAATCAGAAGAGCTCTAGCAGGTCTAAGTCCAGAAGGATCTATTCACTCTGCTTCACTCTCTCCAGGTCGGGTGCCAGTCATTACTTCCGATGACACTACTGCTGCGCAGGACTTTGCTTTTGGGGAACCAGATCCAGTTAACATATCAGGAGACAGTGACGATGATATTCTTGATATCTTTATCCCCTTTGTTGACATGAGAGTAACTGCTCATTACGCCACTGCTTATGTTACCCCTCCATGTGAATGCCCTGGCAGAGTAATTCGAAAAGCAATG]

[+] EMBL AK108441             [TCTCACAAAGTCAACGCTCGTACTCCCAGCAAAGCCATCCATAATCGGAGCGGGATGATGCAACCATTCACCACATCCCCAGTGGCTCACGCTCCTAGAGCAGGCAGGCTCTCATGGACCGGCGCTTCGTGCCGGCCCAGCAGATGCTGGGTGAGAGTACGGTCCATGAGGAACGGGTCTACCGAGAGCCTGGACCATCTGCAGAGGGCCTCAAAGGCTAGACCGCGGCAGCAGCAGGGGACTCCCAGCGCCAGGAGGAGAGTCATCCAAACCACGCCATTTGAGCTGCTGCGGTTGCTGAAGTTGCTCATGCTACTGTTGAGTCCGTTGTTGTTCCGTCCTCTGTCAGCGAAGATCTCTCGCCAGCGGTCAACCTTAGCAGTATGCCACCTCGTCTCAGATGCAAGAATAAAGGTTTCCTCGCTTGGTACGGCGCCTGTCTATCTTCGAGGCAGCCAAGCTCGGTCCCCCCACAGGAACCTAGGGATATCTTCGTCTGTTCGGAACAGTTGTCTGCCAACCCAGTTCTGTCTCCACCTCAGGATCCTGATAGCACGAGATCGCCACCTCCGACATTGAGTGGCCCCTCAGCTGCTGAGCAAATCAGAAGAGCTCTAGCAGGTCTAAGTCCAGAAGGATCTATTCACTCTGCTTCACTCTCTCCAGGTCGGGTGCCAGTCATTACTTCCGATGACACTACTGCTGCGCAGGACTTTGCTTTTGGGGAACCAGATCCAGTTAACATATCAGGAGACAGTGACGATGATATTCTTGATATCTTTATCCCCTTTGTTGACATGAGAGTAACTGCTCATTACGCCACTGCTTATGTTACCCCTCCATGTGAATGCCCTGGCAGAGTAATTCGAAAAGCAATG]


>consensus_9434#1 TCTCACAAAGTCAACGCTCGTACTCCCAGCAAAGCCATCCATAATCGGAGCGGGATGATG CAACCATTCACCACATCCCCAGTGGCTCACGCTCCTAGAGCAGGCAGGCTCTCATGGACC GGCGCTTCGTGCCGGCCCAGCAGATGCTGGGTGAGAGTACGGTCCATGAGGAACGGGTCT ACCGAGAGCCTGGACCATCTGCAGAGGGCCTCAAAGGCTAGACCGCGGCAGCAGCAGGGG ACTCCCAGCGCCAGGAGGAGAGTCATCCAAACCACGCCATTTGAGCTGCTGCGGTTGCTG AAGTTGCTCATGCTACTGTTGAGTCCGTTGTTGTTCCGTCCTCTGTCAGCGAAGATCTCT CGCCAGCGGTCAACCTTAGCAGTATGCCACCTCGTCTCAGATGCAAGAATAAAGGTTTCC TCGCTTGGTACGGCGCCTGTCTATCTTCGAGGCAGCCAAGCTCGGTCCCCCCACAGGAAC CTAGGGATATCTTCGTCTGTTCGGAACAGTTGTCTGCCAACCCAGTTCTGTCTCCACCTC AGGATCCTGATAGCACGAGATCGCCACCTCCGACATTGAGTGGCCCCTCAGCTGCTGAGC AAATCAGAAGAGCTCTAGCAGGTCTAAGTCCAGAAGGATCTATTCACTCTGCTTCACTCT CTCCAGGTCGGGTGCCAGTCATTACTTCCGATGACACTACTGCTGCGCAGGACTTTGCTT TTGGGGAACCAGATCCAGTTAACATATCAGGAGACAGTGACGATGATATTCTTGATATCT TTATCCCCTTTGTTGACATGAGAGTAACTGCTCATTACGCCACTGCTTATGTTACCCCTC CATGTGAATGCCCTGGCAGAGTAATTCGAAAAGCAATG



