[BiO BB] Blast Output statistics - xml vs plain text
Stefan Schuster
sschuster at clcbio.com
Fri Nov 3 06:23:05 EST 2006
Hello,
performing a blastx search against RefSeq using the NCBI webblast
(details below), the statistics section of the text output contains
amongst others following lines:
Length of database: 926984281
Length adjustment: 36
Effective length of query: 157
Effective length of database: 834733201
Effective search space: 23372529628
Effective search space used: 23372529628
The statics section of the xml output for exactly the same search (same RID) contains amongst others follwing entries:
<Statistics_db-len>926984281</Statistics_db-len>
<Statistics_hsp-len>0</Statistics_hsp-len>
<Statistics_eff-space>0</Statistics_eff-space>
How can the difference between "Effective search space" in the text
output and "Statistics_eff-space" int the xml output be explained?
Which field in the xml output reffers to which field in the html output?
Is there a detailed description for all values of the statistics section
available?
thanks in advance for helping
Stefan
details for blast query:
RID: 1162550444-15189-25311546969.BLASTQ2
Programm: blastx
database: refseq
all other parameters have default settings.
used query sequence:
>testsequence1
CCGCCCGCCCGCCCGCAGGGACCACGCGCGGGGAAACCCGGAGCTGGCGCGGCTTCGTCC
CGGGCTGGCGGTGCTGGGCGCGGACGAGCGCATCTTCTCGCTGACGCGCAGGCTGGCGCA
CGGCGAGGAGCTGCGGGTGAGCGCGCGCTCCCGGGAGGGGCGGGGAGGGCGCCCCGGGTC
CACCCGCCCTCAC
More information about the BBB
mailing list