These datas are free for academic use only, please contact me for any other use. Schistosoma mansoni see consensus multiple alignment with clustalw Direct access to contigs :
consensusID : consensus_1471#0 NCBI blastX ! send the sequence to the NCBI site ! NCBI blastN ! send the sequence to the NCBI site ! Sequences nbr = 1 consensus length = 98 fasta sequence [GGCCCCCGGCAAGCTATCCGGTTCAATTTCAGGCTTGATTCAGGCCTGCAATCAAGCCAGCTATCCGGTTCAATGCATGATGGTGAATCAAGTGTGCC] [+] EMBL CD060957 [GGCCCCCGGCAAGCTATCCGGTTCAATTTCAGGCTTGATTCAGGCCTGCAATCAAGCCAGCTATCCGGTTCAATGCATGATGGTGAATCAAGTGTGCC] consensusID : consensus_1471#1 NCBI blastX ! send the sequence to the NCBI site ! NCBI blastN ! send the sequence to the NCBI site ! Sequences nbr = 1 consensus length = 84 fasta sequence [GGCACCCCTTGATTGCAGGCTTGATTGCAGGCTTTCCAGGCTTGATTGCAGGCGCACACTTGATTCACCATCATGCATTGAACC] [+] EMBL CD060951 [GGCACCCCTTGATTGCAGGCTTGATTGCAGGCTTTCCAGGCTTGATTGCAGGCGCACACTTGATTCACCATCATGCATTGAACC] consensus multiple alignement with clustalw CLUSTAL W (1.82) multiple sequence alignment consensus_1471#0 GGCCCCCGGCAAGCTATCCGGTTCAATTTCAGGCTTGATTCAGGCCTGCAATCAAGCCAG 60 consensus_1471#1 GGCACCCCTTGA--TTGCAGGCTTGATTGCAGGCTT--TCCAGGCTTG-ATTGCAGGCGC 55 *** *** * * * ** * *** ******* * ***** ** * * ** * consensus_1471#0 CTATCCGGTTCAATGCATGATGGTGAATCAAGTGTGCC 98 consensus_1471#1 ACACTTGATTCACCATCATGCATTGAACC--------- 84 * * **** **** * |
Copyright Thu Nov 6 12:32:27 CET 2003 Hubert Wassner (hubert.wassner@noos.fr) | ||||