consensusID : consensus_9434#2
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 1
consensus length = 604
fasta sequence
                              [GAGGTAGAGCACGCCGTCCCTCACCTCCGCCGCGATCCGCTCCACCTCCACGTTCTCCGGCAGCTCCACCCGCGTCCTGTACCTCCCGAAGCTCGCCGCCGGCCACGCCTCCCCCTCGTCCTCACCGTCAGCCGCCTCCACGGCCTCCCCATCCTTGGCCGCCTTCTCGGCGACCACCACCAGCTTCCGGTCCTGCACGCTCACCGTCACGTCCTCCCTCGTCATGCCCGGCATGTCGTACCGCACCAGGTACGCCCCGGCGCGCTCCTTGATCTCCCACGGCGTCCGCCCACGCCTGTAGGCGGCTGTGGCGGCGCCGTTGTCGACGGCGCGGGCAGCTGCCGGCGCCGCCGTCACCGCGGAGGCCGGCACGACGAGCATGCGGTCGCTGTCGGCGTCGCCGTCCATGATGCGCTCCATGGTCCGCATCATCTGGTCCAGCGTCCTCGCCTCCGGGAAGCTGTCCCATAACCCTGCCCATGTTCGCAAATGGAGTAATTAATTAGCCAAGCCAATTCTTTTTTACAGTTTTAACACTCTTTAGAAATCCGTTATGTAAATTCAATTAGTGAATTATAAGTAATCGAAAAAACAAGCCAAAAAT]

[+] EMBL AK063686             [GAGGTAGAGCACGCCGTCCCTCACCTCCGCCGCGATCCGCTCCACCTCCACGTTCTCCGGCAGCTCCACCCGCGTCCTGTACCTCCCGAAGCTCGCCGCCGGCCACGCCTCCCCCTCGTCCTCACCGTCAGCCGCCTCCACGGCCTCCCCATCCTTGGCCGCCTTCTCGGCGACCACCACCAGCTTCCGGTCCTGCACGCTCACCGTCACGTCCTCCCTCGTCATGCCCGGCATGTCGTACCGCACCAGGTACGCCCCGGCGCGCTCCTTGATCTCCCACGGCGTCCGCCCACGCCTGTAGGCGGCTGTGGCGGCGCCGTTGTCGACGGCGCGGGCAGCTGCCGGCGCCGCCGTCACCGCGGAGGCCGGCACGACGAGCATGCGGTCGCTGTCGGCGTCGCCGTCCATGATGCGCTCCATGGTCCGCATCATCTGGTCCAGCGTCCTCGCCTCCGGGAAGCTGTCCCATAACCCTGCCCATGTTCGCAAATGGAGTAATTAATTAGCCAAGCCAATTCTTTTTTACAGTTTTAACACTCTTTAGAAATCCGTTATGTAAATTCAATTAGTGAATTATAAGTAATCGAAAAAACAAGCCAAAAAT]


>consensus_9434#2 GAGGTAGAGCACGCCGTCCCTCACCTCCGCCGCGATCCGCTCCACCTCCACGTTCTCCGG CAGCTCCACCCGCGTCCTGTACCTCCCGAAGCTCGCCGCCGGCCACGCCTCCCCCTCGTC CTCACCGTCAGCCGCCTCCACGGCCTCCCCATCCTTGGCCGCCTTCTCGGCGACCACCAC CAGCTTCCGGTCCTGCACGCTCACCGTCACGTCCTCCCTCGTCATGCCCGGCATGTCGTA CCGCACCAGGTACGCCCCGGCGCGCTCCTTGATCTCCCACGGCGTCCGCCCACGCCTGTA GGCGGCTGTGGCGGCGCCGTTGTCGACGGCGCGGGCAGCTGCCGGCGCCGCCGTCACCGC GGAGGCCGGCACGACGAGCATGCGGTCGCTGTCGGCGTCGCCGTCCATGATGCGCTCCAT GGTCCGCATCATCTGGTCCAGCGTCCTCGCCTCCGGGAAGCTGTCCCATAACCCTGCCCA TGTTCGCAAATGGAGTAATTAATTAGCCAAGCCAATTCTTTTTTACAGTTTTAACACTCT TTAGAAATCCGTTATGTAAATTCAATTAGTGAATTATAAGTAATCGAAAAAACAAGCCAA AAAT



consensusID : consensus_9434#3
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 1
consensus length = 365
fasta sequence
                              [CGCTCGTACTCCCAGCAAAGCCATCCATAATCGGAGCGGGATGATGCAACCATTCACCACATCCCCAGTGGCTCACGCTCCTAGAGCAGGCAGGCTCTCATGGACCGGCGCTTCGTGCCGGCCCAGCAGATGCTGGGTGAGAGTACGGTCCATGAGGAACGGGTCTACCGAGAGCCTGGACCATCTGCAGAGGGCCTCAAAGGCTAGACCGCGGCAGAGCAGGGGACTCCCAGCGCCAGGAGGAGAGTCATCCAAACCACGCCATTTGGGTTATGGGACAGCTTCCCGGAGGCGAGGACGCTTGGACCAGATGATGCGGACCATGGAGCGCATCATGGACGGCGACGGCGACAAGCGACCGAATG]

[+] EMBL AU063283             [CGCTCGTACTCCCAGCAAAGCCATCCATAATCGGAGCGGGATGATGCAACCATTCACCACATCCCCAGTGGCTCACGCTCCTAGAGCAGGCAGGCTCTCATGGACCGGCGCTTCGTGCCGGCCCAGCAGATGCTGGGTGAGAGTACGGTCCATGAGGAACGGGTCTACCGAGAGCCTGGACCATCTGCAGAGGGCCTCAAAGGCTAGACCGCGGCAGAGCAGGGGACTCCCAGCGCCAGGAGGAGAGTCATCCAAACCACGCCATTTGGGTTATGGGACAGCTTCCCGGAGGCGAGGACGCTTGGACCAGATGATGCGGACCATGGAGCGCATCATGGACGGCGACGGCGACAAGCGACCGAATG]


>consensus_9434#3 CGCTCGTACTCCCAGCAAAGCCATCCATAATCGGAGCGGGATGATGCAACCATTCACCAC ATCCCCAGTGGCTCACGCTCCTAGAGCAGGCAGGCTCTCATGGACCGGCGCTTCGTGCCG GCCCAGCAGATGCTGGGTGAGAGTACGGTCCATGAGGAACGGGTCTACCGAGAGCCTGGA CCATCTGCAGAGGGCCTCAAAGGCTAGACCGCGGCAGAGCAGGGGACTCCCAGCGCCAGG AGGAGAGTCATCCAAACCACGCCATTTGGGTTATGGGACAGCTTCCCGGAGGCGAGGACG CTTGGACCAGATGATGCGGACCATGGAGCGCATCATGGACGGCGACGGCGACAAGCGACC GAATG



consensus multiple alignement with clustalw

CLUSTAL W (1.82) multiple sequence alignment


consensus_9434#0      --TCACAAAGTCAACGCTCGTACTCCCAGCAAAGCCATCCATAATCGGAGCGGGATGATG 58
consensus_9434#1      TCTCACAAAGTCAACGCTCGTACTCCCAGCAAAGCCATCCATAATCGGAGCGGGATGATG 60
consensus_9434#3      --------------CGCTCGTACTCCCAGCAAAGCCATCCATAATCGGAGCGGGATGATG 46
consensus_9434#2      -------GAGGTAGAGCACGCCGTCCC--TCACCTCCGCCGCGATCCGCTCCACCTC-CA 50
                                     ** **   ****    *   *  **   *** *  *    *    

consensus_9434#0      CAACCATTCACCACATCCCCAGTGGCTCACGC-TCCTAGAGCAGGCAGGCTCTCATGGAC 117
consensus_9434#1      CAACCATTCACCACATCCCCAGTGGCTCACGC-TCCTAGAGCAGGCAGGCTCTCATGGAC 119
consensus_9434#3      CAACCATTCACCACATCCCCAGTGGCTCACGC-TCCTAGAGCAGGCAGGCTCTCATGGAC 105
consensus_9434#2      CGTTCTCCGGCAGCTCCACCCGCGTCCTGTACCTCCCGAAGCTCGCCGCCGGCCACG--C 108
                      *   *     *  *  * ** * * *     * ***   ***  ** * *   ** *  *

consensus_9434#0      CGGCGCTTCGTGCCGGCCCAGCAGATGCTGGGTGAGAGTACGGTCCATGAGGAACGGGTC 177
consensus_9434#1      CGGCGCTTCGTGCCGGCCCAGCAGATGCTGGGTGAGAGTACGGTCCATGAGGAACGGGTC 179
consensus_9434#3      CGGCGCTTCGTGCCGGCCCAGCAGATGCTGGGTGAGAGTACGGTCCATGAGGAACGGGTC 165
consensus_9434#2      CTCCCCCTCGTCCTCACC-GTCAGCCGCC---TCCACGGCCTCCCCATCCTTGGCCGCCT 164
                      *  * * **** *   **   ***  **    *    *  *   ****      * *   

consensus_9434#0      TACCGAGAGCCTGGACCATCTGCAGAGGGCCTCAAAGGCTAGACCGCGGCAGCAGCAGGG 237
consensus_9434#1      TACCGAGAGCCTGGACCATCTGCAGAGGGCCTCAAAGGCTAGACCGCGGCAGCAGCAGGG 239
consensus_9434#3      TACCGAGAGCCTGGACCATCTGCAGAGGGCCTCAAAGGCTAGACCGCGGCAG-AGCAGGG 224
consensus_9434#2      TCTCGGCGACC---ACCACCAGCTTCCGGTCCTGCACGCTC-ACCGTCAC---------- 210
                      *  **    **   **** * **    ** *    * ***  ****   *          

consensus_9434#0      GACTCCCAGCGCCAGGAGGAGAGTCATCCAAACCACGCCATTTGGTACGTATAGCAAAAG 297
consensus_9434#1      GACTCCCAGCGCCAGGAGGAGAGTCATCCAAACCACGCCATTTG---------------- 283
consensus_9434#3      GACTCCCAGCGCCAGGAGGAGAGTCATCCAAACCACGCCATTTGGGTTATGGGACAGCTT 284
consensus_9434#2      GTCCTCCCTCGTCATGCCCGGCAT--GTCGTACCGCACCAGGTACGCCCCGGCGCGCTCC 268
                      * *  **  ** ** *    *  *    *  *** * ***  *                 

consensus_9434#0      CTCTTTTGGTGTTTGTCTTCAATTTTGTGTTA-ACATAATTGAGCTTCGTGTGGTTTTTG 356
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      CCCGGAGGCGAGGACGCTTGGACCAGATGATGCGGACCATGGAGCGCATCATGGACGGCG 344
consensus_9434#2      TTGATCTCCCACGGCGTCCGCCCACGCCTGTAGGCGGCTGTGGCGGCGCCGTTGTCGACG 328
                                                                                  

consensus_9434#0      GTTTGAGAATGCGGTCACTTCTTCTGTTGCTTCTCCTTTACCGGACGTAAGAAATGCCCT 416
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ACGGCGACAAGCGACCGAATG--------------------------------------- 365
consensus_9434#2      GCGCGGGCAGCTGCCGGCGCCGCC--------------------------GTCACCGCGG 362
                                                                                  

consensus_9434#0      AGTCTGTGTGCAAGATAGTTCAATCTCAGTGGCTGCCTTAGTTCCAGTTCTTGCATGTGC 476
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      AGGCCGGCACGACGAGCATGCGGTCGCTGTCGGCGTCGCCGTCCATGATGCGCTCCATGG 422
                                                                                  

consensus_9434#0      TGTTAATGATCTAGAGACTGTCTCAACTGAAGTGGTACCTGCGACTGTTTCCTTGGTGTC 536
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      TCCGCATCATCTGGT----------------------CCAGCGTCCTCGCCTCCGGGAAG 460
                                                                                  

consensus_9434#0      TGTTATGCCTACAAGAGCTGCTGCGGTTGCTGAAGTTGCTCATGCTACTGTTGAGTCCGT 596
consensus_9434#1      ---------------AGCTGCTGCGGTTGCTGAAGTTGCTCATGCTACTGTTGAGTCCGT 328
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      CTGTCCCATAACCCTGCCCATGTTCGCAAATGGAGTAATTAATTAGCCAAGCCAATTCTT 520
                                                                                  

consensus_9434#0      TGTTGTTCCGTCCTCTGTCAGCGAAGATCTCTCGCCAGCGGTCAACCTTAGCAGTATGCC 656
consensus_9434#1      TGTTGTTCCGTCCTCTGTCAGCGAAGATCTCTCGCCAGCGGTCAACCTTAGCAGTATGCC 388
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      TTTTACAGTTTTAACACTCTTTAGAAATCCGTTATGTAAATTCAATTAGTGAATTAT--- 577
                                                                                  

consensus_9434#0      ACCTCGTCTCAGATGCAAGAATAAAGGTTTCCTCGCTTGGTACGGCGCCTGTCCATCTTC 716
consensus_9434#1      ACCTCGTCTCAGATGCAAGAATAAAGGTTTCCTCGCTTGGTACGGCGCCTGTCTATCTTC 448
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      AAGTAATCGAAAAAACAAGCCAAAAAT--------------------------------- 604
                                                                                  

consensus_9434#0      GAGGCAGCCAAGCTCGGTCCCCCCACAGGAACCTAGGGATATCTTCGTCTGTTCGGAACA 776
consensus_9434#1      GAGGCAGCCAAGCTCGGTCCCCCCACAGGAACCTAGGGATATCTTCGTCTGTTCGGAACA 508
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      GTTGTCTGCCAACCCAATTCTGTCTCCACCTCAGGATCCTGATAGCACGAGATCGCCACC 836
consensus_9434#1      GTTGTCTGCCAACCCAGTTCTGTCTCCACCTCAGGATCCTGATAGCACGAGATCGCCACC 568
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      TCCGACATTGAGTGGCCCCTCAGCTGCTGAGCAAATCAGAAGAGCTCTAGCAGGTCTAAG 896
consensus_9434#1      TCCGACATTGAGTGGCCCCTCAGCTGCTGAGCAAATCAGAAGAGCTCTAGCAGGTCTAAG 628
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      TCCAGAAGGATCTATTCACTCTGCTTCACTCTCTCCAGGTCGGGTGCCAGTCATTACTTC 956
consensus_9434#1      TCCAGAAGGATCTATTCACTCTGCTTCACTCTCTCCAGGTCGGGTGCCAGTCATTACTTC 688
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      CGATGACACTACTGCCGCGCAGGACTTTGCTTTTGGGGAACCAGATCCAGTTAACATATC 1016
consensus_9434#1      CGATGACACTACTGCTGCGCAGGACTTTGCTTTTGGGGAACCAGATCCAGTTAACATATC 748
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      AGGAGACAGTGACGATGATATTCTTGATATCTTTATCCCCTTTGTTGACATGAGAGTAAC 1076
consensus_9434#1      AGGAGACAGTGACGATGATATTCTTGATATCTTTATCCCCTTTGTTGACATGAGAGTAAC 808
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      TGCTCATTACGCCACTGCTTATGTTACCCCTCCATGTGAATGCCCTGGCAGAGTAATTCG 1136
consensus_9434#1      TGCTCATTACGCCACTGCTTATGTTACCCCTCCATGTGAATGCCCTGGCAGAGTAATTCG 868
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      AAAAGCAATGCAGGATGCTCACCCTCGTTTTCAGTTCACTCTCATCTCAGCTTGTAGAGG 1196
consensus_9434#1      AAAAGCAATG-------------------------------------------------- 878
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      TGCAATGACTCTAAGATTTATTCACAGTCAGGACAGAGACATTGCAGTTGATCACCAGGA 1256
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      GAATCTTACAGCTGAAGGCCACTTGGTTAGGCTTGAACGGCCTGAGGACAGTGCGGCTCG 1316
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      CTTCATTCAACACAACACTATGCTGTCCGAACTAGACTGTATTGACTTCCCGCCAGAGAT 1376
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      GTTGTTCCCTAACAAGATAAGAAATGCTTTTGAAAATTACGGCGAGCTGATGGAAGTAGA 1436
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      TGATCAATGCCTCTATGGGGACGAACAATCCTCTCTGCGTCTTGTTGTTCTGCACTATCC 1496
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      TGGCAAGAGGATGAGCCCTAGATTTCGGCTGCGCTACAATTTGGGGATTGTCTGCACTGT 1556
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      CTATGTCAGGGTTCTAAGAACATGGGAGCTGGCCATGAACGTGGATGAAGATGGAAATTA 1616
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      CATTAAGCATTATGAACAGTTTCTATTCCCTCATCAGCTGGATCCTCCCCGTTCAGGACC 1676
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      AACTGTTGGACCAGAGGCAGAGTTGGGCAACTTGAATCAGGCTCCTTCAAATCAAATCTC 1736
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      TAACAACCAAAGACTTCAGAACAGGGGAAGATTGCTTGCGATTCTGCCTGCAGCTAGCAC 1796
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      TGTCTTCATTGAGGAAATCTCTGATACACCTGAATTTTTTGTCCCTCCGTCAATCCATTC 1856
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      TGCTCCCTCCAGTATCCATGACTGCCTCCAGGACCTCGTGCCCTCAGATACTGAAAATGA 1916
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      ACATGAGCTTTCAGCCCGGAAACGCAGAAGGCAGAAGAAACGGACAATTGATTCAGATGT 1976
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      CAAGAGGCGATATAGCGAAAGACTGGCGGCCAAAGAAGGACATTTGTACATTTCAATGGA 2036
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      ATCCAAAGCAGCCAGAGCGAAAAAACTAAAGGAACAACTTGCCAAATGCTCATCCAAACT 2096
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      CAATGACGCGGTACACAAGCACAATCTGCTCGACCTTAACTTCAAGACTACTCCGAAAGC 2156
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      GTTGGAAGATCTGGCTATTGCTTGCAGTTTGAATGATCACGATATTGCCCAGCTTCGAAA 2216
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      GGTGTTCTCGTCAGTGGACTGATGGTGATCAATACCCTCAATGGGATGGACAAGCCCAGC 2276
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      ATGCGTCTGCTTCTCTCCCTTTGTTATGTTCTTTCAGCTCTTCTTCAGTTCTCTAGTGTC 2336
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      TTCTCTCCCTTCGGTATGGTCTCTTTCAGGCTATTTACTCCATGTAAGCTGGATTATGTG 2396
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      ATGCTGGGGCCTTTTGCTCTTGGGTCTGGCATGNGCTATTTCGGNGAACCTATTNTTTTT 2456
consensus_9434#1      ------------------------------------------------------------
consensus_9434#3      ------------------------------------------------------------
consensus_9434#2      ------------------------------------------------------------
                                                                                  

consensus_9434#0      TNAAAAAAAAAGAAAAAAAAAAAAGCGGNCGCCANCGG 2494
consensus_9434#1      --------------------------------------
consensus_9434#3      --------------------------------------
consensus_9434#2      --------------------------------------
                                                            




Copyright Mon Feb 16 12:49:02 CET 2004 Hubert Wassner    (hubert.wassner@noos.fr)